Loading...
HomeMy WebLinkAboutItem 10e - 2025 Urban Water Management Plan and Water Shortage Contingency Plan STAFF REPORT PUBLIC WORKS SERVICES DEPARTMENT DATE: June 16, 2026 TO: Honorable Mayor and City Council FROM: Paul Cranmer, Public Works Services Director By: Rebecca Cardenas, Management Analyst SUBJECT: RESOLUTION NO. 7702 ADOPTING THE CITY OF ARCADIA’S 2025 URBAN WATER MANAGEMENT PLAN AND WATER SHORTAGE CONTINGENCY PLAN CEQA: Exempt Recommendation: Adopt SUMMARY To comply with the California Urban Water Management Planning Act, the City of Arcadia is required to adopt an Urban Water Management Plan (“UWMP”) every five years. The UWMP is a planning document that supports the City’s long-range water resources planning to ensure adequate water supplies are available to meet existing and future water demands. A water supplier must have a current UWMP on file to be eligible for any water grant or loan administered by the State Department of Water Resources (“DWR”). The 2025 UWMP provides an assessment of Arcadia’s water service reliability, and describes and evaluates sources of water supply, efficient uses of water, demand management measures, and other relevant information and programs. In addition, the plan includes an evaluation of frequent and severe periods of droughts, as described in the Drought Risk Assessment, and requires the preparation and adoption of a Water Shortage Contingency Plan (“WSCP”). This is especially important in years when drought conditions are anticipated. Resolution No. 7702 Adopting the 2025 Urban Water Management Plan and Water Shortage Contingency Plan June 16, 2026 Page 2 of 6 It is recommended that the City Council adopt Resolution No. 7702, adopting the City of Arcadia’s 2025 Urban Water Management Plan and Water Shortage Contingency Plan. BACKGROUND The Urban Water Management Planning Act (“Act”) of 1983 requires every urban water supplier that provides more than 3,000 acre-feet of water annually or serves more than 3,000 urban water connections, to submit an UWMP every five years. Since the original Act, subsequent legislative requirements have been incorporated into the California Water Code to expand the scope of water management planning. The UWMP requires demonstration of water supply reliability in normal, single dry years, multiple dry years, and other adverse conditions. As stipulated in Senate Bill 606, the 2025 UWMP must be adopted by July 1, 2026, and submitted to the DWR within 30 days of adoption. There are a number of requirements for the 2025 UWMP that build upon updates introduced in prior UWMP cycles. The required chapters in the 2025 UWMP update include: • Urban Water Management Plan Introduction and Overview The City’s 2025 Plan was prepared consistent with the recommended organization provided in the DWR’s Final “Urban Water Management Plan Guidebook 2025.” • Plan Preparation The City’s Plan has been prepared as an “individual” plan rather than a “regional” plan to provide information specific to the City to best inform its employees, management, and customers. Information presented in the City’s 2025 Plan is provided on a “Fiscal Year” basis, which is from July 1 through June 30 of the following year. • Service Area Description The City provides water service to a majority of the City of Arcadia and encompasses an area of approximately 11 square miles. The City of Arcadia is positioned in the north-central area of the San Gabriel Valley, extending Resolution No. 7702 Adopting the 2025 Urban Water Management Plan and Water Shortage Contingency Plan June 16, 2026 Page 3 of 6 northward into the southerly slopes of the San Gabriel Mountains, and lies northeast of the City of Los Angeles. • Water Use Characterization The City provides water service to individual “water use sectors.” These water use sectors include single-family residential, multi-family residential, commercial, and landscape. • SB X7-7 Baselines, 2020 Targets, and 2025 Reporting SB X7-7 required urban water suppliers, including the City, to develop a “2020 Water Use Target” to assist the State of California to achieve the 20% reduction. The 2020 Water Use Target represents the amount of water each person should use per day (i.e. gallons per capita per day or “GPCD”) by the year 2020. The City previously determined its 2020 Water Use Target during the preparation of its 2015 Plan by completing standardized tables (or the SB X7-7 Verification Form) to demonstrate compliance with the Water Conservation Act of 2009. The City’s 2020 Water Use Target was 238 GPCD. • Normal-Year Water Supply Characterization Details regarding the City’s groundwater supplies from the Main Basin and Raymond Basin is provided. Information regarding basin location, adjudication, management, water levels, water quality, water rights, and historical production is provided. • Water Service Reliability and Drought Risk Assessment The reliability of the City’s water supply sources, including a review of water supply constraints, is provided in the 2025 UWMP. A single dry year or a five consecutive year drought period will not compromise the City’s ability to provide a reliable supply of water to its customers. The City’s Drought Risk Assessment assumes a five consecutive year drought from FY 2025-26 through FY 2029-30, and includes a review of water supplies, water uses, and water supply reliability for each water supply source during this period. Resolution No. 7702 Adopting the 2025 Urban Water Management Plan and Water Shortage Contingency Plan June 16, 2026 Page 4 of 6 • Water Shortage Contingency Plan The City’s WSCP outlines how the City will respond in the event of a water supply shortage. The UWMP incorporates this WSCP and details specific response actions for varying levels of water shortage. • Demand Management Measures The City has implemented “Demand Management Measures” to reduce its water demands and achieve its water use targets, which includes adoption of an ordinance to prevent water waste. • Plan Adoption, Submittal, and Implementation The City has completed all necessary requirements listed by the Department of Water Resources to ensure full compliance with the California Urban Water Management Planning Act. DISCUSSION Key requirements among the 2025 UWMP is for the City to demonstrate compliance with Senate Bill X7-7 the Water Conservation Act of 2009, also known as the “20% by 2020” requirement. Enacted in 2009, this legislation called for a statewide 20% per capita water use reduction in the span of 10 years by 2020. The City previously determined its 2020 Water Use Target during the preparation of its 2015 UWMP by completing standardized tables (or the SB X7-7 Verification Form) to demonstrate compliance with the Water Conservation Act of 2009. The City’s 2020 Water Use Target was 238 GPCD. The City’s per-capita water use during Fiscal Year 2019-20 was 230 GPCD. The City’s per-capita water use during Fiscal Year 2019-20 met the 2020 Water Use Target. The table below shows the Senate Bill X7-7 2020 target was met: Resolution No. 7702 Adopting the 2025 Urban Water Management Plan and Water Shortage Contingency Plan June 16, 2026 Page 5 of 6 On June 1, 2026, and June 8, 2026, a notice of public hearing for the UWMP was published in the City’s local adjudicated newspaper. The 2025 UWMP and WSCP are available for public review on the City website at ArcadiaCA.gov/UWMP and physical copies are located at the Public Works Services Department. To date, no comments have been received. The City’s 2025 UWMP and WSCP have been prepared in accordance with all legislative requirements and in the format required by the DWR. Therefore, it is recommended that, upon conclusion of the public hearing, the City Council adopt Resolution No. 7702 adopting the City’s 2025 Urban Water Management Plan and Water Shortage Contingency Plan. ENVIRONMENTAL ANALYSIS The update to the Urban Water Management Plan is exempt from the California Environmental Quality Act (“CEQA”), under Section 15282 (v) of the California Environmental Quality Act Guidelines. FISCAL IMPACT There is no fiscal impact in adopting Resolution No. 7702. RECOMMENDATION It is recommended that the City Council find that the following resolution is categorically exempt pursuant to the California Environmental Quality Act (“CEQA”); and adopt Resolution No. 7702 adopting the City of Arcadia’s 2025 Urban Water Management Plan and Water Shortage Contingency Plan. Resolution No. 7702 Adopting the 2025 Urban Water Management Plan and Water Shortage Contingency Plan June 16, 2026 Page 6 of 6 Attachments: Resolution No. 7702 2025 Urban Water Management Plan and Water Shortage Contingency Plan 2025 Urban Water Management Plan Appendices M AY 2026 FINAL D RAFT 99999.92100\45048348.1 City of Arcadia 2025 Urban Water Management Plan 99999.92100\45048348.1 TABLE OF CONTENTS Page i CHAPTER 1 ............................................................................................................................ 1-1 URBAN WATER MANAGEMENT PLAN INTRODUCTION AND OVERVIEW ............................... 1-1 UPDATED GUIDANCE FOR 2025 URBAN WATER MANAGEMENT PLANS ........................ 1-4 SUBMITTAL TABLES .......................................................................................................... 1-5 INCLUSION OF SUBMITTAL TABLES .................................................................... 1-5 OPTIONAL PLANNING TOOL ............................................................................... 1-6 RECOMMENDED UWMP ORGANIZATION ....................................................................... 1-6 UWMPS IN RELATION TO OTHER EFFORTS ...................................................................... 1-7 SPECIFIC CONSIDERATIONS ................................................................................ 1-7 DEPARTMENT OF WATER RESOURCES’ REVIEW PROCESS .............................................. 1-9 UWMPS AND GRANT OR LOAN ELIGIBILITY ..................................................................... 1-9 TIPS FOR URBAN WATER MANAGEMENT PLAN PREPARES ........................................... 1-10 CHAPTER 2 ............................................................................................................................ 2-1 PLAN PREPARATION ............................................................................................................. 2-1 BASIS FOR PREPARING A PLAN ........................................................................................ 2-2 SUPPLIERS WITH BOTH WHOLESALE AND RETAIL SALES .................................... 2-3 PUBLIC WATER SYSTEMS .................................................................................... 2-4 INDIVIDUAL OR REGIONAL PLANS ................................................................................... 2-5 REGIONAL REPORTING ........................................................................................ 2-5 FISCAL OR CALENDAR YEAR AND UNITS OF MEASURE .................................................... 2-6 FISCAL OR CALENDAR YEAR ................................................................................ 2-6 UNITS OF MEASURE ............................................................................................ 2-6 COORDINATION AND OUTREACH .................................................................................... 2-6 WHOLESALE AND RETAIL COORDINATION ......................................................... 2-7 COORDINATION WITH OTHER AGENCIES AND THE COMMUNITY ..................... 2-7 NOTICE TO CITIES AND COUNTIES ...................................................................... 2-8 SUBMITTAL TABLES .......................................................................................................... 2-9 SUBMITTAL TABLE 2-1: PWSs ............................................................................. 2-9 SUBMITTAL TABLE 2-2: PLAN TYPE IDENTIFICATION ........................................ 2-10 SUBMITTAL TABLE 2-3: SUPPLIER INFORMATION ............................................ 2-11 SUBMITTAL TABLE 2-4: WATER SUPPLIER INFORMATION EXCHANGE ............ 2-12 CHAPTER 3 ............................................................................................................................ 3-1 SERVICE AREA DESCRIPTION ................................................................................................. 3-1 GENERAL DESCRIPTION .................................................................................................... 3-2 SERVICE AREA BOUNDARY MAPS .................................................................................... 3-3 SERVICE AREA CLIMATE ................................................................................................... 3-4 SERVICE AREA POPULATION AND DEMOGRAPHICS ........................................................ 3-6 SERVICE AREA POPULATION ............................................................................... 3-6 OTHER SOCIAL, ECONOMIC, AND DEMOGRAPHIC FACTORS ............................. 3-8 TABLE OF CONTENTS (Continued) Page ii 3-8 LAND USES WITHIN SERVICE AREA .................................................................................. 3-9 SUBMITTAL TABLES ........................................................................................................ 3-10 SUBMITTAL TABLE 3-1: POPULATION - CURRENT AND PROJECTED ................. 3-10 CHAPTER 4 ............................................................................................................................ 4-1 WATER USE CHARACTERIZATION .......................................................................................... 4-1 NON-POTABLE VERSUS POTABLE WATER USE ................................................................ 4-2 PAST, CURRENT, AND PROJECTED WATER USE BY SECTOR ............................................. 4-2 WATER-USE SECTORS LISTED IN WATER CODE .................................................. 4-4 OPTIONAL WATER-USE SECTORS IN ADDITION TO THOSE LISTED IN WATER CODE ...................................................................................................... 4-6 PAST WATER USE ................................................................................................ 4-6 CURRENT WATER USE ......................................................................................... 4-6 PROJECTED WATER USE ...................................................................................... 4-7 DISTRIBUTION SYSTEM WATER LOSS ............................................................................. 4-24 PREVIOUS FIVE YEARS DISTRIBUTION SYSTEM LOSSES .................................... 4-24 PROGRESS TOWARD MEETING THE WATER LOSS PERFORMANCE STANDARD ........................................................................................................ 4-25 SUBMITTAL TABLES ........................................................................................................ 4-26 TABLE 4-1: TOTAL USES FOR POTABLE AND NON-POTABLE WATER- ACTUAL ............................................................................................................. 4-27 TABLE 4-2: TOTAL USES OF POTABLE AND NON-POTABLE WATER— PROJECTED ........................................................................................................ 4-28 TABLE 4-3: INCLUSION IN WATER-USE PROJECTIONS ...................................... 4-29 OPTIONAL TABLE 4-4: PASSIVE WATER SAVINGS PROJECTION ........................ 4-29 TABLE 4-5: WATER LOSS AUDIT REPORTING .................................................... 4-30 TABLE 4-6: PROGRESS TOWARD 2028 WATER LOSS STANDARD ..................... 4-31 CHAPTER 5 ............................................................................................................................ 5-1 SB X7-7 BASELINE, 2020TARGETS, 2025 REPORTING ............................................................. 5-1 REPORTING REQUIREMENTS FOR WHOLESALE SUPPLIERS ............................................. 5-2 REPORTING REQUIREMENTS FOR RETAIL SUPPLIERS ...................................................... 5-2 SUPPLIER WAS NOT AN URBAN RETAIL WATER SUPPLIER ................................. 5-3 SUPPLIER MET 2020 TARGET IN 2020 ................................................................. 5-3 SUPPLIER DID NOT MEET 2020 TARGET IN 2020—NO CHANGE TO SERVICE AREA ..................................................................................................... 5-4 SUPPLIER DID NOT MEET 2020 TARGET—CHANGE TO SERVICE AREA SINCE 2020 .......................................................................................................... 5-4 FUNDING ELIGIBILITY .......................................................................................... 5-4 NEXUS TO STATE WATER BOARD URBAN WATER-USE OBJECTIVES (NOT REQUIRED FOR UWMPs) ..................................................................................... 5-5 TABLE OF CONTENTS (Continued) Page iii SUBMITTAL TABLES .......................................................................................................... 5-7 CHAPTER 6 ............................................................................................................................ 6-1 NORMAL YEAR WATER SUPPLY CHARACTERIZATION ............................................................ 6-1 WATER SUPPLY ANALYSIS OVERVIEW ............................................................................. 6-2 SPECIFIC ANALYSIS APPLICABLE TO ALL WATER SUPPLY SOURCES .................... 6-4 SPECIAL CONSIDERATIONS ................................................................................. 6-6 WATER SUPPLY CHARACTERIZATION ............................................................................... 6-7 PURCHASED OR IMPORTED WATER ................................................................... 6-7 GROUNDWATER................................................................................................ 6-10 SURFACE WATER ............................................................................................... 6-38 STORMWATER .................................................................................................. 6-39 WASTEWATER AND RECYCLED WATER............................................................. 6-39 DESALINATED WATER OPPORTUNITIES ............................................................ 6-46 WATER EXCHANGES AND TRANSFERS .............................................................. 6-47 SUPPLY FROM STORAGE ................................................................................... 6-49 OTHER ............................................................................................................... 6-49 FUTURE WATER PROJECTS ................................................................................ 6-49 ENERGY USE ................................................................................................................... 6-50 SUBMITTAL TABLES ........................................................................................................ 6-54 TABLE 6-1: GROUNDWATER VOLUME PUMPED ............................................... 6-54 TABLE 6-2: WASTEWATER COLLECTED WITHIN SERVICE AREA ........................ 6-55 TABLE 6-3: WASTEWATER TREATMENT AND OUTCOMES WITHIN UWMP SERVICE AREA ................................................................................................... 6-56 TABLE 6-4: RECYCLED WATER DIRECT BENEFICIAL USES WITHIN SERVICE AREA .................................................................................................................. 6-57 TABLE 6-5: 2020 UWMP RECYCLED WATER-USE PROJECTION COMPARED TO 2025 ACTUAL ........................................................................... 6-58 TABLE 6-6: METHODS TO ENCOURAGE FUTURE RECYCLED WATER USE ......... 6-59 TABLE 6-7: EXPECTED FUTURE WATER SUPPLY PROJECTS OR PROGRAMS ..... 6-60 TABLE 6-8: WATER SUPPLIES—ACTUAL ............................................................ 6-60 OPTIONAL TABLE 6-8DS: SOURCE DESALINATION BY SUPPLIER ...................... 6-62 TABLE 6-9: WATER SUPPLIES—PROJECTED ...................................................... 6-63 CHAPTER 7 ............................................................................................................................ 7-1 WATER SERVICE RELIABILITY AND DROUGHT RISK ASSESSMENT .......................................... 7-1 CONSTRAINTS ON WATER SOURCES CONSIDERATIONS .................................................. 7-2 SERVICE RELIABILTY - CONSTRAINTS ON WATER SOURCES ............................... 7-3 WATER SERVICE RELIABILITY ASSESSMENT ..................................................................... 7-4 WSRA YEAR-TYPE CHARACTERIZATION .............................................................. 7-8 WSRA SUPPLY AND DEMAND COMPARISON ..................................................... 7-9 WSRA DESCRIPTION OF MANAGEMENT TOOLS AND OPTIONS ....................... 7-11 TABLE OF CONTENTS (Continued) Page iv DROUGHT RISK ASSESSMENT ........................................................................................ 7-13 DRA, DATA, METHODS, AND BASIS FOR WATER SHORTAGE CONDITIONS ...... 7-14 DRA INDIVIDUAL WATER SOURCE RELIABILITY ................................................ 7-16 DRA TOTAL WATER SUPPLY AND USE COMPARISON ....................................... 7-19 OPTIONAL PLANNING TOOL WORKBOOK ...................................................................... 7-19 SUBMITTAL TABLES ........................................................................................................ 7-20 OPTIONAL TABLE 7-1: BASIS OF WATER-YEAR DATA (WSRA) .......................... 7-20 TABLE 7-2: NORMAL-YEAR SUPPLY AND USE COMPARISON ............................ 7-21 TABLE 7-3: SINGLE-DRY-YEAR SUPPLY AND USE COMPARISON ....................... 7-22 TABLE 7-4: MULTIPLE DRY YEARS SUPPLY AND USE COMPARISON ................. 7-23 TABLE 7-5: FIVE-YEAR DROUGHT RISK ASSESSMENT ........................................ 7-24 CHAPTER 8 ............................................................................................................................ 8-1 WATER SHORTAGE CONTINGENCY PLAN .............................................................................. 8-1 WATER SUPPLY RELIABILITY ANALYSIS ............................................................................ 8-3 ANNUAL WATER SUPPLY AND DEMAND ASSESSMENT PROCEDURES ............................ 8-4 DECISION-MAKING PROCESS .............................................................................. 8-5 DATA AND METHODOLOGIES ............................................................................. 8-6 SIX STANDARD WATER SHORTAGE LEVELS ...................................................................... 8-8 SHORTAGE RESPONSE ACTIONS ...................................................................................... 8-9 SUPPLY AUGMENTATION .................................................................................. 8-10 DEMAND REDUCTION ....................................................................................... 8-12 OPERATIONAL CHANGES .................................................................................. 8-16 ADDITIONAL MANDATORY RESTRICTIONS ....................................................... 8-17 EMERGENCY RESPONSE PLAN .......................................................................... 8-17 SEISMIC RISK ASSESSMENT AND MITIGATION PLAN ........................................ 8-18 SHORTAGE RESPONSE ACTION EFFECTIVENESS ............................................... 8-21 COMMUNICATION PROTOCOLS .................................................................................... 8-23 COMPLIANCE AND ENFORCEMENT ............................................................................... 8-24 LEGAL AUTHORITIES....................................................................................................... 8-26 FINANCIAL CONSEQUENCES OF WSCP .......................................................................... 8-27 MONITORING AND REPORTING ..................................................................................... 8-28 WSCP REFINEMENT PROCEDURES ................................................................................. 8-29 SPECIAL WATER FEATURE DISTINCTION ........................................................................ 8-30 PLAN ADOPTION, SUBMITTAL, AVAILABILITY, AND AMENDMENT PROCEDURES......... 8-31 RESOURCES AND REFERENCES....................................................................................... 8-32 SUBMITTAL TABLES ........................................................................................................ 8-32 TABLE 8-1: CROSS REFERENCE FOR STANDARD VS. SUPPLIER SHORTAGE LEVELS ............................................................................................................... 8-33 TABLE 8-2: SUPPLY AUGMENTATION AND OTHER ACTION .............................. 8-34 TABLE 8-3: DEMAND-REDUCTION ACTIONS ..................................................... 8-35 TABLE OF CONTENTS (Continued) Page v CHAPTER 9 ............................................................................................................................ 9-1 DEMAND MANAGEMENT MEASURES ................................................................................... 9-1 DEMAND MANAGEMENT MEASURES FOR RETAIL SUPPLIERS ........................................ 9-2 IMPLEMENTATION OVER THE PAST FIVE YEARS ................................................. 9-2 IMPLEMENTATION TO ACHIEVE WATER USE TARGETS ...................................... 9-5 REQUIRED DEMAND MANAGEMENT MEASURES ............................................... 9-5 DEMAND MANAGEMENT MEASURES FOR WHOLESALE SUPPLIERS ............................. 9-12 CHAPTER 10 ........................................................................................................................ 10-1 PLAN ADOPTION, SUBMITTAL, AND IMPLEMENTATION ..................................................... 10-1 PLAN COMPLETION TIMELINE ....................................................................................... 10-2 NOTICE OF PLAN PREPARATION .................................................................................... 10-2 NOTICE OF PUBLIC HEARING ......................................................................................... 10-3 PUBLIC HEARING AND ADOPTION ................................................................................. 10-4 PLAN SUBMITTAL ........................................................................................................... 10-5 SUBMITTING A UWMP AND WATER SHORTAGE CONTINGENCY PLAN TO DWR .................................................................................................................. 10-6 ELECTRONIC DATA SUBMITTAL......................................................................... 10-6 SUBMITTING A UWMP, INCLUDING WSCP, TO THE CALIFORNIA STATE LIBRARY ............................................................................................................. 10-7 SUBMITTING A UWMP TO CITIES AND COUNTIES ............................................ 10-7 PUBLIC AVAILABILITY ..................................................................................................... 10-8 NOTIFICATION TO PUBLIC UTILITIES COMMISSION ....................................................... 10-8 PLAN IMPLEMENTATION ............................................................................................... 10-9 AMENDING AN ADOPTED UWMP OR WATER SHORTAGE CONTINGENCY PLAN .......... 10-9 AMENDING A UWMP OR WSCP ........................................................................ 10-9 AMENDING A WATER SHORTAGE CONTINGENCY PLAN ................................ 10-10 CALIFORNIA DEPARTMENT OF WATER RESOURCES REVIEW OF SUBMITTED PLANS ........................................................................................................................... 10-10 SUBMITTAL TABLES ...................................................................................................... 10-11 SUBMITTAL TABLE 10-1: NOTIFICATION TO CITIES AND COUNTIES ............... 10-11 TABLE OF CONTENTS (Continued) vi LIST OF TABLES Table 2-1 Public Water Systems ................................................................................................................... 2-9 Table 2-2 Plan Type Identification .............................................................................................................. 2-10 Table 2-3 Supplier Information ................................................................................................................... 2-11 Table 2-4 Water Supplier Information Exchange........................................................................................ 2-1 2 Table 3-1: Population - Current and Projected ............................................................................................ 3-10 Table 4-1 Total Uses for Potable and Non-Potable Water - Actual ............................................................ 4-27 Table 4-2 Total Uses for Potable and Non-Potable Water - Projected ....................................................... 4-28 Table 4-3 Inclusion in Water-Use Projections ............................................................................................. 4-29 Table 4-4 Passive Savings Projection .......................................................................................................... 4-29 Table 4-5 Water Loss Audit Reporting ........................................................................................................ 4-30 Table 4-6 Progress Toward 2028 Water Loss Standard .............................................................................. 4-31 Table 5-1 SB X7-7 2020 Target Progress ....................................................................................................... 5-7 Table 6-1 Groundwater Volume Pumped ................................................................................................... 6 -54 Table 6-2 Wastewater Collected Within Service Area ................................................................................ 6-55 Table 6-3 Wastewater Treatment and Outcomes Within UWMP Service Area ......................................... 6-56 Table 6-4 Recycled Water Direct Beneficial Uses Within Service Area ...................................................... 6-57 Table 6-5 2020 UWMP Recycled Water-Use Projection Compared to 2025 Actual .................................. 6-58 Table 6-6 Methods to Encourage Future Recycled Water Use ................................................................... 6-59 Table 6-7 Expected Future Water Supply Projects or Programs ................................................................ 6-60 Table 6-8 Water Supplies—Actual .............................................................................................................. 6-62 Table 6-9 Water Supplies—Projected ......................................................................................................... 6-63 Table 7-1 Basis of Water-Year Data (Reliability Assessment) ..................................................................... 7-20 Table 7-2 Normal-Year Supply and Use Comparison .................................................................................. 7-21 Table 7-3 Single-Dry-Year Supply and Use Comparison ............................................................................. 7-22 Table 7-4 Multiple Dry Years Supply and Use Comparison ........................................................................ 7-23 Table 7-5 Five-Year Drought Risk Assessment ............................................................................................ 7-24 Table 8-1 Cross-Reference for Standard vs. Supplier Shortage Levels ....................................................... 8-33 Table 8-2 Supply Augmentation and Other Actions ................................................................................... 8-34 Table 8-3 Demand-Reduction Actions ........................................................................................................ 8-35 Table 10-1 Notification to Cities and Counties ........................................................................................... 10-11 TABLE OF CONTENTS (Continued) vii LIST OF FIGURES Figure 1 Water Service Area Figure 2 Water Service Area and City Boundaries Figure 3 Main Basin Location Figure 4 Raymond Basin Location TABLE OF CONTENTS (Continued) viii LIST OF APPENDICES Appendix A DWR Standardized Tables Appendix B Completed Plan Checklist Appendix C Demonstration of Reduced Imported Water Reliance Appendix D Notification Letters and Notices of Public Hearing Appendix E Climate Change Considerations (Cal-Adapt Data) Appendix F Long Beach Judgment Appendix G Main Basin Judgment Appendix H Raymond Basin Adjudication Appendix I Draft Recycled Water Feasibility Study Appendix J Water Conservation Plan Appendix K City of Arcadia Local Hazard Mitigation Plan Appendix L Los Angeles County All-Hazard Mitigation Plan Appendix M Water Rate Structure Appendix N Ordinance 2327 and Resolution 7430 Appendix O Resolution Adopting 2025 UWMP and WSCP TABLE OF CONTENTS (Continued) ix LIST OF ACRONYMS AB Assembly Bill AF Acre-feet AFY Acre-feet per year Annual Assessment Annual Water Supply and Demand Assessment AWWA American Water Works Association BPOU Baldwin Park Operable Unit CECs Constituents of emerging concern Central District Central Basin Municipal Water District CII Commercial, Industrial, and Institutional CIMIS California Irrigation Management Information System City City of Arcadia CWC California Water Code CWEA Cooperative Water Exchange Agreement DACs Disadvantaged Communities DMMs Demand Management Measures DOF Department of Finance DPW Department of Public Works DRA Drought Risk Assessment DWR Department of Water Resources ERP Emergency Response Plan ETo Evapotranspiration FY Fiscal Year GCMs General Circulation Models GIS Geographical Information Systems GPCD Gallons per capita per day GSP Groundwater Sustainability Plan HERO Home Energy Renovation Opportunity JPL Jet Propulsion Laboratory JWPCP Joint Water Pollution Control Plant Key Well Baldwin Park Key Well kWh Kilowatt Hours LACSD Los Angeles County Sanitation District LAEEF Los Angeles County Environmental Education Fair LARWQCB Los Angeles Regional Water Quality Control Board M&I Municipal and Industrial Main Basin Main San Gabriel Basin MGD Million Gallons Per Day mg/l Milligrams per liter MSL Mean seal level MWD Metropolitan Water District of Southern California NASA National Aeronautics and Space Administration NCP National Contingency Plan NDMA N-nitrosodimethylamine OSY Operating Safe Yield TABLE OF CONTENTS (Continued) x Plan Urban Water Management Plan PCE Perchloroethylene PHET Premium High Efficiency Toilet RCP Representative Concentration Pathway RDA Main Basin Resource Development Assessment RDA II Main Basin Water Resource Development Assessment for Stormwater Augmentation Program RDM Robust Decision Making ROD Records of Decision RRA Risk and Resilience Assessment San Gabriel District San Gabriel Valley Municipal Water District SB Senate Bill SCAG Southern California Association of Governments SCE Southern California Edison SGMA Sustainable Groundwater Management Act of 2014 SJCWRP San Jose Creek Water Reclamation Plant SNMP San Gabriel Valley Salt and Nutrient Management Plan SWP State Water Project SWRCB-DDW State Water Resources Control Board - Division of Drinking Water TCE Trichloroethylene TDS Total Dissolved Solids Three Valleys District Three Valleys Municipal Water District Upper Water Upper San Gabriel Valley Municipal Water District USEPA U.S. Environmental Protection Agency UWMP Urban Water Management Plan VOCs Volatile Organic Compounds WNWRP Whittier Narrows Water Reclamation Plant WQA Water Quality Authority WRCC Western Regional Climate Center WRD Water Replenishment District of Southern California WSAP WSRA Water Supply Allocation Plan Water Supply Reliability Assessment WSCP Water Shortage Contingency Plan WUCA Water Utility Climate Alliance WUE Water Use Efficiency TABLE OF CONTENTS (Continued) xi <Page Intentionally Left Blank> 2025 Urban Water Management Plan City of Arcadia Page 1-1 CHAPTER 1 URBAN WATER MANAGEMENT PLAN INTRODUCTION AND OVERVIEW LAY DESCRIPTION - INTRODUCTION An urban water supplier is defined (pursuant to Section 10617 of the California Water Code1) as “a supplier, either publicly or privately owned, providing water for municipal purposes either directly or indirectly to more than 3,000 customers or supplying more than 3,000 acre-feet of water annually. An urban water supplier includes a supplier or contractor for water, regardless of the basis of right, which distributes or sells for ultimate resale to customers.” The City of Arcadia (City) is classified as an urban water supplier because it serves more than 3,000 customers (i.e. individual metered accounts) and it supplies more than 3,000 acre-feet of water annually to its customers for municipal purposes. In accordance with the “Urban Water Management Planning Act”, which was enacted by the California Legislature in 1983, every urban water supplier (including the City) is required to prepare and adopt an Urban Water Management Plan (UWMP), periodically review its UWMP, and incorporate updated and new information into an updated UWMP at least once every five years. The City’s most recent update was its 2020 UWMP (or 2020 Plan) which was submitted to, and approved by, the California Department of Water Resources (DWR). Urban water suppliers (including the City) are required to complete and submit their 2025 UWMPs to DWR by July 1st, 2026. 1 References to CWC Sections in this 2025 UWMP were obtained from https://leginfo.legislature.ca.gov/ 2025 Urban Water Management Plan City of Arcadia Page 1-2 The current requirements for preparing the UWMP are included in California Water Code (CWC) Sections 10608 through 10657. The City’s 2025 UWMP (or 2025 Plan) was prepared consistent with the CWC and the recommended organization provided in DWR’s Final “Urban Water Management Plan Guidebook 2025” (Final 2025 UWMP Guidebook), dated January 2026. The UWMP provides urban water suppliers (including the City) with a reliable management action plan for long-term resource planning to ensure adequate water supplies are available to meet existing and future water supply needs. In addition, the 2025 Plan incorporates water supply reliability determinations resulting from potential prolonged drought, regulatory revisions, and/or changing climatic conditions. The City’s 2025 Plan consists of the following Chapters: Chapter 1 Urban Water Management Plan Introduction and Overview Chapter 2 Plan Preparation Chapter 3 Service Area Description Chapter 4 Water Use Characterization Chapter 5 SB X7-7 Baselines, 2020 Targets, and 2025 Reporting Chapter 6 Normal-Year Water Supply Characterization Chapter 7 Water Service Reliability and Drought Risk Assessment Chapter 8 Water Shortage Contingency Plan Chapter 9 Demand Management Measures Chapter 10 Plan Adoption, Submittal, and Implementation A lay description is presented at the beginning of each of these Chapters. 2025 Urban Water Management Plan City of Arcadia Page 1-3 LAY DESCRIPTION – CHAPTER 1 URBAN WATER MANAGEMENT PLAN INTRODUCTION AND OVERVIEW Chapter 1 (Urban Water Management Plan Introduction and Overview) of the City’s 2025 Plan discusses and provides the following: x An overall lay description of the 2025 Plan, including California Water Code and Urban Water Management Plan Act requirements, is provided. The City is required to prepare an Urban Water Management Plan. x The City’s 2025 Plan was prepared consistent with the recommended organization provided in DWR’s Final “Urban Water Management Plan Guidebook 2025”, dated January 2026. A description regarding the organization of the 2025 Plan, including a summary of each Chapter, is provided. The City’s Water Shortage Contingency Plan (discussed in Chapter 8) is also included in the 2025 Plan. x The 2025 Plan incorporates DWR’s water use and supply tables (standardized Submittal Tables) for the reporting and submittal of UWMP data. Relevant Submittal Tables are included at the end of each Chapter in this 2025 Plan and in Appendix A. x The City’s coordination efforts with other planning agencies are discussed, including coordination efforts with Upper San Gabriel Valley Municipal Water District and the Southern California Association of Governments x The City’s eligibility to receive grants and loans administered by the State of California and/or DWR, as a result of preparing the 2025 Plan, is discussed. x Information is provided which demonstrates the City’s prior, continued, and projected reduction on imported water supplies obtained (either directly or indirectly) from the Sacramento-San Joaquin Delta (Delta). The City has reduced its reliance on the imported water supplies for Fiscal Year 2014-15, Fiscal Year 2025 Urban Water Management Plan City of Arcadia Page 1-4 2019-2020, and Fiscal Year 2024-25. In addition, the City is projected to continue reducing its reliance on the imported water supplies through Fiscal Year 2049-50. x The checklist developed by DWR and used by the City to incorporate the specific UWMP requirements is discussed. The completed checklist is provided in Appendix B. UPDATED GUIDANCE FOR 2025 URBAN WATER MANAGEMENT PLANS The City’s 2025 Plan was prepared consistent with the recommended organization provided in DWR’s Final “Urban Water Management Plan Guidebook 2025”, dated January 2026. DWR provided the following updated guidance for the preparation of the 2025 Plans (in comparison to the preparation of the 2020 Plans): x There have been minor changes to the Water Code since the 2020 Plans were submitted; primarily, several definitions have been added (none of these change the requirements for 2025 Plans). x DWR and the State Water Resources Control Board are using the same criteria to determine when a water supplier with multiple Public Water Systems is considered an Urban Water Supplier subject to UWMP requirements. x DWR has updated its submittal tables to reflect the current reporting year, improve accuracy of reporting, and more clearly identify information required by Water Code and optional information. x There has been no change to the Water Code regarding water loss standard reporting since the 2020 Plans were submitted. However, water suppliers can report progress toward compliance with their 2028 Water Loss Standard in the 2025 Plans (see Table 4-6). x The State Water Resources Control Board has adopted regulations for the use of direct potable reuse (DPR) since the 2020 Plan reporting. To allow for reporting 2025 Urban Water Management Plan City of Arcadia Page 1-5 of DPR, minor changes have been made to the supply and demand tables in the 2025 Plans. x While projections for lower-income housing were required in the 2020 Plans, additional guidance has been provided for optional reporting of the method used to project water use for lower-income housing. x In previous years, the guidance for reporting water placed into storage did not differentiate between long-term storage (i.e., water placed into storage one year but extracted in a future year) and short-term storage (i.e., water that is placed into storage and extracted the same year). When a water supplier reports water placed into storage and then reports it was retrieved in the same year (short-term storage) it can cause a double counting error. Additional guidance has been provided recommending that water suppliers do not report water into and out of short-term storage. SUBMITTAL TABLES INCLUSION OF SUBMITTAL TABLES CWC 10644. (a)(2) The plan, or amendments to the plan, submitted to the department … shall include any standardized forms, tables, or displays specified by the department. The City’s 2025 Plan includes the completion of DWR’s standardized Submittal Tables for the reporting and submittal of UWMP data. Relevant Submittal Tables are included at the end of each Chapter in this 2025 Plan. In addition, all Submittal Tables are provided collectively in Appendix A. 2025 Urban Water Management Plan City of Arcadia Page 1-6 OPTIONAL PLANNING TOOL DWR has created an optional “Planning Tool Worksheet” for water suppliers to review and assess monthly water use trends. DWR has deemed the tool as optional and the City is not required by DWR to use the tool. RECOMMENDED UWMP ORGANIZATION The City’s 2025 Urban Water Management Plan (2025 Plan) was prepared consistent with the recommended organization provided in DWR’s Final “Urban Water Management Plan Guidebook 2025” (Final 2025 UWMP Guidebook), dated January 2026. The City’s 2025 Plan consists of the following Chapters: Chapter 1 Urban Water Management Plan Introduction and Overview Chapter 2 Plan Preparation Chapter 3 Service Area Description Chapter 4 Water Use Characterization Chapter 5 SB X7-7 Baselines, 2020 Targets, and 2025 Reporting Chapter 6 Normal-Year Water Supply Characterization Chapter 7 Water Service Reliability and Drought Risk Assessment Chapter 8 Water Shortage Contingency Plan Chapter 9 Demand Management Measures Chapter 10 Plan Adoption, Submittal, and Implementation Pursuant to CWC requirements, the City’s 2025 Plan incorporates DWR’s water use and supply tables (standardized Submittal Tables) for the reporting and submittal of UWMP data. DWR’s standardized Submittal Tables are provided within the body of the 2025 Plan text as well as in Appendix A. 2025 Urban Water Management Plan City of Arcadia Page 1-7 The City’s 2025 Plan also provides supporting documents (appendices) including notification letters of the Plan update, public notice of the Plan hearing, and adoption resolution from the City’s governing body. Further discussions regarding these supporting documents are provided within the individual Chapters of the City’s 2025 Plan. UWMPS IN RELATION TO OTHER EFFORTS The City is a sub-agency of Upper San Gabriel Valley Municipal Water District (Upper Water), a wholesale water agency. Upper Water prepared a 2025 Plan which is incorporated in the City’s 2025 UWMP by reference. In addition, the City provided its 2025 UWMP to Upper Water which includes water use projections in five-year increments for a normal year, a single dry year, and a five consecutive year drought over the next 25 years. SPECIFIC CONSIDERATIONS 1.4.1.1 DEMONSTRATION OF CONSISTENCY WITH THE DELTA PLAN FOR PARTICIPANTS IN COVERED ACTIONS Pursuant to DWR, an urban water supplier that anticipates participating in or receiving water from a proposed project (or “covered action”) such as a multi-year water transfer, conveyance facility, or new diversion that involves transferring water through, exporting water from, or using water in the Sacramento-San Joaquin Delta (Delta) should provide information in their Plans for use in demonstrating consistency with Delta Plan Policy WR P1, “Reduce Reliance on the Delta Through Improved Regional Water Self-Reliance”. In addition, pursuant to California Code of Regulations, Title 23, § 5003: 2025 Urban Water Management Plan City of Arcadia Page 1-8 (c)(1) Water suppliers that have done all of the following are contributing to reduced reliance on the Delta and improved regional self-reliance and are therefore consistent with this policy: (A) Completed a current Urban or Agricultural Water Management Plan (Plan) which has been reviewed by the California Department of Water Resources for compliance with the applicable requirements of Water Code Division 6, Parts 2.55, 2.6, and 2.8; (B) Identified, evaluated, and commenced implementation, consistent with the implementation schedule set forth in the Plan, of all programs and projects included in the Plan that are locally cost effective and technically feasible which reduce reliance on the Delta; and (C) Included in the Plan, commencing in 2015, the expected outcome for measurable reduction in Delta reliance and improvement in regional self- reliance. The expected outcome for measurable reduction in Delta reliance and improvement in regional self-reliance shall be reported in the Plan as the reduction in the amount of water used, or in the percentage of water used, from the Delta watershed. For the purposes of reporting, water efficiency is considered a new source of water supply, consistent with Water Code section 1011(a). The City has reduced its reliance on the imported water supplies for FY 2014-15, FY 2019-20, and FY 2024-25. In addition, the City is projected to continue reducing its reliance on the imported water supplies through FY 2049-50. A further discussion which demonstrates the City’s measurable reduction in imported water reliance and improvement in regional self-reliance is provided in Appendix C. 1.4.1.2 PERMITTING FOR OCEAN DESALINATION PROJECTS The City is currently not considering the development of a desalinated water project. However, as discussed in Section 6.2.6, there may be opportunities for use of desalinated ocean water as a potential water supply source in the future, if needed, through coordination with other agencies that have ocean desalination programs. 2025 Urban Water Management Plan City of Arcadia Page 1-9 DEPARTMENT OF WATER RESOURCES’ REVIEW PROCESS Section 10.5 discusses the process for a water supplier to submit the completed 2025 Plan to DWR, including electronic submittal through DWR’s online Water Use Efficiency Data (WUEdata) portal. DWR will subsequently review the 2025 Plans to ensure that they address the California Water Code requirements. Following DWR’s review, water suppliers will be notified of the results of the review via a formal review letter. These review letters will also be available to the public on DWR’s WUEdata portal. In cases where DWR finds that a Plan does not properly address item(s) in the Water Code, DWR will reach out to the water supplier to discuss needed corrections and correction procedures. UWMPS AND GRANT OR LOAN ELIGIBILITY CWC 10608.56. (a) On and after July 1, 2016, an urban retail water supplier is not eligible for a water grant or loan awarded or administered by the state unless the supplier complies with this part. (c) Notwithstanding subdivision (a), the department shall determine that an urban retail water supplier is eligible for a water grant or loan even though the supplier has not met the per capita reductions required pursuant to Section 10608.24, if the urban retail water supplier has submitted to the department for approval a schedule, financing plan, and budget, to be included in the grant or loan agreement, for achieving the per capita reductions. The supplier may request grant or loan funds to achieve the per capita reductions to the extent the request is consistent with the eligibility requirements applicable to the water funds. (e) Notwithstanding subdivision (a), the department shall determine that an urban retail water supplier is eligible for a water grant or loan even though the supplier has not met the per capita reductions required pursuant to Section 10608.24, if the urban retail water supplier has submitted to the department for approval documentation demonstrating that its entire service area qualifies as a disadvantaged community. (f) The department shall not deny eligibility to an urban retail water supplier or agricultural water supplier in compliance with the requirements of this part and Part 2.8 (commencing with Section 10800), that is participating in a multiagency water project, or an integrated regional water 2025 Urban Water Management Plan City of Arcadia Page 1-10 management plan, developed pursuant to Section 75026 of the Public Resources Code, solely on the basis that one or more of the agencies participating in the project or plan is not implementing all of the requirements of this part or Part 2.8 (commencing with Section 10800). CWC 10656. An urban water supplier is not eligible for a water grant or loan awarded or administered by the state unless the urban water supplier complies with this part. California Code of Regulations Title 23 Division 2 Chapter 5.1 Article 1, Section 596.1 (b)(2) “disadvantaged community” means a community with a median household income that is less than 80 percent of the statewide annual median household income. Pursuant to DWR’s Final 2025 UWMP Guidebook: “For a Supplier to be eligible for any water grant or loan administered by DWR, the Supplier must have a current UWMP on file that has been determined by DWR to address the requirements of the Water Code. A current UWMP must also be maintained by the Supplier throughout the term of any grant or loan administered by DWR. A UWMP may also be required to be eligible for other State funding, depending on the conditions that are specified in the funding guidelines. Suppliers are encouraged to seek guidance on the specifics of any State funding source from the respective funding agencies.” The City’s 2025 UWMP has been prepared to meet eligibility requirements for grants and loans administered by the State and/or DWR. TIPS FOR URBAN WATER MANAGEMENT PLAN PREPARERS The City’s 2025 Plan (which includes the City’s 2025 Water Shortage Contingency Plan (WSCP)) is considered an update to the City’s 2020 UWMP. However, the 2025 Plan 2025 Urban Water Management Plan City of Arcadia Page 1-11 and the WSCP are considered stand-alone documents. As discussed in Section 1.3, the City’s 2025 Plan was prepared consistent with the recommended organization provided in DWR’s Final 2025 UWMP Guidebook. The City’s 2025 Plan was also prepared based on the tips provided in DWR’s Final 2025 UWMP Guidebook including the use of information from previous Plans and following the required Plan notification and adoption process. In addition, a checklist of specific UWMP requirements is included in Appendix B. The checklist includes the page number where the required elements are addressed to assist in DWR’s review of the submitted Plan. 2025 Urban Water Management Plan City of Arcadia Page 2-1 CHAPTER 2 PLAN PREPARATION LAY DESCRIPTION – CHAPTER 2 PLAN PREPARATION Chapter 2 (Plan Preparation) of the City’s 2025 Plan discusses and provides the following: x The basis for preparing an Urban Water Management Plan is provided. The City is required to prepare the 2025 Plan because it is an “urban water supplier” (the City serves more than 3,000 customers and it supplies more than 3,000 acre-feet of water annually to its customers for municipal purposes) x The City is a “Public Water System” and is regulated by the State Water Resources Control Board - Division of Drinking Water. The City’s Public Water System number is provided in Table 2-1. x The City’s Plan has been prepared as an “individual” plan rather than a “regional” plan in an effort to provide information specific to the City to best inform its employees, management and customers. x Information presented in the City’s 2025 Plan is provided on “fiscal year” basis which is from July 1 through June 30 of the following year. x Water quantities presented in the City’s 2025 Plan are provided on an “acre-foot” basis. x The City’s coordination and outreach efforts with wholesale water agencies, other retail water agencies, and the community are described. The City coordinated the preparation of its 2025 Plan with the cities of Monrovia, Pasadena, and Sierra Madre, California American Water Company, Golden State Water Company, Main 2025 Urban Water Management Plan City of Arcadia Page 2-2 San Gabriel Basin Watermaster, San Gabriel Valley Water Company, Sunny Slope Water Company, Upper Water, and Los Angeles County. x The City’s notification process to the cities and county within which the City provides water supplies to is discussed. As discussed in Section 1.3, the City’s 2025 Plan was prepared consistent with the recommended organization provided in DWR’s Final 2025 UWMP Guidebook. Pursuant to CWC requirements, the City’s 2025 Plan incorporates DWR’s water use and supply tables (standardized Submittal Tables) for the reporting and submittal of UWMP data. BASIS FOR PREPARING A PLAN CWC 10617. "Urban water supplier" means a supplier, either publicly or privately owned, providing water for municipal purposes either directly or indirectly to more than 3,000 customers or supplying more than 3,000 acre-feet of water annually. An urban water supplier includes a supplier or contractor for water, regardless of the basis of right, which distributes or sells for ultimate resale to customers. This part applies only to water supplied from public water systems subject to Chapter 4 (commencing with Section 116275) of Part 12 of Division 104 of the Health and Safety Code. CWC 10618.12. (t) “Urban retail water supplier” means a water supplier, either publicly or privately owned, that directly provides potable municipal water to more than 3,000 end users or that supplies more than 3,000 acre-feet of potable water annually at retail for municipal purposes. (w) “Urban wholesale water supplier” means a water supplier, either publicly or privately owned, that provides more than 3,000 acre- feet of water annually at wholesale for potable municipal purposes. CWC 10620. 2025 Urban Water Management Plan City of Arcadia Page 2-3 (b) Every person that becomes an urban water supplier shall adopt an urban water management plan within one year after it has become an urban water supplier. CWC 10621. (a) Each urban water supplier shall update its plan at least once every five years on or before July 1, in years ending in six and one, incorporating updated and new information from the five years preceding each update. The City’s 2025 Plan was prepared in accordance with the UWMP Act which was established in 1983. The UWMP Act requires every “urban water supplier” to prepare and adopt a Plan, to periodically review its Plan at least once every five years and make any amendments or changes which are indicated by the review. An “Urban Water Supplier” is defined as a supplier, either publicly or privately owned, providing water for municipal purposes either directly or indirectly to more than 3,000 customers or supplying more than 3,000 acre-feet of water annually. Section 10621(a) of the CWC states, “Each urban water supplier shall update its plan at least once every five years on or before July 1, in years ending in six and one, incorporating updated and new information from the five years preceding each update”. As a result, DWR requires the 2025 Plans be submitted by July 1, 2026. The City is an “urban water supplier” pursuant to Section 10617 of the CWC and directly serves potable water to more than 3,000 customers and supplies more than 3,000 acre- feet per year (AFY) at retail for municipal purposes. The City’s 2025 Plan is an update to the City’s 2020 Plan. SUPPLIERS WITH BOTH WHOLESALE AND RETAIL SALES The City is a retail water supplier (and not a wholesale water supplier). The City’s 2025 Plan was prepared based on the CWC requirements pertaining to retail water suppliers. 2025 Urban Water Management Plan City of Arcadia Page 2-4 The City relies on water supplies from wholesale water suppliers which are discussed in Section 2.4.1. PUBLIC WATER SYSTEMS California Health and Safety Code 116275. (h) "Public water system" means a system for the provision of water for human consumption through pipes or other constructed conveyances that has 15 or more service connections or regularly serves at least 25 individuals daily at least 60 days out of the year. Pursuant to CWC requirements, the City’s 2025 Plan incorporates DWR’s standardized Submittal Tables for the reporting and submittal of UWMP data. The Submittal Tables are provided within the body of the 2025 Plan text as well as in Appendix A. The City also submitted the UWMP data (from the Submittal Tables) electronically through DWR’s Online Submittal Tool. In addition, the City is a Public Water System and is regulated by the State Water Resources Control Board - Division of Drinking Water (SWRCB-DDW). The SWRCB- DDW requires water agencies provide the number of connections, water usage, and other information annually. The information provided to SWRCB-DDW indicates the City serves potable water to more than 3,000 customers and supplies more than 3,000 AFY. Table 2-1 provides the City’s Public Water System name and number. As indicated in Table 2- 1, the City serves only a single Public Water System. 2025 Urban Water Management Plan City of Arcadia Page 2-5 INDIVIDUAL OR REGIONAL PLANS The City has developed its 2025 Plan reporting solely on its service area to address all requirements of the California Water Code. The City’s 2025 Plan was not developed as a Regional Plan. As shown in Table 2-2, the City’s 2025 Plan is an “Individual UWMP”. The City has developed its 2025 Plan reporting solely for its service area to address all requirements of the California Water Code, including water use targets and baselines pursuant to SB X7-7 Water Conservation Act of 2009 reporting (discussed further in Chapter 5). The City notified and coordinated with appropriate regional agencies and constituents (See Section 2.4). REGIONAL REPORTING CWC 10620. (d)(1) An urban water supplier may satisfy the requirements of this part by participation in area wide, regional, watershed, or basin wide urban water management planning where those plans will reduce preparation costs and contribute to the achievement of conservation and efficient water use. As indicated in Table 2-2, the City’s 2025 Plan was developed as an “Individual UWMP” and not part of a Regional Plan or Regional Alliance. 2025 Urban Water Management Plan City of Arcadia Page 2-6 FISCAL OR CALENDAR YEAR AND UNITS OF MEASURE CWC 10608.20. (a)(1) Urban retail water suppliers…may determine the targets on a fiscal or calendar year basis. FISCAL OR CALENDAR YEAR The data provided in the City’s 2025 Plan is reported on a fiscal year basis, unless noted otherwise, as shown in Table 2-3. A fiscal year begins on July 1st of every year. UNITS OF MEASURE As shown in Table 2-3, the data provided in the City’s 2025 Plan is reported in units AF, unless noted otherwise. COORDINATION AND OUTREACH CWC 10631. (h) An urban water supplier that relies upon a wholesale agency for a source of water shall provide the wholesale agency with water use projections from that agency for that source of water in five-year increments to 20 years or as far as data is available. The wholesale agency shall provide information to the urban water supplier for inclusion in the urban water supplier’s plan that identifies and quantifies, to the extent practicable, the existing and planned sources of water as required by subdivision (b), available from the wholesale agency to the urban water supplier over the same five-year increments, and during various water-year types in accordance with subdivision (f). An urban water supplier may rely upon water supply information provided by the wholesale agency in fulfilling the plan informational requirements of subdivisions (b) and (f). 2025 Urban Water Management Plan City of Arcadia Page 2-7 WHOLESALE AND RETAIL COORDINATION The City is a sub-agency of Upper Water, a wholesale agency. As indicated in Table 2- 4, the City has provided its 2025 Plan to Upper Water which includes water use projections in five-year increments for normal, single dry, and five consecutive year drought conditions over the next 25 years. COORDINATION WITH OTHER AGENCIES AND THE COMMUNITY CWC 10620. (d)(3) Each urban water supplier shall coordinate the preparation of its plan with other appropriate agencies in the area, including other water suppliers that share a common source, water management agencies, and relevant public agencies, to the extent practicable. CWC 10642. Each urban water supplier shall encourage the active involvement of diverse social, cultural, and economic elements of the population within the service area prior to and during the preparation of both the plan… The City is a retail water supplier that serves customers in the City of Arcadia. The City is required to coordinate the preparation of the Plan with appropriate agencies in the area, including appropriate water suppliers that share a common source. Therefore, the City coordinated the preparation of its 2025 Plan with the Main San Gabriel Basin Watermaster, Upper Water, City of Monrovia, City of Pasadena, City of Sierra Madre, San Gabriel Valley Water Company, Golden State Water Company, California American Water Company, and Sunny Slope Water Company. As discussed in Section 10.2, the City notified these agencies, as well as the cities and county within which the City provides water supplies, at least sixty (60) days prior to the public hearing of the preparation of the 2025 Urban Water Management Plan City of Arcadia Page 2-8 2025 Plan and invited them to participate in the development of the 2025 Plan. A copy of the notification letters sent to these agencies is provided in Appendix D. NOTICE TO CITIES AND COUNTIES CWC 10621. (b) Every urban water supplier required to prepare a plan pursuant to this part shall, at least 60 days before the public hearing on the plan required by Section 10642, notify any city or county within which the supplier provides water supplies that the urban water supplier will be reviewing the plan and considering amendments or changes to the plan. As discussed in Section 10.2, notification was provided to the cities and county within which the City provides water supplies that the City was reviewing and considering amendments (updates) to the previous 2020 Plan, and as a result prepare the 2025 Plan. Notification was provided on March 4, 2026, at least 60 days prior to the public hearing (see Appendix D). 2025 Urban Water Management Plan City of Arcadia Page 2-9 SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 2 are provided below. SUBMITTAL TABLE 2-1: PWSs Table 2-1 Public Water Systems CA1910003 City of Arcadia 15,564 13,294 15,564 13,294Total Public Water System Number Public Water System Name Number of Municipal Connections 2025 Submittal Table 2-1 Retail: Public Water Systems Add additional rows as needed NOTES: Units are in acre-feet (AF) Volume of Water Supplied 2025 (AF) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. 2025 Urban Water Management Plan City of Arcadia Page 2-10 SUBMITTAL TABLE 2-2: PLAN TYPE IDENTIFICATION Table 2-2 Plan Type Identification 2025 Urban Water Management Plan City of Arcadia Page 2-11 SUBMITTAL TABLE 2-3: SUPPLIER INFORMATION Table 2-3 Supplier Information 2025 Urban Water Management Plan City of Arcadia Page 2-12 SUBMITTAL TABLE 2-4: WATER SUPPLIER INFORMATION EXCHANGE Table 2-4 Water Supplier Information Exchange Submittal Table 2-4 Retail: Water Supplier Information Exchange Water Code Section 10631(h) The retail Supplier has informed the following wholesale supplier(s) of projected water use. Wholesale Water Supplier Name Add additional rows as needed Upper San Gabriel Valley Municipal Water District NOTES: 2025 Urban Water Management Plan City of Arcadia Page 3-1 CHAPTER 3 SERVICE AREA DESCRIPTION LAY DESCRIPTION – CHAPTER 3 SERVICE AREA DESCRIPTION Chapter 3 (Service Area Description) of the City’s 2025 Plan discusses and provides the following: x A description of the City’s service area is provided. The City provides water service to a majority of the City of Arcadia and encompasses an area of approximately 11 square miles. The City of Arcadia is in the north-central area of the San Gabriel Valley extending northward into the southerly slopes of the San Gabriel Mountains and which lies northeast of the City of Los Angeles. x The City’s water service area encompasses an area of approximately 11 square miles. The location of the City’s water service area is provided in Figure 1. x A description regarding the City’s water service area climate is provided. The monthly historical average temperatures (including minimum and maximum), monthly historical average rainfall, and monthly evapotranspiration (ETo) in the vicinity of the City’s service area is summarized. The sources of the climate information are also discussed. x The population within the City’s water service area is discussed and projected. The sources of the population information are also discussed. The City provides water service to an area with a current population of about 54,700. The City is projected to have a population of about 66,900 by Fiscal Year 2049-50. x A discussion of land use information used by the City to develop the 2025 Plan is provided. The City reviewed the current and projected land uses within its service 2025 Urban Water Management Plan City of Arcadia Page 3-2 area. The City also reviewed data provided by the Southern California Association of Governments, the Department of Finance, and the United States Census Bureau and prepared for counties, cities, and unincorporated areas within Southern California. GENERAL DESCRIPTION CWC 10631. (a) Describe the service area of the supplier, including current and projected population, climate, and other social, economic, and demographic factors affecting the supplier’s water management planning. The projected population estimates shall be based upon data from the state, regional, or local service agency population projections within the service area of the urban water supplier and shall be in five-year increments to 20 years or as far as data is available. The description shall include the current and projected land uses within the existing or anticipated service area affecting the supplier’s water management planning. Urban water suppliers shall coordinate with local or regional land use authorities to determine the most appropriate land use information, including, where appropriate, land use information obtained from local or regional land use authorities, as developed pursuant to Article 5 (commencing with Section 65300) of Chapter 3 of Division 1 of Title 7 of the Government Code. The City of Arcadia is a residential community encompassing approximately 11 square miles, in the north-central area of the San Gabriel Valley extending northward into the southerly slopes of the San Gabriel Mountains and which lies northeast of the City of Los Angeles. The City was incorporated in 1903, and in 1914 its citizens agreed to develop a municipal water system. A bond issue was passed and by 1916 the City had purchased an existing water company, drilled wells, built reservoirs and installed thousands of feet of water main as well as fire hydrants and water meters. 2025 Urban Water Management Plan City of Arcadia Page 3-3 In 1918, the State of California granted the City a domestic water supply permit. Since then, the City has improved its water system by drilling additional wells, building new reservoirs, constructing booster pumps, and installing many miles of water mains. These improvements were funded through two bond issues. The last bond was redeemed in 1966, and since then, all additional improvements have been funded by water sales, developers and federal grants. The City provides water service to a majority of the City of Arcadia and encompasses an area of approximately 11 square miles, as shown in Figure 1. The City currently derives its water supply from groundwater wells that produce water from two groundwater basins; the Main San Gabriel Basin and the Raymond Basin, with the Main San Gabriel Basin as the City’s primary groundwater source. The City is also a sub-agency of Upper Water, a wholesale water agency and can purchase treated, imported water. A discussion of the City’s sources of water supply is provided in Chapter 6. SERVICE AREA BOUNDARY MAPS As discussed in Section 3.1, the City’s service area covers approximately 11 square miles encompassing the majority of the City of Arcadia. A service area boundary map is provided on Figure 1. The City’s water service area boundary relative to the City of Arcadia’s municipal boundary is also provided in Figure 2. The City’s service area boundary was originally created in a Geographical Information Systems (GIS) shape file format and converted into a KML format. To the extent information was available, metadata was included in the KML file (including map projection, contact information, start and end dates for which the map is valid, constraints, attribute table definitions, and digitizing base). 2025 Urban Water Management Plan City of Arcadia Page 3-4 SERVICE AREA CLIMATE CWC 10631. (a) Describe the service area of the supplier, including … “climate…” CWC 10630. It is the intention of the Legislature, in enacting this part, to permit levels of water management planning commensurate with the numbers of customers served and the volume of water supplied, while accounting for impacts from climate change. The monthly historical average temperatures (including minimum and maximum), monthly historical average rainfall, and monthly evapotranspiration in the vicinity of the City’s service area is summarized in the tabulation below. Historical climate information was obtained from the Western Regional Climate Center (WRCC), Los Angeles County Department of Public Works (DPW), and from DWR’s California Irrigation Management Information System (CIMIS). 2025 Urban Water Management Plan City of Arcadia Page 3-5 Service Area Climate Information Month Average Temperature Average Min. Temperature Average Max. Temperature Average Total Precipitation ETo (F) (F) (F) (Inches) (Inches) January 54.9 43.1 66.7 4.3 2.15 February 56.4 44.5 68.2 4.5 2.54 March 58.3 46.4 70.3 3.4 3.85 April 61.6 49.3 73.9 1.3 4.61 May 64.6 52.7 76.5 0.5 5.21 June 69.2 56.3 82.2 0.1 6.00 July 74.6 60.5 88.7 0.0 6.58 August 75.3 60.9 89.6 0.1 6.38 September 73.4 59.2 87.6 0.4 4.95 October 67.6 54.0 81.2 0.7 3.55 November 60.9 47.7 74.1 1.6 2.48 December 55.4 43.6 67.3 3.2 1.90 Annual 64.4 51.5 77.3 19.9 50.22 Source: Historical average monthly precipitation and temperature information was obtained from the Western Regional Climate Center (http://www.wrcc.dri.edu/) and is based on data collected from Station 046719 (Pasadena, CA) from 1893 through 2015. Historical monthly average ETo information was obtained from the California Irrigation Management Information Systems (http://wwwcimis.water.ca.gov) and is based on data collected from Station 159 (Monrovia). The historical average rainfall in the vicinity of the City’s service area is 19.9 inches. The City’s service area in the San Gabriel Valley has a dry climate and summers can reach average maximum daily temperatures in the high 80s. Although changes in climatic conditions may have an impact (as discussed in Section 4.5), the projected water supply demands will be based on average year, single dry year and a five consecutive year drought, based on historical data and projected demands. Precipitation within the vicinity of the City’s service area is discussed further in Section 7.2. 2025 Urban Water Management Plan City of Arcadia Page 3-6 A discussion of the City’s sources of supply, how those sources may be impacted by climate change, and the proactive actions the City and other local/regional water managers may take to address the potential climate change on water supplies is provided in Section 4.2.5.6. SERVICE AREA POPULATION AND DEMOGRAPHICS SERVICE AREA POPULATION CWC 10631. (a) Describe the service area of the supplier, including current and projected population… The projected population estimates shall be based upon data from the state, regional, or local service agency population projections within the service area of the urban water supplier and shall be in five-year increments to 20 years or as far as data is available. The City provides water service to an area with a current population of about 54,700. Table 3-1 presents the current and projected population of the area encompassed by the City’s service area from FY 2024-25 to FY 2049-50. The City is projected to have a population of about 66,900 by FY 2049-50. A GIS analysis using census tracts was performed to estimate the current population (FY 2024-25) within the City’s service area. The City’s service area is comprised of individual census tracts which represent smaller statistical areas for which population data is available. The smaller census tracts were combined to more accurately represent the total area within the City’s service area. Current census tract information was obtained in a GIS format from the advanced demographics dataset developed by Esri which includes source material supplied by the U.S. Census Bureau and the U.S. Census Bureau's American Community Survey. 2025 Urban Water Management Plan City of Arcadia Page 3-7 The City’s service area boundary in a GIS format was overlayed on the census tract GIS layer. Each census tract located within the City’s service area was identified (including the entire census tract or a portion of). For a census tract located entirely within the service area, the entire population (i.e. 100 percent) associated with the census tract was incorporated. For a census tract located partially within the service area, the portion (or percentage) of the census tract located geographically within the service area was determined through GIS. The percentage was then applied to the census tract’s population in order to estimate the population of the census tract within the service area. The total population within the City’s service area was then estimated based on the sum of the populations within these census tracts. The projected total population within the City’s service area was based on growth rate projections included in the Southern California Association of Governments (SCAG) “Connect SoCal 2024, Demographics and Growth Forecast” report dated April 2024. The SCAG report incorporates demographic trends, existing land use, general plan land use policies, and input and projections through the year 2050 from the Department of Finance (DOF) and the U.S. Census Bureau for counties, cities and unincorporated areas within Southern California. Annual growth rate projections within the City’s service area were estimated based on the SCAG report and applied to the City’s current population to estimate projected populations through 2050. The City’s service area is almost built out with predominantly single and multi-family residential units and some commercial, institutional, and industrial establishments. Moving forward, the City will continue planning for the Regional Housing Needs Assessment (RHNA) allocations and future planned developments including the addition of apartment units and accessory dwelling units (ADUs) as the means of affordable housing. 2025 Urban Water Management Plan City of Arcadia Page 3-8 Pursuant to the California State Housing Law, every jurisdiction (including the City of Arcadia) is required to plan for its RHNA allocation in the Housing Element of its General Plan. RHNA is a representation of future housing needs for all income levels in a jurisdiction. SCAG’s “6th Cycle Final RHNA Allocation” was adopted March 2021 (and modified in July 2021) and covers the planning period from October 2021 through October 2029. The total RHNA allocation of housing within the City of Arcadia through 2029 is 3,214 units (including 1,102 “very-low” income units, 570 “low” income units, 605 “moderate” income units, and 937 “above moderate” income units). The City of Arcadia must identify adequate sites and establish policies and programs that will accommodate the estimated growth, however the City of Arcadia is not obligated to produce, construct, or develop these allocated units. However, the population projections in the City’s 2025 Plan incorporate anticipated RHNA allocations. OTHER SOCIAL, ECONOMIC, AND DEMOGRAPHIC FACTORS CWC 10631. (a) Describe the service area of the supplier, including… other social, economic, and demographic factors affecting the supplier’s water management planning. No other demographic factors than previously described affect significantly the City’s water management planning. However, increased population will have an impact on water demand. 2025 Urban Water Management Plan City of Arcadia Page 3-9 LAND USES WITHIN SERVICE AREA CWC 10631. (a) ...The description shall include the current and projected land uses within the existing or anticipated service area affecting the supplier’s water management planning. Urban water suppliers shall coordinate with local or regional land use authorities to determine the most appropriate land use information, including, where appropriate, land use information obtained from local or regional land use authorities… The City reviewed the current and projected land uses within its service area during the preparation of this 2025 Plan. Information regarding current and projected land uses is included in the City of Arcadia’s General Plan. The existing land uses within the City’s service area include residential (single-family and multi-family), commercial, and open space. The projected land uses within the City’s service area are expected to remain similar to the existing land uses. In addition, although mostly built-out, the projected population within the City’s service area is anticipated to increase (as discussed in Section 3.4). A discussion of the existing and projected water uses for the individual water use sectors within the City’s service area, which includes the different land uses, is provided in Section 4.2. As discussed in Section 2.4, the City coordinated the preparation of the 2025 Plan with the City of Arcadia, the County of Los Angeles, and other agencies. As discussed in Section 3.4, the City obtained data from the Southern California Association of Governments document entitled “Connect SoCal 2024, Demographics and Growth Forecast”, dated April 2024. Projected populations in the City’s service area were based on growth rate projections developed by SCAG. The data provided by SCAG incorporates demographic trends, existing land use, general plan land use policies, and input and projections through the year 2050 from the Department of Finance and the U.S. Census Bureau for counties, cities and unincorporated areas within Southern California. 2025 Urban Water Management Plan City of Arcadia Page 3-10 SUBMITTAL TABLES The applicable standardized Submittal Table referenced within Chapter 3 is provided below. SUBMITTAL TABLE 3-1: POPULATION - CURRENT AND PROJECTED Table 3-1 Population - Current and Projected 2025 2030 2035 2040 2045 2050(opt) 54,700 60,303 65,903 66,233 66,564 66,897 Submittal Table 3-1 Retail: Population - Current and Projected Water Code Section 10631(a) Population Served NOTES: 2025 Urban Water Management Plan City of Arcadia Page 4-1 CHAPTER 4 WATER USE CHARACTERIZATION LAY DESCRIPTION – CHAPTER 4 WATER USE CHARACTERIZATION Chapter 4 (Water Use Characterization) of the City’s 2025 Plan discusses and provides the following: x The City provides water service to individual “water use sectors”. These water use sectors include single-family residential, multi-family, commercial, and landscape. Individual descriptions for these water use sectors are provided in Section 4.2.1. x The City’s total water demands (including potable water) over the past 15 years have ranged from 11,621 AFY to 17,452 AFY, with an average of 14,341 AFY. The City currently measures its water use through meter data and billing records. x The City conducts an annual water loss audit to identify distribution system water losses. Water losses can result from pipeline leaks and inaccurate metering due to faulty meters. Water loss estimates are incorporated into the City’s projected water demands. x The City’s current and projected water demands are provided in five-year increments over the next 25 years are provided (through Fiscal Year 2049-50) as shown on Table 4-3. x The City’s water demand projections incorporate passive savings from water savings which are the result of implementation of codes, water conservation standards, and/or ordinances. x The projected water demands for lower income households are identified and are included in the City’s total projected water demands. 2025 Urban Water Management Plan City of Arcadia Page 4-2 x The City’s sources of water supply and how those sources may be impacted by climate change are discussed. The proactive actions the City and other local/regional water managers may take to address the potential climate change impacts on water supplies are also discussed. NON-POTABLE VERSUS POTABLE WATER USE The Water Code requires a description and quantification of water uses within the City’s service area, including both non-potable and potable water. Recycled water (non-potable) uses are addressed in Section 6.2.5, (although the City currently has none); however, a summary is provided in Table 4-1 and Table 4-2. Furthermore, Chapter 4 addresses the City’s potable water demands. PAST, CURRENT, AND PROJECTED WATER USE BY SECTOR CWC 10635. (a) Every urban water supplier shall include, as part of its urban water management plan, an assessment of the reliability of its water service to its customers during normal, dry, and multiple dry water years. This water supply and demand assessment shall compare the total water supply sources available to the water supplier with the long-term total projected water use over the next 20 years, in five-year increments, for a normal water year, a single dry water year, and a drought lasting five consecutive water years. The water service reliability assessment shall be based upon the information compiled pursuant to Section 10631, including available data from state, regional, or local agency population projections within the service area of the urban water supplier. CWC 10631. (d)(1) For an urban retail water supplier, quantify, to the extent records are available, past and current water use, over the same five-year increments described in subdivision (a), and projected water use, based upon information developed pursuant to subdivision (a), identifying the uses among water use sectors, including, but not necessarily limited to, all of the following… 2025 Urban Water Management Plan City of Arcadia Page 4-3 (2) The water use projections shall be in the same five-year increments described in subdivision (a). (4)(A) Water use projections, where available, shall display and account for the water savings estimated to result from adopted codes, standards, ordinances, or transportation and land use plans identified by the urban water supplier, as applicable to the service area. (4)(B) To the extent that an urban water supplier reports the information described in subparagraph (A), an urban water supplier shall do both of the following: (i) Provide citations of the various codes, standards, ordinances, or transportation and land use plans utilized in making the projections. (ii) Indicate the extent that the water use projections consider savings from codes, standards, ordinances, or transportation and land use plans. Water use projections that do not account for these water savings shall be noted of that fact. The City’s current and projected water demands are provided in five-year increments over the next 25 years (through FY 2049-50) in Tables 4-1 and 4-2. The City’s total water demands were projected based on a review of the “2020 Water Use Target” pursuant to SB X7-7 calculations (discussed in Section 5.2), current water use factors based on recent water demands, Urban Water Use Objective standards (discussed in Section 5.2.6), and the total population projections based on land use trends within the City (discussed in Section 3.4). The City provides water service to individual “water use sectors” as identified by the California Water Code. The water use sectors supplied by the City are discussed in Section 4.2.1. The water use for each of these sectors during FY 2024-25 is provided in Table 4-1. The projected water use for each individual water use sector through FY 2049- 50 is provided in Table 4-2 and is based on the percentage breakdown of water use from each individual water use sector in FY 2024-25 (the percentages were then applied to the projected total water use). 2025 Urban Water Management Plan City of Arcadia Page 4-4 WATER-USE SECTORS LISTED IN WATER CODE CWC 10631. (d)(1) For an urban retail water supplier, quantify, to the extent records are available, past and current water use, over the same five-year increments described in subdivision (a), and projected water use, based upon information developed pursuant to subdivision (a), identifying the uses among water use sectors, including, but not necessarily limited to, all of the following: (A) Single-family residential. (B) Multifamily. (C) Commercial. (D) Industrial. (E) Institutional and governmental. (F) Landscape. (G) Sales to other agencies. (H) Saline water intrusion barriers, groundwater recharge, or conjunctive use, or any combination thereof. (I) Agricultural. (J) Distribution system water loss. As shown in Table 4-1, the City’s service area includes the following water use sectors listed in the California Water Code: x Single-family residential (A single-family dwelling unit is a lot with a free-standing building containing one dwelling unit that may include a detached secondary dwelling. ) x Multi-family (Multiple dwelling units are contained within one building or several buildings within one complex. ) 2025 Urban Water Management Plan City of Arcadia Page 4-5 x Commercial (Commercial users are defined as water users that provide or distribute a product or service) x Institutional (and governmental) (Institutional users are defined as water user dedicated to public service. Institutional users include, among other users, higher education institutions, schools, courts, churches, hospitals, government facilities, and nonprofit research institutions. x Landscape (Landscape connections supply water solely for landscape irrigation. Landscapes users may be associated with multi-family, commercial, industrial, or institutional/governmental sites, but are considered a separate water use sector if the connection is solely for landscape irrigation. Landscape water demands are included in retail demands.) x Distribution system losses (Distribution system losses represent the potable water losses from the pressurized water distribution system and water storage facilities, up to the point of delivery to the customers. Additional information is discussed in Section 4.2.4) 2025 Urban Water Management Plan City of Arcadia Page 4-6 OPTIONAL WATER-USE SECTORS IN ADDITION TO THOSE LISTED IN WATER CODE The City’s service area includes other water uses for fire hydrant uses. However, the City’s service area does not include other water demand sectors which are not listed in the California Water Code (including exchanges, transfers, wetlands or wildlife habitat, and surface water storage). PAST WATER USE Chapter 6 provides a discussion of the sources of water supply the City uses to meet its water demands. Section 6.1 provides a tabulation of the City’s historical annual water demands for each water supply source. Over the past 15 years, the City’s total water demands have ranged from 11,621 AFY to 17,452 AFY, with an average of 14,341 AFY. In addition, the City previously experienced a five consecutive year drought within its service area from FY 2011-12 to FY 2015-16. The City also reviewed its historical water demands to determine the projected water demands and water supply reliability (discussed in Chapter 7). The City is able to provide sufficient water supplies to meet the projected water demands of its customers, including during a five consecutive year drought period. CURRENT WATER USE CWC 10631. (d)(1) For an urban retail water supplier, quantify, to the extent records are available, past… water use… based upon information developed pursuant to subdivision (a), identifying the uses among water use sectors… 2025 Urban Water Management Plan City of Arcadia Page 4-7 The City currently measures its water use through meter data and billing records. The water use for the City’s individual water use sectors during FY 2024-25 are provided in Table 4-1. Recycled water uses are addressed separately in Section 6.5; however, a summary of projected recycled water uses is provided in Table 4-2. DWR has created an optional “Planning Tool Worksheet” for water suppliers to review and assess monthly water use trends. DWR has deemed the tool as optional and the City is not required by DWR to use the tool. Section 6.1 provides a tabulation of the City’s historical annual water uses for each water supply source. During the past 15 years, the City experienced a five consecutive year drought within its service area from FY 2011-12 to FY 2015-16. Historical records indicate the City’s annual water demands had been greater prior to FY 2011-12. The City has been able to provide sufficient water supplies to its customers, including during long-term droughts and years with historically high water demands. In addition, the City has been able to provide water service to meet maximum day water demands for these years, including during the summer months. A further discussion regarding the reliability of the City’s water supply sources is provided in Chapter 7. PROJECTED WATER USE 4.2.5.1 GENERAL GUIDANCE ON PROJECTIONS CWC 10631. (d)(1) For an urban retail water supplier, quantify, to the extent records are available, … projected water use, based upon information developed pursuant to subdivision (a), identifying the uses among water use sectors… CWC 10633. The plan shall provide, to the extent available, information on recycled water...and shall include all of the following:... 2025 Urban Water Management Plan City of Arcadia Page 4-8 (e) The projected use of recycled water within the supplier’s service area at the end of 5, 10, 15, and 20 years, and a description of the actual use of recycled water in comparison to uses previously projected pursuant to this subdivision... CWC 10635. (a) Every urban water supplier shall include, as part of its urban water management plan, an assessment of the reliability of its water service to its customers during normal, dry, and multiple dry water years. This water supply and demand assessment shall compare the total water supply sources available to the water supplier with the long-term total projected water use over the next 20 years, in five-year increments, for a normal water year, a single dry water year, and a drought lasting five consecutive water years. The water service reliability assessment shall be based upon the information compiled pursuant to Section 10631, including available data from state, regional, or local agency population projections within the service area of the urban water supplier. CWC 10631. (h) An urban water supplier that relies upon a wholesale agency for a source of water shall provide the wholesale agency with water use projections from that agency for that source of water in five-year increments to 20 years or as far as data is available… As discussed above, the City’s current and projected water demands are provided in five- year increments over the next 25 years (through FY 2049-50) in Tables 4-1 and 4-2. The City’s total water demands were projected based on a review of the “2020 Water Use Target” pursuant to SB X7-7 calculations (discussed in Section 5.2), current water use factors based on recent water demands, Urban Water Use Objective standards (discussed in Section 5.2.6), and the total population projections based on land use trends within the City (discussed in Section 3.4). Chapter 6 provides a discussion of the sources of water supply the City will use to meet the projected water demands (including recycled water use). The City’s projected water demands and water supplies during a normal year, a single dry year, and a five consecutive year drought are provided in Chapter 7. Because the City relies on wholesale water supplies, the City has provided its 2025 Plan to Upper Water as discussed in Section 2.4.1. 2025 Urban Water Management Plan City of Arcadia Page 4-9 4.2.5.2 WATER-USE PROJECTIONS BY SECTOR CWC 10631. (d)(1) For an urban retail water supplier, quantify, to the extent records are available … projected water use based upon information developed pursuant to subdivision (a), The City provides water service to individual “water use sectors” as identified by the California Water Code. The water use sectors supplied by the City are discussed in Section 4.2.1. The water use for each of these sectors during FY 2024-25 is provided in Table 4-1. The projected water use for each individual water use sector through FY 2049- 50 is provided in Table 4-2 and is based on the percentage breakdown of water use from each individual water use sector in FY 2024-25 (the percentages were then applied to the projected total water use). 4.2.5.3 STANDARDS, CODES, ORDINANCES, AND PLANS CWC 10631. (d)(4)(A) Water use projections, where available, shall display and account for the water savings estimated to result from adopted codes, standards, ordinances, or transportation and land use plans identified by the urban water supplier, as applicable to the service area. (d)(4)(B) To the extent that an urban water supplier reports the information described in subparagraph (A), an urban water supplier shall do both of the following: (i) Provide citations of the various codes, standards, ordinances, or transportation and land use plans utilized in making the projections. (ii) Indicate the extent that the water use projections consider savings from codes, standards, ordinances, or transportation and land use plans. Water use projections that do not account for these water savings shall be noted of that fact. 2025 Urban Water Management Plan City of Arcadia Page 4-10 The City’s projected water demands are provided in five-year increments over the next 25 years (through FY 2049-50) in Table 4-2. The City’s projected water demands and water supplies during a normal year, a single dry year, and a five consecutive year drought are provided in Chapter 7. The projected water demands for each of the City’s water use sectors are provided in Table 4-2. As discussed in the following Section, the City’s water demand projections incorporate “passive savings” which are the result of implementation of codes, standards, and/or ordinances. 4.2.5.4 RETAIL ONLY The City’s total water demands were projected based on a review of the “2020 Water Use Target” pursuant to SB X7-7 calculations (discussed in Section 5.2), current water use factors based on recent water demands, Urban Water Use Objective standards (discussed in Section 5.2.6), and the total population projections based on land use trends within the City (discussed in Section 3.4). The projected water demands for the water use sectors were based on the percentage breakdown of water demands from each individual water use sector in FY 2024-25 (the percentages were then applied to the projected total water demands). A discussion of the City’s water supplies from Upper Water, a wholesaler, are discussed in Section 6.2. As discussed in Section 2.4.1, the City has coordinated its water demand projections with Upper Water for each water use sector. The City’s water demand projections incorporate water savings from “passive savings” which are the result of implementation of codes, standards, and/or ordinances. The City’s ”Water Conservation Plan”, which was created through Ordinance No. 1930, which was adopted in 1991 and subsequently expanded upon by the adoption of Ordinance No. 2327 in 2015 (discussed in Chapter 9.1.3), includes methods for current and ongoing reduction in water use and water waste. Prior to adoption of Ordinance No. 2327, the City’s water use rate ranged from approximately 272 gallons per capita day to 317 gallons per capita day (from FY 1995-96 through FY 2004-05). As identified in Section 5.2.2, the 2025 Urban Water Management Plan City of Arcadia Page 4-11 City’s actual water use rate during FY 2019-20 was 230 gallons per capita per day which is a decrease of up to 87 gallons per capita per day from the recent historical water use and includes passive savings. The City’s projected water demands, incorporate water use targets less than its established SB X7-7 water use target for 2020 and incorporate ongoing water passive savings and reduced water use. As indicated in Table 4-3, estimated future water savings have been considered as part of the City’s water use projections. 4.2.5.5 LOWER-INCOME HOUSEHOLDS CWC 10631.1. (a) The water use projections required by Section 10631 shall include projected water use for single-family and multifamily residential housing needed for lower income households, as defined in Section 50079.5 of the Health and Safety Code, as identified in the housing element of any city, county, or city and county in the service area of the supplier. (b) It is the intent of the Legislature that the identification of projected water use for single-family and multifamily residential housing for lower income households will assist a supplier in complying with the requirement under Section 65589.7 of the Government Code to grant a priority for the provision of service to housing units affordable to lower income households. California Health and Safety Code 50079.5. (a) "Lower income households" means persons and families whose income does not exceed the qualifying limits for lower income families… In the event the federal standards are discontinued, the department shall, by regulation, establish income limits for lower income households for all geographic areas of the state at 80 percent of area median income, adjusted for family size and revised annually. The City’s water demands projections provided in Table 4-2 include projected water demands for lower income single-family and multi-family households. A lower income household is defined as a household with an income less than 80 percent of the “area median income”, adjusted for family size. For the purpose of this evaluation, the entire Los Angeles County was used for the “area median income”. The total number of lower 2025 Urban Water Management Plan City of Arcadia Page 4-12 income households within the City’s service area was estimated based on billing records provided by the City, a review of the City of Arcadia’s General Plan, a review of median household income range statistics provided by the US Census Bureau (https://data.census.gov/cedsci/), and a review of GIS maps of Disadvantaged Communities2 (DACs), including block groups, tracts, and places, provided by DWR. The estimated number of lower income households located within the City’s service area is 33.5 percent of the total number of households. As indicated in Table 4-2, the total projected residential (single family and multi-family) water demands within the City in 2050 is estimated at about 16,388 AFY. Based on a 33.5 percent use factor of total residential water demands, the projected water demand for lower income households will be about 5,496 AFY by FY 2049-50. The projected water demands for lower income households were included in the City’s total projected water demands, as indicated in Table 4-3. 4.2.5.6 CLIMATE CHANGE CONSIDERATIONS CWC 10630. It is the intention of the Legislature, in enacting this part, to permit levels of water management planning commensurate with the numbers of customers served and the volume of water supplied, while accounting for impacts from climate change. CWC 10635. (b) Every urban water supplier shall include, as part of its urban water management plan, a drought risk assessment… (and) shall include each of the following… (4) Considerations of the historical drought hydrology, plausible changes on projected supplies and demands under climate change conditions, anticipated regulatory changes, and other locally applicable criteria. 2 GIS information for DACs is based on data from the US Census showing census block groups, tracts, and places identified as disadvantaged communities (less than 80 percent of the State's median household income) or severely disadvantaged communities (less than 60 percent of the State's median household income). 2025 Urban Water Management Plan City of Arcadia Page 4-13 Climate is defined as “the average course or condition of the weather at a place usually over a period of years as exhibited by temperature, wind velocity and precipitation”.3 A change in the climate which produces a greater amount of precipitation (i.e. more runoff and/or snowpack) and lower temperatures is generally a benefit to water supplies. However, drought conditions which may result in decreased precipitation, decreased runoff, and increased temperature may adversely affect an urban water supplier’s ability to meet demands by potentially impacting supplies. Consequently, the focus of impacts of climate change is on these adverse consequences. Section 6.2 of this Plan describes the City’s sources of water supply, management practices associated with those sources, and the long-term reliability of those sources. Section 7.3 includes a Drought Risk Assessment which considers the potential impacts of climate change to the City’s water supply sources. Chapter 8 provides a detailed discussion of the City’s Water Shortage Contingency Plan, including but not limited to, the six standard water shortage levels in the event climate change results in a reduction to water supplies associated with a periodic drought condition. The following is a discussion of the City’s sources of supply, how those sources may be impacted by climate change, and the proactive actions the City and other local/regional water managers may take to address the potential climate change impacts on water supplies. Imported Water Supplies The City can receive treated imported water as discussed in Section 6.2.1 and relies on the Main Basin Watermaster and Raymond Basin Management Board to manage the groundwater supplies of the Main Basin and Raymond Basin. Consequently, the City directly and/or indirectly relies on Metropolitan Water District of Southern California 3 Climate, www.merriam-webster.com. 2025 Urban Water Management Plan City of Arcadia Page 4-14 (MWD) for those imported water supplies. MWD has prepared a Regional 2025 Urban Water Management Plan which includes a discussion (Section 2.6 in MWD’s 2025 UWMP) of the reliability of its water supplies and the impacts of climate change and is incorporated by reference in this Plan. Furthermore, the City is a sub-agency of the Upper Water which has also provided a discussion of climate change considerations and that discussion is included by reference. The following is a brief summary of MWD’s efforts: Resource Planning x MWD has established the Robust Decision Making (RDM) approach to identify vulnerabilities to its water supplies. Climate change information was applied to MWD’s simulated water supply scenarios to demonstrate the vulnerability of water supplies to climate change. x MWD altered the inflow hydrology scenarios on the Colorado River simulation model to reflect modified inflow to MWD’s Colorado River aqueduct. Knowledge Sharing and Research Support x MWD is an active and founding member of the Water Utility Climate Alliance (WUCA) which includes 12 nationwide partners collaborating on climate change considerations. As such, MWD shares agency actions on climate change and adaptation. WUCA has also released numerous research papers on climate change. 2025 Urban Water Management Plan City of Arcadia Page 4-15 Implementation of Programs and Policies x MWD’s programs include the use of solar energy, use of ride share programs, and reduction of greenhouse emissions. Collectively these actions are intended to impact the effects of climate change. Groundwater Supplies – Main Basin The City relies on groundwater produced from the Main Basin as discussed in Section 6.2.2. The Main Basin (which is included as a subbasin of the San Gabriel Valley Basin, Basin Number 4-13 pursuant to DWR Bulletin 118) has been identified by DWR as a very low-priority groundwater basin partially due to the fact it is adjudicated. In that regard, the Main Basin is actively managed by the Main Basin Watermaster and those management activities are described in detail in Section 6.2.2. Recognizing the potential impacts of climate change on the Main Basin groundwater supplies (decreased local runoff and replenishment, along with increased groundwater production, may lead to decreased groundwater levels), the City has used climate tools available on the California Energy Commission’s Cal-Adapt website (https://cal-adapt.org/) to identify potential future climate change cycles for the Main Basin. The Cal-Adapt website has been developed by the Geospatial Innovation Facility at the University of California, Berkeley with funding and advisory oversight by the California Energy Commission and California Strategic Growth Council. To address the uncertainty in future greenhouse gas emissions, Cal-Adapt has developed a Representative Concentration Pathway 4.5 (RCP 4.5) scenario and a Representative Concentration Pathway 8.5 (RCP 8.5) scenario. RCP 4.5 represents a scenario in which greenhouse gas emissions peak around 2040, then decline and stabilize. RCP 8.5 represents a scenario in which emissions continue to strongly rise through 2050 and 2025 Urban Water Management Plan City of Arcadia Page 4-16 plateau around 2100. RCP 4.5 is a “medium” emissions scenario that models a future in which there is an effort made by societies to reduce greenhouse gas emissions, whereas RCP 8.5 is a “business-as-usual” scenario. For the City’s climate change analysis, the RCP 4.5 scenario was selected. The Cal-Adapt climate tools also incorporate several General Circulation Models (GCMs), which represent physical processes in the atmosphere, ocean, and land surface. These GCMs projected future climates under conditions such as warm/dry, cooler/wetter, and average simulations. For the City’s climate change analysis, the average condition GCM (CanESM2) was selected. The climate tools available on the Cal-Adapt website were used to simulate projected annual precipitation and annual average maximum temperature in the Main Basin. An electronic boundary of the Main Basin was submitted online through the Cal-Adapt website in a “KML” file format (i.e. Google Earth format) and data using several of the available climate tools was generated. Based on the data generated by the Cal-Adapt simulations (see Appendix E), the average annual rainfall in the Main Basin is projected to be 21.7 inches through 2099, compared to historical average of 20.1 inches (from 1961 through 1990). In addition, the average maximum temperature is projected to be 84.7 degrees Fahrenheit compared to a historical average of 78.3 degrees Fahrenheit. Although there may be more precipitation in the future, it may be more likely to fall as rainfall compared to snowfall. The simulations do not denote the duration or intensity of storms contributing to the annual precipitation. Notwithstanding, the San Gabriel River watershed includes a complex and interconnected series of dams, reservoirs and replenishment basins to capture stormwater runoff. In an average to below average year of precipitation, over 95 percent of the precipitation in the watershed is retained within the watershed and is not lost to the ocean. Consequently, most if not all precipitation (whether it is rain or snowfall) likely will be captured for use in 2025 Urban Water Management Plan City of Arcadia Page 4-17 the Main Basin area and not adversely impacted by a potentially higher average annual temperature. Recognizing these potential impacts to local hydrology resulting from climate change and the resultant impacts to the groundwater supplies, the Main Basin Watermaster has taken (and may reinstate as needed) the following proactive actions to anticipate and circumvent the potential impacts of climate change. These actions will enable the City to rely on the Main Basin as a reliable source of supply. Judgment Amendments Since FY 2011-12 the Main Basin Watermaster has become more pro-active by implementing provisions of the Judgment, and developing and instituting new studies, programs and plans to address the drought conditions as they progressively worsened. As a direct result of a multiple-year drought (from 2006 to 2009), the 2012 Judgment Amendments provided Watermaster with increased management flexibility and adaptability; and provided more discretion in making Basin management decisions. A key component of the Judgment Amendments was the new Water Resource Development Assessment (RDA) to be levied on all production. The RDA was designed to help address the potential future unavailability of imported replenishment water supplies, by allowing the Watermaster to collect RDA funds and purchase replenishment water for storage in the Basin to offset a future Replacement Water obligation (discussed in Section 6.2.2). Storm Water Capture During FY 2011-12, the Watermaster convened an Ad Hoc Committee on storm water capture to help address the local drought conditions that resulted in the historic low Key Well (representing groundwater elevation in the Main Basin) elevation in 2009. The Ad 2025 Urban Water Management Plan City of Arcadia Page 4-18 Hoc Committee performed extensive research and coordinated closely with the Los Angeles County, Department of Public Works (DPW) to identify and prioritize several potential new and enhanced storm water capture projects. Reduce Operating Safe Yield The adjudicated water rights in the Main Basin are approximately 200,000 AF. Through adoption of an annual Operating Safe Yield the Main Basin Watermaster has the ability to reduce the amount of water rights available to Producers before they must pay an assessment for expensive imported water. The Operating Safe Yield has previously been set at 150,000 AF ten years in a row which has been about 75 percent of the adjudicated total. This action provides producers with an economic incentive to reduce demands. Cyclic Storage Cyclic Storage allows a producer who anticipates a Replacement Water obligation to also pre-purchase imported water and store it in the Main Basin to meet its future Replacement Water obligation. The use of Cyclic Storage helps increase groundwater levels, however, wet Replacement Water deliveries are deferred. Consequently, Cyclic Storage water will be applied to Replacement Water obligations for the short-term (one to three years), significantly reducing actual deliveries of Replacement Water. Therefore, with significant amounts of water stored in Cyclic Storage, setting “lower” Operating Safe Yields will have almost no short-term impacts on Basin water levels/supplies. Conservation Watermaster passed Resolution No. 03-14-260 declaring “drought conditions” and encouraged all Basin water producers to adopt reduced pumping and water conservation activities at the retail level. Due to conservation efforts in the Main Basin, production 2025 Urban Water Management Plan City of Arcadia Page 4-19 decreased from 242,900 AF in FY 2012-13 to 168,400 AF in FY 2022-23, a total of 74,500 AF. Groundwater production was 189,300 AF in FY 2024-25. With less water being pumped from the Main Basin, this has helped maintain groundwater levels in the Main Basin. Recycled Water for Replenishment The Main Basin Watermaster has declared its support for a new recycled water supply project for Main Basin replenishment. When completed, the project could supply up to 100 percent of the overall imported replenishment water requirements. Basinwide Low Water Vulnerability Assessment During FY 2013-14, the Main Basin Watermaster initiated an evaluation of the potential impacts to groundwater production wells and local potable water supplies. The Watermaster also updated the basinwide information on water purveyor inter-connections in the event water supply from groundwater wells are reduced. In-Lieu Program During FY 2014-15, the Main Basin Watermaster re-instated the In-Lieu Program, where Watermaster funded a Producer’s cost difference to take direct delivery of MWD imported water “in-lieu” of pumping from its groundwater wells. The In-Lieu Program provided imported water to the Basin, and preserved groundwater supply in the Basin. Stormwater Augmentation Program During FY 2015-16, the Main Basin Watermaster evaluated other ways to help manage the Main Basin water supplies. While Southern California remained in extreme drought, 2025 Urban Water Management Plan City of Arcadia Page 4-20 northern California received above-average precipitation. As a result, replenishment water was made available. The Watermaster determined that during the previous five consecutive year drought from FY 2011-12 through 2015-16, nearly 400,000 acre-feet had been pumped from the Basin and not replaced by local rainfall and local runoff replenishment. The Water Resource Development Assessment for Stormwater Augmentation Program (RDA II) was developed by the Main Basin Watermaster to help manage Main Basin water supplies under the perceived “worst case” hydrologic conditions, which was assumed to be two additional consecutive five-year droughts, using the same hydrologic conditions as the recent FY 2011-12 through 2015-16 severe drought. Based upon ten (10) additional consecutive years of drought, the new RDA II Program is intended to purchase imported replenishment water (when available), for stormwater augmentation, to maintain the Baldwin Park Key Well (Key Well) elevation above 180 feet by the end of the tenth year. This Key Well elevation essentially ensures continued Main Basin water supply to the Main Basin Producers under a worst case, 15-year sustained drought. The RDA II Program has an assessment of $175 per AF on all FY 2024-25 production and is planned to be $175 per AF on all FY 2025-26 production, with a potential to increase in the next three to five years. Main Basin Watermaster will use the RDA II funds to purchase untreated imported water to replenish the Basin for the “general benefit” of all Producers within the Main Basin. The RDA II untreated imported water will supplement local stormwater replenishment, enhance overall Main Basin conditions, and have “no right of recovery” using a water right, by any Main Basin producer. Funding for the RDA II Program is based on the current year’s production. For example, assessments on FY 2024-25 production were levied in August 2025 and received by Watermaster by September 20, 2025. Main Basin Watermaster has entered into a Letter Agreement with Upper Water, MWD and Three Valleys District where Watermaster can purchase pre-delivered water over 10 years. This pre-delivered MWD water is purchased 2025 Urban Water Management Plan City of Arcadia Page 4-21 out of MWD’s Cyclic Storage account, and will be paid for by the Main Basin Watermaster, primarily using funds from the Resource Development Assessments from Upper Water and Three Valleys District producers. Groundwater Supplies – Raymond Basin The City relies on groundwater produced from the Raymond Basin as discussed in Section 6.2.2. The Raymond Basin (Basin Number 4-23 pursuant to DWR Bulletin 118) has been identified by DWR as a very low-priority groundwater basin partially due to the fact it is adjudicated. In that regard, the Raymond Basin is actively managed by the Raymond Basin Management Board and those management activities are described in detail in Section 6.2.2. Recognizing the potential impacts of climate change on the Raymond Basin groundwater supplies (decreased local runoff and replenishment, along with increased groundwater production, may lead to decreased groundwater levels), the City has used climate tools available on the California Energy Commission’s Cal-Adapt website (https://cal-adapt.org/) to identify potential future climate change cycles for the Raymond Basin. The Cal-Adapt website has been developed by the Geospatial Innovation Facility at the University of California, Berkeley with funding and advisory oversight by the California Energy Commission and California Strategic Growth Council. To address the uncertainty in future greenhouse gas emissions, Cal-Adapt has developed a RCP 4.5 scenario and a RCP 8.5 scenario. RCP 4.5 represents a scenario in which greenhouse gas emissions peak around 2040, then decline and stabilize. RCP 8.5 represents a scenario in which emissions continue to strongly rise through 2050 and plateau around 2100. RCP 4.5 is a “medium” emissions scenario that models a future in which there is an effort made by societies to reduce greenhouse gas emissions, whereas 2025 Urban Water Management Plan City of Arcadia Page 4-22 RCP 8.5 is a “business-as-usual” scenario. For the City’s climate change analysis, the RCP 4.5 scenario was selected. The Cal-Adapt climate tools also incorporate several GCMs, which represent physical processes in the atmosphere, ocean, and land surface. These GCMs projected future climates under conditions such as warm/dry, cooler/wetter, and average simulations. For the City’s climate change analysis, the average condition GCM (CanESM2) was selected. The climate tools available on the Cal-Adapt website were to simulate projected annual precipitation and annual average maximum temperature in the Raymond Basin. An electronic boundary of the Raymond Basin was submitted online through the Cal-Adapt website in a “KML” file format (i.e. Google Earth format) and data using several of the available climate tools was generated. Based on the data generated by the Cal-Adapt simulations (see Appendix E), the average annual rainfall in the Raymond Basin is projected to be 26.1 inches through 2099, compared to historical average of 24.3 inches (from 1961 through 1990). In addition, the average maximum temperature is projected to be 82.7 degrees Fahrenheit compared to a historical average of 76.3 degrees Fahrenheit. Although there may be more precipitation in the future, it may be more likely to fall as rainfall compared to snowfall. The simulation does not denote the duration or intensity of the storms contributing to the annual precipitation. Notwithstanding, the San Gabriel River watershed (including the Rio Hondo, which is a distributary of the San Gabriel River) includes a complex and interconnected series of dams, reservoirs and replenishment basins to capture stormwater runoff. In an average to below average year of precipitation, over 95 percent of the precipitation in the watershed is retained within the watershed and is not lost to the ocean. Consequently, most if not all precipitation (whether it is rain or snowfall) likely will be captured and not adversely impacted by a potentially higher average annual temperature. 2025 Urban Water Management Plan City of Arcadia Page 4-23 Recognizing these potential impacts to local hydrology resulting from climate change and the resultant impacts to the groundwater supplies, the Raymond Basin Management Board has taken (and may reinstate as needed) the following proactive actions to anticipate and circumvent the potential impacts of climate change. These actions will enable the City to continue use rely on the Raymond Basin as a reliable source of supply. Temporary Reduction of Allowed Production Historical prolonged droughts have caused groundwater levels to decrease resulting in the Raymond Basin Management Board to temporarily reduce the amount of groundwater which may be produced. The decreased production is designed to promote recovery of groundwater levels. At such time the groundwater levels have recovered the program may be suspended, but can be reinstated as needed in the event groundwater levels decrease in the future. Recognizing allowed pumping is limited, the City along with other Raymond Basin producers have taken steps to reduce water demands to address the potential gap between supply and demand in the event demands cannot be entirely reduced. The City has production facilities in the Main Basin and has the ability to shift production, if needed. In addition, the City has a treated water connection and has access to MWD water as an additional source of supply. 2025 Urban Water Management Plan City of Arcadia Page 4-24 DISTRIBUTION SYSTEM WATER LOSS CWC 10631(d)(3). (d)(3)(A) The distribution system water loss shall be quantified for each of the five years preceding the plan update, in accordance with rules adopted pursuant to Section 10608.34. (B) The distribution system water loss quantification shall be reported in accordance with a worksheet approved or developed by the department through a public process. The water loss quantification worksheet shall be based on the water system balance methodology developed by the American Water Works Association. (C) In the plan due July 1, 2021, and in each update thereafter, data shall be included to show whether the urban retail water supplier met the distribution loss standards enacted by the board pursuant to Section 10608.34. PREVIOUS FIVE YEARS DISTRIBUTION SYSTEM LOSSES Distribution system water losses represent the potable water losses from the pressurized water distribution system and water storage facilities, up to the point of delivery to the customers. Sources of distribution system water loss can include: inaccurate metering due to faulty meters; water use not metered such as firefighting, flushing of the water system; and pipeline leaks. The California Water Code Section 10608.34 requires “On or before January 1, 2024, and on or before January 1 of each year thereafter, each urban retail water supplier shall submit a completed and validated water loss audit report for the previous calendar year or the previous fiscal year...” The water loss audits must follow American Water Works Association (AWWA) guidance and be validated by a certified water audit validator. The City’s water loss audits were prepared and validated pursuant to DWR requirements. The annual water loss audit reports submitted by retail water agencies in California, including the City, are available on DWR’s WUEdata website (https://wuedata.water.ca.gov/awwa_plans). 2025 Urban Water Management Plan City of Arcadia Page 4-25 The City’s annual water loss audits identify real water losses (e.g. leaks and main failures) and apparent water losses (e.g. customer meter inaccuracies, systematic data handling errors in customer billing systems, and unauthorized consumption). The City’s distribution system water losses are based on the sum of the real and apparent water losses. The City’s average distribution system water losses represent approximately 8.0 percent of its total water demands. This average water loss factor was incorporated into the City’s total potable water demand projections (Tables 4-2 and 4-3). PROGRESS TOWARD MEETING THE WATER LOSS PERFORMANCE STANDARD Consistent with the California Code of Regulations, Title 23, Sections 980 through 986, retail water suppliers are required to comply with Real Water Loss Performance Standards by January 1, 2028 (pursuant to SWRCB requirements). Until then, a supplier may, when calculating its Urban Water Use Objective (discussed further in Section 5.2.6), use real losses reported in the water loss audits provided to the Department of Water Resources (discussed in Section 4.3.1), rather than the standard-based budget calculated according to the equation described Section 970 of the California Code of Regulations. Pursuant to the California Water Code Section 10631(d)(3)(C), a retail water supplier is required to provide data in its 2025 Plan demonstrating whether the retail water supplier met its Water Loss Performance Standard. The California Code of Regulations includes the following methods for compliance: • Retail suppliers may have met their Real Water Loss Performance Standard if their 2025 or 2026 annual water loss audits (currently not available) show actual real water loss at or below the standard (California Code of Regulations Section 981[b]). 2025 Urban Water Management Plan City of Arcadia Page 4-26 • Retail suppliers may still meet the Real Water Loss Performance Standard if, by January 1, 2028, their 2027 annual water loss audit shows actual real water loss at or below the standard (California Code of Regulations Section 981[a] and [b]). • Apparent Water Loss Performance Standards are evaluated at the time compliance with the Real Water Loss Performance Standard is assessed (California Code of Regulations Section 981[d]). The City’s 2025 water loss audit is due by January 1, 2027 and was not available during the preparation, completion, and submittal of the City’s 2025 Plan. However, Table 4-6 presents the City’s Real and Apparent Water Loss Performance Standard, as well as the real and apparent water losses included in the City’s most recent water loss audit. The City will continue to improve data collection for assessing and reducing water losses while performing proactive measures to minimize real losses. City field personnel are trained to spot leaks and verify if water from fire hydrants is metered, permitted, or if the water is taken without authorization. SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 4 are provided below. 2025 Urban Water Management Plan City of Arcadia Page 4-27 TABLE 4-1: TOTAL USES FOR POTABLE AND NON-POTABLE WATER-ACTUAL Table 4-1 Total Uses for Potable and Non-Potable Water – Actual Use Type Drop down list May select each use multiple times These are the only use types that will be recognized by the WUEdata online submittal tool Potable or Non- Potable (OPTIONAL) Drop down list Volume (AF) Single Family Potable 7,010 Multi-Family Potable 1,863 Commercial Potable 2,284 Institutional/Governmental Potable 937 Other (optional) Fire Hydrants Potable 1 Landscape Potable 135 Distribution System Water Loss Potable 1,064 13294 0 13,294Total Submittal Table 4-1 Retail: Total Uses for Potable and Non-Potable Water — Actual Water Code Section 10631(d)(1) NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. 2025 Actual Water Use Add additional rows as needed Subtotal Potable Subtotal Non-Potable Additional Description (as needed) 2025 Urban Water Management Plan City of Arcadia Page 4-28 TABLE 4-2: TOTAL USES OF POTABLE AND NON-POTABLE WATER—PROJECTED Table 4-2 Total Uses for Potable and Non-Potable Water – Projected Use Type Drop down list May select each use multiple times These are the only Use Types that will be recognized by the WUEdata online submittal tool Potable or Non-Potable (OPTIONAL) Drop down list 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF) 2050 opt (AF) Single Family Potable 7,790 8,513 8,556 8,599 8,642 Multi-Family Potable 2,070 2,262 2,273 2,285 2,296 Commercial Potable 2,538 2,774 2,788 2,802 2,816 Institutional/Governmental Potable 1,041 1,138 1,144 1,150 1,155 Other (optional) Fire Hydrants Potable 1111 1 Landscape Potable 151 164 165 166 167 Distribution System Water Loss Potable 1,182 1,292 1,298 1,305 1,311 14,773 16,144 16,225 16,308 16,388 0000 0 14,773 16,144 16,225 16,308 16,388 Add additional rows as needed. Submittal Table 4-2 Retail: Total Uses for Potable, and Non-Potable Water — Projected Water Code Section 10631(d)(1) Projected Water Use (Report To the Extent that Records are Available) Additional Description (as needed) NOTES: Total DWR NOTES: Units of measure (AF, CCF, MG ) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Subtotal Non-Potable Subtotal Potable 2025 Urban Water Management Plan City of Arcadia Page 4-29 TABLE 4-3: INCLUSION IN WATER-USE PROJECTIONS Table 4-3 Inclusion in Water-Use Projections OPTIONAL TABLE 4-4: PASSIVE WATER SAVINGS PROJECTION DWR has deemed Table 4-4 to be optional. Table 4-4 Passive Savings Projection Are Future Water Savings Included in Projections? Drop down list (y/n) Yes If "Yes" to above, state the section or page number, in the cell to the right, where citations of the codes, ordinances, or otherwise are utilized in demand projections are found. Optional Suppliers may complete Optional Submittal Table 4-4 R to quantify the expected savings. Section 4.2.5 and Chapter 8 Are Lower Income Residential Demands Included In Projections? Drop down list (y/n)Yes Optional If the method for accounting Lower Income Residential Demands has been included, provide page number where this accounting can be found. Submittal Table 4-3 Retail: Inclusion in Water Use Projections Water Code Section 10631 (a), 10631 (d)(4)(A), and 10631 (d)(4)(B) NOTES: DWR NOTES: Additional guidance is provided in Appendix K. 2025 Urban Water Management Plan City of Arcadia Page 4-30 TABLE 4-5: WATER LOSS AUDIT REPORTING Table 4-5 Water Loss Audit Reporting Public Water System ID # Reported in Table 2-1 R Reporting Period Submitted to DWR Water Loss Audit Program (yes/no) 2020 No 2021 No 2022 Yes 2023 No 2024 No Submittal Table 4-5 Retail: Water Loss Audit Reporting Water Code Section 10631(d)(3)(A) CA1910003 DWR NOTES: Suppliers will provide a link to the WUEdata submittals of their Water Loss Audit Reports. NOTES: The City has also prepared Water Loss Audits representing Calendar Year 2020, Calendar Year 2021, and Fiscal Year 2024-25 and will be submitting these audits to DWR. Report submittal status for all five years for each Public Water System as available. Add rows as needed 2025 Urban Water Management Plan City of Arcadia Page 4-31 TABLE 4-6: PROGRESS TOWARD 2028 WATER LOSS STANDARD Table 4-6 Progress Toward 2028 Water Loss Standard 2028 Real Water Loss Standard per Unit per day Units for Real Water Loss Drop down list Number of Units (Connections or Miles corresponding with units selected) Volume of Total Real Loss (from AWWA Water Loss Audit) (AF) 2028 Apparent Water Loss Standard per Unit per Day Units for Apparent Water Loss Number of Connections Volume of Total Apparent Loss (from AWWA Water Loss Audit) (AF) CA1910003 Yes 19.0 Gallons per Service Connection per Day (GPSCD) 14958 792.144 47.3 44.4 Gallons per Service Connection per Day (GPSCD) 14958 162.426 9.7 Gallons per Service Connection per Day (GPSCD) Gallons per Service Connection per Day (GPSCD) Submittal Table 4-6 Retail: Progress Towards 2028 Water Loss Standard Water Code Section 10631(d)(3)(C) NOTES: Information used to complete the table above was based on the Water Loss Audit from FY 2022-23. The City has also prepared Water Loss Audits representing Calendar Year 2020, Calendar Year 2021, and Fiscal Year 2024-25 and will be submitting these audits to DWR. Apparent Water Loss Did the Water Board Calculate a Water Loss Standard for this Public Water System? (y/n) If no, Supplier will not complete this row. Real Water Loss Water Board's Calculated Water Loss Standards DWR NOTES: Units of measure (AF, CCF, MG) for Water Loss MUST remain consistent with units reported in Submittal Table 2-3. The units reported in Submittal Table 2-3 are used in this table 's calculations. Public Water System ID # Reported in Submittal Table 2- 1 R Add additional rows as needed. Most Recent AWWA Water Loss Audit Real Water Loss Per Unit per Day Most Recent AWWA Water Loss Audit Apparent Water Loss Per Unit per Day State Water Board Standard State Water Board Standard 2025 Urban Water Management Plan City of Arcadia Page 5-1 CHAPTER 5 SB X7-7 BASELINE, 2020TARGETS, 2025 REPORTING LAY DESCRIPTION – CHAPTER 5 SB X7-7 BASELINES, 2020 TARGETS, AND 2025 REPORTING Chapter 5 (SB X7-7 Baselines, 2020 Targets, and 2025 Reporting of the City’s 2025 Plan discusses and provides the following: x The Water Conservation Act of 2009 (or SB X7-7) required the State of California achieve a 20 percent reduction in urban water use by the year 2020. x SB X7-7 required urban water suppliers, including the City, to develop a “2020 Water Use Target” to assist the State of California to achieve the 20 percent reduction. The 2020 Water Use Target represents the amount of water each person should use per day (i.e. gallons per capita per day or GPCD) by the year 2020. x The City previously determined its 2020 Water Use Target during the preparation of its 2015 Plan by completing standardized tables (or the SB X7-7 Verification Form) to demonstrate compliance with the Water Conservation Act of 2009. The City’s 2020 Water Use Target was 238 GPCD. x The City’s per-capita water use during Fiscal Year 2019-20 was 230 GPCD. The City’s confirmed 2020 Water Use Target was 238 GPCD. The City’s per-capita water use during Fiscal Year 2019-20 met the 2020 Water Use Target. 2025 Urban Water Management Plan City of Arcadia Page 5-2 REPORTING REQUIREMENTS FOR WHOLESALE SUPPLIERS CWC 10608.12. (aj) “Urban wholesale water supplier,” means a water supplier, either publicly or privately owned, that provides more than 3,000 acre-feet of water annually at wholesale for potable municipal purposes. CWC 10608.36. Urban wholesale water suppliers shall include in the urban water management plans required pursuant to Part 2.6 (commencing with Section 10610) an assessment of their present and proposed future measures, programs, and policies to help achieve the water use reductions required by this part. The City is not a wholesale agency and is not required by DWR to complete Section 5.1. REPORTING REQUIREMENTS FOR RETAIL SUPPLIERS CWC 10608.40. Urban water retail suppliers shall report to the department on their progress in meeting their urban water use targets as part of their urban water management plans submitted pursuant to Section 10631. CWC 10608.12. (af) “Urban retail water supplier” means a water supplier, either publicly or privately owned, that directly provides potable municipal water to more than 3,000 end users or that supplies more than 3,000 acre-feet of potable water annually at retail for municipal purposes. The Water Conservation Act of 2009 (or SB X7-7) required the State of California achieve a 20 percent reduction in urban water use by the year 2020. SB X7-7 required urban 2025 Urban Water Management Plan City of Arcadia Page 5-3 water suppliers, including the City, to develop a “2020 Water Use Target” to assist the State of California to achieve the 20 percent reduction. The 2020 Water Use Target represents the amount of water each person should use per day (i.e. gallons per capita per day or GPCD) by the year 2020. The City previously determined its 2020 Water Use Target during the preparation of its 2015 Plan by completing standardized tables (or the SB X7-7 Verification Form) to demonstrate compliance with the Water Conservation Act of 2009. The City’s SB X7-7 Verification Form was also included in its 2020 Plan. The City’s 2020 Water Use Target was 238 GPCD. SUPPLIER WAS NOT AN URBAN RETAIL WATER SUPPLIER Section 5.2.1 is not applicable to the City. The City was an urban retail water supplier during and before the 2020 Plan cycle. SUPPLIER MET 2020 TARGET IN 2020 The City previously calculated its “2020 Water Use Target” in its 2015 Plan pursuant to the methodology provided by DWR. The City’s 2020 Water Use Target was confirmed to be 238 GPCD. As discussed in the City’s 2020 Plan, the annual gross water use by the City during FY 2019-20 was 13,935 AF. In addition, the estimated population within the City’s service area for FY 2019-20 was 53,998. As a result, the City’s per-capita water use during FY 2019-20 was 230 GPCD. As shown in Table 5-1, the City’s per-capita water use during FY 2019-20 met the 2020 Water Use Target. The City also demonstrated compliance with 2025 Urban Water Management Plan City of Arcadia Page 5-4 the 2020 Water Use Target by completing the SB X7-7 2020 Compliance Form (included in the 2020 Plan). SUPPLIER DID NOT MEET 2020 TARGET IN 2020—NO CHANGE TO SERVICE AREA Section 5.2.3 is not applicable to the City. As indicated in Section 5.2.2, the City previously met its 2020 Water Use Target as part of the 2020 Plan. SUPPLIER DID NOT MEET 2020 TARGET—CHANGE TO SERVICE AREA SINCE 2020 Section 5.2.4 is not applicable to the City. As indicated in Section 5.2.2, the City previously met its 2020 Water Use Target as part of the 2020 Plan. In addition, the City has not had any changes to its service area since 2020. FUNDING ELIGIBILITY CWC 10608.56. (a) On and after July 1, 2016, an urban retail water supplier is not eligible for a water grant or loan awarded or administered by the state unless the supplier complies with this part. 2025 Urban Water Management Plan City of Arcadia Page 5-5 If a retail water supplier does not achieve its 2020 Water Use Target, the retail water supplier is not eligible to receive a water grant or loan from the State of California until it complies. The following two exceptions to this are provided: x Water Code Section 10608.56(c) states that a water supplier shall be eligible for a water loan or grant if it “has submitted to the department for approval a schedule, financing plan, and budget, to be included in the grant or loan agreement, for achieving the per-capita reductions.” x Water Code Section 10608.56(e) states that a water supplier can also be eligible for a water loan or grant if it “has submitted to the department for approval documentation demonstrating that its entire service area qualifies as a disadvantaged community.” As indicated in Section 5.2.2, the City previously met its 2020 Water Use Target as part of the 2020 Plan. NEXUS TO STATE WATER BOARD URBAN WATER-USE OBJECTIVES (NOT REQUIRED FOR UWMPs) SWRCB’s “Making Conservation A Way of Life Regulation” (under the California Code of Regulations, Title 23, Section 965 et seq) requires urban retail water suppliers to annually calculate and comply with an Urban Water Use Objective (UWUO); carry out commercial, industrial, and institutional (CII) performance measures; and provide progress reports. The regulation is expected to reduce inefficient water use and protect water supplies from the effects of rising temperatures and drier conditions due to climate change. The Urban Water Use Objective is the sum of standard-based water use budgets for efficient residential indoor use, residential outdoor use, CII landscapes with dedicated irrigation meters (DIMs), and real water losses. Each budget is the product of the 2025 Urban Water Management Plan City of Arcadia Page 5-6 applicable standard and the water supplier’s unique characteristics (e.g., population). Water suppliers will be assessed for compliance with their overall objective, not each standards-based budget. The residential indoor water use standard is based on 55 GPCD (until December 31, 2024), 47 GPCD (from January 1, 2025 to January 1, 2030), and 42 GPCD (beginning January 1, 2030). The residential outdoor water standard is based on a landscape efficiency factor (representing plant factors and irrigation efficiency) of 0.80 (until June 30, 2035), 0.63 (from July 1, 2035 to June 30, 2040), and 0.55 (beginning July 1, 2040). The standard for commercial, industrial, and institutional (CII) landscapes is based on a landscape efficiency factor of 0.80 (until June 30, 2035), 0.63 (from July 1, 2035 to June 30, 2040), and 0.45 (beginning July 1, 2040). Urban retail water suppliers are also required to comply with real water loss standards by January 1, 2028. DWR has indicated that compliance with the Urban Water Use Objective requirements are under the authority of the SWRCB and that the requirements are not part of Urban Water Management Plan content requirements. However, the SWRCB uses the 2020 Water Use Targets as a back stop for the Urban Water Use Objective calculations. The Urban Water Use Objectives, together with excluded demands, are to be more efficient than the 2020 Water Use Targets. 2025 Urban Water Management Plan City of Arcadia Page 5-7 SUBMITTAL TABLES The applicable standardized Submittal Table referenced within Chapter 5 is provided below. Table 5-1 SB X7-7 2020 Target Progress 2025 Urban Water Management Plan City of Arcadia Page 6-1 CHAPTER 6 NORMAL YEAR WATER SUPPLY CHARACTERIZATION LAY DESCRIPTION – CHAPTER 6 NORMAL-YEAR WATER SUPPLY CHARACTERIZATION Chapter 6 (Normal-Year Water Supply Characterization) of the City’s 2025 Plan discusses and provides the following: x The City’s water supply sources include groundwater pumped from the Main Basin and Raymond Basin, and treated, imported surface water from Metropolitan Water District of Southern California purchased through Upper San Gabriel Valley Municipal Water District. x The City’s main source of water supply is groundwater pumped from the Main Basin. x A tabulation of the City’s historical water supplies is provided in Section 6.1. x A discussion regarding the City’s imported water supplies from Upper San Gabriel Valley Municipal Water District is provided. Information regarding imported water connections, capacities, reliability, and historical production is provided. x A discussion regarding the City’s groundwater supplies from the Main Basin and Raymond Basin is provided. Information regarding basin location, adjudication, management, water levels, water quality, water rights, and historical production is provided. x The City’s proposed future projects to maximize its water supply resources are discussed. x The City’s “energy intensity” is discussed and represents the quantity of energy consumed, measured in kilowatt hours, divided by the volume of water, measured 2025 Urban Water Management Plan City of Arcadia Page 6-2 in acre-feet over a one-year period. The total energy intensity associated with the City’s water management processes was estimated during FY 2024-25. In this Chapter, the City will identify and describe each of its sources of water supply. In addition, the City will describe the following: x Management of each water supply source; x Current provisions of a basin adjudication or Groundwater Sustainability Plan (GSP), as applicable, pertaining to management of groundwater supplies; x Measures the City is taking to develop potential new sources of water supply (as applicable); and x Opportunities for exchanges and transfers on a long- or short-term basis. The characterization of the City’s water supply sources will account for the anticipated availability during a normal year, a single dry year, a five consecutive year drought, along with projections through FY 2049-50. WATER SUPPLY ANALYSIS OVERVIEW CWC 10631. (b) Identify and quantify, to the extent practicable, the existing and planned sources of water available to the supplier over the same five-year increments described in subdivision (a), providing supporting and related information, including all of the following: (1) A detailed discussion of anticipated supply availability under a normal water year, single dry year, and droughts lasting at least five years, as well as more frequent and severe periods of drought, as described in the drought risk assessment. For each source of water supply, consider any information pertinent to the reliability analysis conducted pursuant to Section 10635, including changes in supply due to climate change. (2) When multiple sources of water supply are identified, a description of the management of each supply in correlation with the other identified supplies. 2025 Urban Water Management Plan City of Arcadia Page 6-3 (3) For any planned sources of water supply, a description of the measures that are being undertaken to acquire and develop those water supplies. CWC 10631. (h) … The wholesale agency shall provide information to the urban water supplier for inclusion in the urban water supplier’s plan that identifies and quantifies, to the extent practicable, the existing and planned sources of water as required by subdivision (b), available from the wholesale agency to the urban water supplier over the same five-year increments, and during various water-year types in accordance with subdivision (f). An urban water supplier may rely upon water supply information provided by the wholesale agency in fulfilling the plan informational requirements of subdivisions (b) and (f). The City’s water supply sources include groundwater pumped from the Main Basin and Raymond Basin, and treated, imported surface water from Metropolitan Water District of Southern California purchased through Upper San Gabriel Valley Municipal Water District. The City’s main source of water supply is groundwater pumped from the Main Basin. A tabulation of the City’s historical water supplies is provided below. 2025 Urban Water Management Plan City of Arcadia Page 6-4 Fiscal Year System Water Supply Sources (AF) Total Groundwater Purchased Water East Raymond Basin West Raymond Basin Main San Gabriel Basin MWD Imported Water 2010-11 3,544 1,632 9,840 0 15,016 2011-12 3,526 1,157 11,716 0 16,399 2012-13 2,006 1,930 13,276 0 17,211 2013-14 1,449 1,899 14,104 0 17,452 2014-15 2,051 1,265 12,010 0 15,326 2015-16 1,887 1,022 9,460 0 12,369 2016-17 2,658 460 10,229 0 13,346 2017-18 1,783 534 12,100 0 14,416 2018-19 2,311 508 10,754 0 13,574 2019-20 1,837 536 11,562 0 13,935 2020-21 2,216 678 12,116 0 15,009 2021-22 2,179 621 11,480 0 14,280 2022-23 1,734 641 9,245 0 11,621 2023-24 2,060 286 9,528 0 11,873 2024-25 2,167 772 10,355 0 13,294 Source: Data provided by the City SPECIFIC ANALYSIS APPLICABLE TO ALL WATER SUPPLY SOURCES The section below provides a discussion of the following information to the extent practical: x The City’s existing and planned sources of water supply are identified; x Each source of supply is quantified in five-year increments through FY 2049-50; 2025 Urban Water Management Plan City of Arcadia Page 6-5 x The anticipated supply availability under normal, single dry, and five consecutive dry years, and any other water year conditions included in the Drought Risk Assessment (see Chapter 7) are described; x The management of each water supply in correlation with other identified supplies is described. x Information pertinent to the reliability analysis, including climate change effects, is considered. The City historically has relied on Main Basin and Raymond Basin, and treated, imported surface water from Metropolitan Water District of Southern California purchased through Upper San Gabriel Valley Municipal Water District. The following descriptions summarize the City’s sources of supply (detailed descriptions are provided in Section 6.2). Existing and Planned Sources of Supply Purchased Treated Imported Water The City has historically purchased treated imported water from the Upper Water, as described in Section 6.2.1. In addition, Section 6.2.1 provides a detailed discussion of the existing and planned supply of the treated imported water, including a description of the management and reliability of those treated imported water supplies. Table 6-8 summarizes the actual treated imported water supply for FY 2024-25. In addition, Table 6-9 summarizes the projected water supply, in five-year increments, through FY 2049-50 under varying water supply conditions. Groundwater The City has historically pumped groundwater from the Main Basin and Raymond Basin as described in Section 6.2.2. In addition, Section 6.2.2 provides a detailed discussion of 2025 Urban Water Management Plan City of Arcadia Page 6-6 the existing and planned supply of the groundwater, including a description of the management and reliability of those groundwater supplies. Table 6-8 summarizes the actual groundwater supplies for FY 2024-25. In addition, Table 6-9 summarizes the projected water supply, in five-year increments, through FY 2049-50 under varying water supply conditions. Surface Water The City does not use surface water supplies to meet its water demands. Storm Water The City has historically received groundwater from the Main Basin and Raymond Basin. Management and use of the stormwater runoff from the San Gabriel River watershed, which is crucial to groundwater management, is described in Section 6.2.4. However, the City currently does not have its own program to beneficially use stormwater runoff as a direct source of supply. SPECIAL CONSIDERATIONS The City considered the issues described below when developing its planned sources of water supply. 6.1.2.1 CLIMATE CHANGE EFFECTS Climate change has the possibility of impacting the availability of planned water supplies, particularly during a drought period. Section 4.2.5.6 of this Plan provides a discussion regarding climate change effects on the City’s various sources of supply. 2025 Urban Water Management Plan City of Arcadia Page 6-7 6.1.2.2 REGULATORY CONDITIONS AND PROJECT DEVELOPMENT The City has considered the implications of emerging regulatory conditions and project development on the availability of planned water supplies. Section 1.4 provides a discussion of the reduced reliance on imported water supplies as well as the proposed Pure Water Southern California recycled water project. 6.1.2.3 OTHER LOCALLY APPLICABLE CRITERIA There are no locally applicable criteria which applies to the City. 6.1.2.4 WHOLESALE AND RETAIL SUPPLIERS COORDINATION Because the City relies on wholesale water supplies, the City has provided its 2025 Plan to Upper San Gabriel Valley Municipal Water District as discussed in Section 2.4.1. WATER SUPPLY CHARACTERIZATION PURCHASED OR IMPORTED WATER UPPER SAN GABRIEL VALLEY MUNICIPAL WATER DISTRICT The City can purchase treated, imported water from Metropolitan Water District of Southern California through Upper San Gabriel Valley Municipal Water District. MWD imports water from the Colorado River through the Colorado River Aqueduct, owned and operated by MWD, and the State Water Project, which utilizes the California Aqueduct for transmission to Southern California. Water delivered to Upper Water’s sub-agencies can be treated at MWD’s Weymouth Treatment Plant located in the City of La Verne. 2025 Urban Water Management Plan City of Arcadia Page 6-8 The City can purchase treated, imported water directly from its USG-6 (20 cubic feet per second) connection. The City’s purchases of treated, imported water from Upper Water over the past five years has been tabulated in Section 6.1. Over the past five years, the City has not purchased water from Upper Water. The City’s projected purchases of treated, imported water from Upper Water, over the next 25 years in five-year increments, is provided in Table 6-9. The City‘s treated imported water supplies from MWD, through Upper Water, may be impacted during a multi-year drought or other conditions which limits MWD from delivering sufficient water supplies to all of its member agencies, and consequently to the City. In anticipation of such a reduction in supplies, MWD developed a Water Supply Allocation Plan (WSAP) which is briefly described below. The WSAP provides a means of equitably providing reduced water supplies to each of MWD’s member agencies for up to 10 levels of reduction representing up to a 50 percent reduction. During calendar year 2007, critically dry conditions impacted MWD’s water supply sources. In addition, a ruling in the Federal Courts in August 2007 provided protective measures for the Delta Smelt (and subsequently other aquatic species) in the Sacramento-San Joaquin River Delta resulting in restrictions on the availability of State Water Project water. As a result, MWD adopted a Water Supply Allocation Plan in February 2008 to allocate available water supplies to its member agencies. MWD revised the WSAP in December 2014. The WSAP establishes ten different shortage levels and a corresponding Allocation to each member agency. Based on the shortage levels established by MWD, the WSAP provides a separate reduced Allocation to a member agency for its 1) Municipal and Industrial (M&I) retail demand and 2) replenishment demand. The WSAP formula considers historical local water production, full service treated water deliveries, 2025 Urban Water Management Plan City of Arcadia Page 6-9 agricultural deliveries and water conservation efforts when calculating each member agency’s Allocation. In general, the WSAP process calculates total historical member agency demand. That historical demand is then compared to member agency projected local supply for a specific Allocation year. The balance required from MWD, less an Allocation reduction factor, is the member agency’s “Water Supply Allocation” of imported water from MWD. When a member agency reduces its local demand through conservation or other means, the Allocation of imported water will increase. Depending on MWD’s available supply, MWD can establish a specific WSAP shortage level. The shortage level causes a regional reduction and calculates an allocation for each of its member agency. Additional information about MWD’s WSAP is provided in MWD’s Regional 2025 UWMP which is incorporated by reference. The following is a summary of MWD’s water shortage levels: Level 1 – Regional Percent Reduction of 5% Level 2 – Regional Percent Reduction of 10% Level 3 – Regional Percent Reduction of 15% Level 4 – Regional Percent Reduction of 20% Level 5 – Regional Percent Reduction of 25% Level 6 – Regional Percent Reduction of 30% Level 7 – Regional Percent Reduction of 35% Level 8 – Regional Percent Reduction of 40% Level 9 – Regional Percent Reduction of 45% Level 10 – Regional Percent Reduction of 50% In response to a fourth consecutive year of below average rainfall and critically dry conditions, MWD declared a WSAP Allocation Level 3 for fiscal year 2015-16, which represented a regional reduction of 15 percent. MWD rescinded the WSAP for fiscal year 2016-17 and has not reinstated the WSAP since that time. 2025 Urban Water Management Plan City of Arcadia Page 6-10 GROUNDWATER CWC 10631. (b)(4) If groundwater is identified as an existing or planned source of water available to the supplier, all of the following information: (A) The current version of any groundwater sustainability plan or alternative adopted pursuant to Part 2.74 (commencing with Section 10720), any groundwater management plan adopted by the urban water supplier, including plans adopted pursuant to Part 2.75 (commencing with Section 10750), or any other specific authorization for groundwater management for basins underlying the urban water supplier’s service area. (B) A description of any groundwater basin or basins from which the urban water supplier pumps groundwater. For basins that a court or the board has adjudicated the rights to pump groundwater, a copy of the order or decree adopted by the court or the board and a description of the amount of groundwater the urban water supplier has the legal right to pump under the order or decree. For a basin that has not been adjudicated, information as to whether the department has identified the basin as a high- or medium-priority basin in the most current official departmental bulletin that characterizes the condition of the groundwater basin, and a detailed description of the efforts being undertaken by the urban water supplier to coordinate with groundwater sustainability agencies or groundwater management agencies listed in subdivision (c) of Section 10723 to maintain or achieve sustainable groundwater conditions in accordance with a groundwater sustainability plan or alternative adopted pursuant to Part 2.74 (commencing with Section 10720). (C) A detailed description and analysis of the location, amount, and sufficiency of groundwater pumped by the urban water supplier for the past five years. The description and analysis shall be based on information that is reasonably available, including, but not limited to, historic use records. (D) A detailed description and analysis of the amount and location of groundwater that is projected to be pumped by the urban water supplier. The description and analysis shall be based on information that is reasonably available, including, but not limited to, historic use records. 2025 Urban Water Management Plan City of Arcadia Page 6-11 MAIN SAN GABRIEL BASIN Main Basin - Sustainable Groundwater Management Act The Main San Gabriel Basin (Main Basin) is a sub-basin of the San Gabriel Valley Basin pursuant to DWR Bulletin 118, Basin Number 4-013. Pursuant to the Sustainable Groundwater Management Act of 2014 (SGMA), the Main Basin was named as an adjudicated groundwater basin and is exempt from the requirements of developing a Groundwater Sustainability Plan and subsequently was designated a very-low-priority basin in DWR’s 2019 SGMA Basin Prioritization report. In compliance with SGMA, the Main Basin Watermaster submits its Annual Report to DWR. Main Basin - Adjudication Main Basin – Long Beach Judgment On May 12, 1959, the Board of Water Commissioners of the City of Long Beach, the Central Basin Municipal Water District (Central District), and the City of Compton, as plaintiffs, filed an action against San Gabriel and 24 other producers of groundwater from the San Gabriel Valley as defendants. This action sought a determination of the rights of the defendants in and to the waters of the San Gabriel River system and to restrain the defendants from an alleged interference with the rights of plaintiffs and persons represented by the Central District in such waters. After six years of study and negotiation a Stipulation for Judgment was filed on February 10, 1965, and the Judgment (Long Beach Judgment) was entered on September 24, 1965. Under the terms of the Long Beach Judgment, the water supply of the San Gabriel River system was divided at Whittier Narrows between San Gabriel Valley upstream and the coastal plain of Los Angeles County downstream. A copy of the Long Beach Judgment can be found in Appendix F. During water year 2018-19, the Water Replenishment District of Southern 2025 Urban Water Management Plan City of Arcadia Page 6-12 California (WRD) intervened in the Long Beach Judgment for the purpose of assuming all of the requirements of the Plaintiffs and the City of Long Beach, Central District, and the City of Compton were dismissed from their collective responsibilities by the Court. Under the terms of the Long Beach Judgment, the area downstream from Whittier Narrows (Lower Area), the plaintiffs and those they represent, are to receive a quantity of usable water annually from the San Gabriel River system comprised of usable surface flow, subsurface flow at Whittier Narrows and water exported to the Lower Area. This annual entitlement is guaranteed by the area upstream of Whittier Narrows (Upper Area), the defendants, and provision is made for the supply of Make-up Water by the Upper Area for years in which the guaranteed entitlement is not received by the Lower Area. Make-up Water is imported water purchased by the Main Basin Watermaster and delivered to agencies in Central District to satisfy obligations under the Long Beach Judgment. The entitlement of the Lower Area varies annually, dependent upon the 10-year average annual rainfall in the San Gabriel Valley for the 10 years ending with the year for which entitlement is calculated. The detailed operations described in the Long Beach Judgment are complex and requires continuous compilation of data so that annual determinations can be made to assure compliance with the Long Beach Judgment. In order to do this, a three-member Watermaster was appointed by the Court, one representing the Upper Area parties nominated by and through Upper Water, one representing the Lower Area parties nominated by and through WRD, and one jointly nominated by Upper Water and WRD. This three-member board is known as the San Gabriel River Watermaster (River Watermaster). The River Watermaster meets periodically during the year to adopt a budget, to review activities affecting water supply in the San Gabriel River system area, to compile and 2025 Urban Water Management Plan City of Arcadia Page 6-13 review data, to make determinations of usable water received by the Lower Area, and to prepare its annual report to the Court. The River Watermaster has rendered annual reports for the water years 1963-64 through 2024-25 and operations of the river system under that Court Judgment and through the administration by the River Watermaster have been satisfactory since its inception. One major result of the Long Beach Judgment was to leave the Main Basin free to manage its water resources so long as it meets its downstream obligation to the Lower Area under the terms of the Long Beach Judgment. Upper Water intervened in the Long Beach case as a defendant to enforce the provisions of a Reimbursement Contract, which was incorporated into the Long Beach Judgment to assure that any Make-up Water obligations under the terms of the Long Beach Judgment would be satisfied. Main Basin – Main Basin Judgment The Upper Area then turned to the task of developing a water resources management plan to optimize the conservation of the natural water supplies of the area. Studies were made of various methods of management of the Main Basin as an adjudicated area and a report thereon was prepared for the Upper San Gabriel Valley Water Association, an association of water producers in the Main Basin. After due consideration by the Association, Upper Water was requested to file as plaintiff, and did file, an action on January 2, 1968, seeking an adjudication of the water rights of the Main Basin and its Relevant Watershed. After several years of study (including verification of annual water production) and negotiations, a stipulation for entry of Judgment was approved by a majority of the parties, by both the number of parties and the quantity of rights to be adjudicated. Trial was held in late 1972 and the Judgment (Main Basin Judgment) was entered on January 4, 1973. The Main Basin Judgment was most recently amended on June 21, 2012. A copy of the Main Basin Judgment can be found in Appendix G. 2025 Urban Water Management Plan City of Arcadia Page 6-14 Under the terms of the Main Basin Judgment, all rights to the diversion of surface water and production of groundwater within the Main Basin and its Relevant Watershed were adjudicated. The Main Basin Judgment provides for the administration of the provisions of the Main Basin Judgment by a nine-member Main Basin Watermaster. Six of those members are nominated by water producers (producer members) and three members (public members) are nominated by the Upper Water and the San Gabriel Valley Municipal Water District (San Gabriel District), which overlie most of the Basin. The nine- member board employs a staff, an attorney and a consulting engineer. The Main Basin Watermaster holds public meetings on a regular monthly basis throughout the year. The Main Basin Judgment does not restrict the quantity of water, which parties may extract from the Main Basin. Rather, it provides a means for replacing all annual extractions in excess of a Party's annual right to extract water with Supplemental Water. The Main Basin Watermaster annually establishes an Operating Safe Yield for the Main Basin which is then used to allocate to each Party its portion of the Operating Safe Yield which can be produced free of a Replacement Water Assessment. If a producer extracts water in excess of its right under the annual Operating Safe Yield, it must pay an assessment for Replacement Water, which is sufficient to purchase one acre-foot of Supplemental Water to be spread in the Main Basin for each acre-foot of excess production. All water production is metered and is reported quarterly to the Main Basin Watermaster. In addition to Replacement Water Assessments, the Main Basin Watermaster levies an Administration Assessment to fund the administration of the Main Basin management program under the Court Judgment and a Makeup Obligation Assessment in order to fulfill the requirements for any makeup Obligation under the Long Beach Judgment and to supply fifty percent of the administration costs of the River Watermaster service. The Main Basin Watermaster levies an In-lieu Assessment and may levy special Administration Assessments. 2025 Urban Water Management Plan City of Arcadia Page 6-15 Water rights under the Main Basin Judgment are transferable by lease or purchase so long as such transfers meet the requirements of the Judgment. There is also provision for Cyclic Storage Agreements by which Parties and non-parties may store imported supplemental water in the Main Basin under such agreements with the Main Basin Watermaster pursuant to uniform rules and conditions and Court approval. The Main Basin Judgment provides that the Main Basin Watermaster will, insofar as practicable, spread imported water in the Main Basin to maintain the groundwater elevation at the Key Well above 200 feet. Under the terms of the Long Beach Judgment, any excess surface flows that pass through the Main Basin at Whittier Narrows to the Lower Area (which is then conserved in the Lower Area through percolation to groundwater storage) is credited to the Upper Area as Usable Surface Flow. Main Basin - Description The Main San Gabriel Basin is located within the San Gabriel Valley, which is located in southeastern Los Angeles County and is bounded on the north by the San Gabriel Mountains; on the west by the San Rafael and Merced Hills, on the south by the Puente Hills and the San Jose Hills, and on the east by a low divide between the San Gabriel River system and the Upper Santa Ana River system, as shown on Figure 3. The San Gabriel River and its distributary, the Rio Hondo, drain an area of about 490 square miles upstream of Whittier Narrows. Whittier Narrows is a low gap between the Merced and Puente Hills, just northwest of the City of Whittier, through which the San Gabriel River and the Rio Hondo flow to the coastal plain of Los Angeles County. Whittier Narrows is a natural topographic divide and a subsurface restriction to the movement of groundwater between the Main Basin and the Coastal Plain. The approximately 490 2025 Urban Water Management Plan City of Arcadia Page 6-16 square miles of drainage area upstream of Whittier Narrows consists of about 167 square miles of valley lands and about 323 square miles of mountains and foothills. The Main Basin includes essentially the entire valley floor of the San Gabriel Valley with the exception of the Raymond Basin and Puente Basin. The boundaries of the Main Basin are the Raymond Basin on the northwest, the base of the San Gabriel Mountains on the north, the groundwater divide between San Dimas and La Verne and the lower boundary of the Puente Basin on the east, and the common boundaries between Upper Water and Central District through Whittier Narrows on the southwest. The common water supply of the Main Basin does not include the Raymond Basin, the area northerly of Raymond Hill Fault, which was adjudicated in the Pasadena v. Alhambra case (Superior Court of the County of Los Angeles, 1944). The Puente Basin, although tributary to the Main Basin, is not included in the Main Basin administered by the Main Basin Watermaster. The Main Basin (administered by the Main Basin Watermaster) is a large groundwater basin replenished by stream runoff from the adjacent mountains and hills, by rainfall directly on the surface of the valley floor, subsurface inflow from Raymond Basin and Puente Basin, and by return flow from water applied for overlying uses. Additionally, the Main Basin is replenished with imported water. The Main Basin serves as a natural storage reservoir, transmission system and filtering medium for wells constructed therein. There are three municipal wholesale water districts overlying and/or partially overlying the Main Basin. The three districts are Upper Water, San Gabriel District, and Three Valleys Municipal Water District (Three Valleys District). Urbanization of the San Gabriel Valley began in the early part of the twentieth century, but until the 1940s, agricultural land use occupied more area than residential and commercial land use. After World War II, agricultural areas reduced rapidly and tend to 2025 Urban Water Management Plan City of Arcadia Page 6-17 be located in the easterly portion of the Main Basin and along power transmission rights of way adjacent to the San Gabriel River. Agricultural plots are discontinuous and relatively small. There are several major industrial areas adjacent to the San Gabriel River and within other portions of the valley. The greatest area of land use in the valley is for residential and commercial purposes. DWR Bulletin 118 does not identify the Main Basin as being in overdraft. Main Basin - Geology The Main Basin consists of a roughly bowl-shaped depression of bedrock, filled over millions of years with alluvial deposits. This bowl-shaped depression is relatively deep; the elevation at the base of the groundwater reservoir declines from about 800 feet above mean sea level (MSL) in the vicinity of San Dimas, at the northeast corner of the Main Basin, to about 2,200 feet below MSL in the vicinity of South El Monte (DWR, 1966, Plate II). Most of the alluvium deposited within this depression is debris from the San Gabriel Mountains, washed and blown down from the side of the mountains over time. This process has also resulted in the materials of the Main Basin varying in size from relatively coarse gravel nearer the mountains to fine and medium-grained sand containing silt and clay as the distance from the mountains increases. The principal water-bearing formations of the Main Basin are unconsolidated and semi-consolidated sediments, which vary in size from coarse gravel to fine-grained sands. The interstices between these alluvial particles throughout the Main Basin fill with water and transmit water readily to wells. The thickness of the water-bearing materials in the Main Basin ranges from 200 to 300 feet in the northeastern portion of the Main Basin near the mountains (DPW, 1934, page 141) to nearly 4,000 feet in the South El Monte area (DWR, 1966, page 31). The soils overlying the Main Basin average about six feet in depth. Soil depths are generally greater at the perimeter of the valley and decrease toward the center along the 2025 Urban Water Management Plan City of Arcadia Page 6-18 San Gabriel River. These soils are residual, formed in place through chemical, mechanical and plant weathering processes. The infiltration rates of these soils are greater along the natural channels and their adjacent flood plains. Lower infiltration rates are found in the perimeter areas of the valley. Since the valley is mostly urbanized, a significant portion of the area has been paved and many miles of stream channel have been lined for flood control purposes, thus decreasing infiltration of water through streambeds. Detailed basin geology is discussed in the report entitled “Planned Utilization of Ground Water Basins, San Gabriel Valley, Appendix A: Geo-hydrology” (DWR, 1966). Main Basin - Hydrology The total fresh water storage capacity of the Main Basin is estimated to be about 9.5 million acre-feet. Of that, about 1,100,000 acre-feet have been used historically in Main Basin operations. The change in groundwater elevation at the Baldwin Park Key Well4 Key Well (Key Well) is representative of changes in groundwater in the Main Basin. One foot of elevation change at the Key Well is roughly the equivalent of about 8,000 acre- feet of water storage. The historical high groundwater elevation was recorded at over 329.1 feet in April 1916, at which time Main Basin storage was estimated to be about 8,700,000 acre-feet. The historical low was recorded in November 2018 at 169.4 feet, at which time Main Basin storage was estimated to be about 7,400,000 acre-feet. The Key Well hydrograph illustrates the cyclic nature of basin recharge and depletion. The hydrograph also illustrates the dramatic recharge capability of the Main Basin during wet periods. 4 The Baldwin Key Well is a water-level monitoring well located in the City of Baldwin Park used to determine when imported water may or may not be spread in the Basin. 2025 Urban Water Management Plan City of Arcadia Page 6-19 Generally, water movement in the Main Basin is from the San Gabriel Mountains on the north to Whittier Narrows to the southwest. Groundwater movement in the northern and northeastern regions of the Main Basin is affected by faulting. For example, the Raymond Fault located in the northwesterly portion of the Main Basin separates the Raymond Basin from the Main Basin. The Main Basin is an unconfined aquifer. Although clay deposits appear mixed with the soils in several locations in the Main Basin and there are various clay lenses throughout the Main Basin, they do not coalesce to form a single impermeable barrier for the movement of subsurface water. The Main Basin therefore operates as a single, unconfined aquifer. As previously mentioned, a thorough discussion of basin hydrogeology is contained in the report “Planned Utilization of Ground Water Basins, San Gabriel Valley, Appendix A: Geo-hydrology” (DWR, 1966). Within the Main Basin there are a number of identified sub-basins. These include the Upper San Gabriel Canyon Basin, Lower San Gabriel Canyon Basin, Glendora Basin, Foothill Basin, Way Hill Basin and San Dimas Basin. In addition, the Puente Basin is tributary to the Main Basin from the southeast, between the San Jose and Puente Hills, but is not included in the Main Basin adjudication. Main Basin – Groundwater Replenishment The major sources of recharge to the Main Basin are direct penetration of rainfall on the valley floor, percolation of runoff from the mountains, percolation of imported water and return flow from applied water. Rainfall occurs predominantly in the winter months and is more intense at higher elevations and closer to the San Gabriel Mountains. The magnitude of annual recharge from direct penetration of local rainfall and return flow from applied water is not easily quantifiable. Percolation of runoff from the mountains 2025 Urban Water Management Plan City of Arcadia Page 6-20 and valley floor along with percolation of imported water has only been estimated. The DPW maintains records on the amount of local and imported water conserved in water spreading facilities and stream channels. The San Gabriel River bisects the Main Basin. The San Gabriel River originates at the confluence of its west and east forks in the San Gabriel Mountains. It flows through the San Gabriel Canyon and enters the Main Basin at the mouth of the canyon north of the City of Azusa. The San Gabriel River flows southwesterly across the valley to Whittier Narrows, a distance of about 15 miles. It exits San Gabriel Valley at Whittier Narrows, and transverses the Coastal Plain in a southerly direction to reach the Pacific Ocean at Alamitos Bay near the City of Long Beach. The San Gabriel River is joined and fed by tributary creeks and washes. In the Main Basin these include: Big Dalton Wash, which originates in the San Gabriel Mountains; Walnut Creek, which originates at the northeast end of the San Jose Hills; and San Jose Creek, which originates in the San Gabriel Mountains, but which travels around the southerly side of the San Jose Hills through the Puente Narrows before joining the San Gabriel River just above Whittier Narrows. The channel of the San Gabriel River bifurcates in the upper middle portion of the Main Basin, forming a channel to the west of and parallel to the San Gabriel River, known as the Rio Hondo. Tributaries draining the westerly portion of the Main Basin, including Sawpit Wash, Santa Anita Wash, Eaton Canyon Wash, Rubio Wash and Alhambra Wash, all of which originate in the San Gabriel Mountains or the foothills, feed the Rio Hondo. The Santa Anita Wash, Eaton Canyon Wash, Rubio Wash and Alhambra Wash all cross the Raymond Basin area before entering the Main Basin. The channel of the Rio Hondo passes through Whittier Narrows westerly of the San Gabriel River, and then flows southwesterly to join the Los Angeles River on the Coastal Plain. 2025 Urban Water Management Plan City of Arcadia Page 6-21 To protect residents of the San Gabriel Valley from flooding that can result during periods of intensive rainfall, the DPW and the U.S. Army Corps of Engineers (Corps of Engineers) have constructed an extensive system of dams, debris basins, reservoirs and flood control channels. The dams and reservoirs also operate as water conservation facilities. The dams and reservoirs that control the flow of the San Gabriel River and the Rio Hondo include: Cogswell Reservoir on the west fork of the San Gabriel River, San Gabriel Reservoir at the confluence of the west and east forks of the San Gabriel River, Morris Reservoir near the mouth of the San Gabriel Canyon, Santa Fe Reservoir in the northerly portion of the Main Basin and Whittier Narrows Reservoir at the southwestern end of the San Gabriel Valley. Many of the stream channels tributary to the San Gabriel River have been improved with concrete banks (walls) and concrete-lined bottoms. These stream channel improvements have significantly reduced the area of previous stream channels and reduce Main Basin recharge. A number of off-stream groundwater replenishment facilities have been established along these stream channels to offset such reductions in recharge. Some of these facilities are accessible to imported water supplies, while some facilities receive only local runoff. The paths of the surface streams are mirrored in the soils and in the direction of groundwater movement in the Main Basin. The tributary creeks and washes, carrying smaller amounts of water, generally flow toward the center of the San Gabriel Valley, while the direction of flow of the major streams, the San Gabriel River and the Rio Hondo, is from the mountains in the north to Whittier Narrows in the southwest. In similar fashion, the primary direction of groundwater movement in the Main Basin is from the north to the southwest, with contributing movement generally from the east and west toward the center of the Main Basin. The greatest infiltration and transmissivity rates of soils in the Main Basin are from north to south, with the maximum rates found in the center of the 2025 Urban Water Management Plan City of Arcadia Page 6-22 valley along the stream channels. Generally, the Main Basin directs groundwater to the southwest through Whittier Narrows. The Main San Gabriel Basin has a freshwater storage capacity of about 8.7 million acre- feet when the Key Well groundwater elevation is at 329.1 feet, of which about 125 feet of elevation change, or about 1,000,000 acre-feet, has been used for historical Basin operations. Local runoff is stored in a series of reservoirs operated by DPW and diverted into spreading grounds to replenish the groundwater supply. Groundwater recharge occurs every year and is exhibited as increasing water levels. High rainfall years can be identified as increases in the groundwater level of 30 feet or more in one year. In addition to groundwater replenishment with local storm runoff, the Watermaster maintains records of each producer’s water rights and annual production. Although there is no limit on the quantity of water that may be produced, production in excess of a water right is subject to a Replacement Water assessment. Watermaster uses funds collected from producers’ overproduction to purchase imported water from municipal water districts. Upper Water and Three Valleys District obtain their water from MWD. San Gabriel District has its own contract for State Water Project (SWP) water. Watermaster coordinates purchase and delivery of imported water to replenish the ground water basin, thus offsetting the producers’ overproduction and making the Basin whole. Groundwater Management Plan The Main Basin has been adjudicated and management of the local water resources within the Main Basin is based on that adjudication. Management of the water resources in the Main Basin is based upon Watermaster services under two Court Judgments: 2025 Urban Water Management Plan City of Arcadia Page 6-23 River Watermaster5 and Main Basin Watermaster6. The City is a party to both Judgments and as such participates in these cases. The City also participates in the Main Basin management described in the Main Basin Watermaster document entitled “Five-Year Water Quality and Supply Plan.” The following sections provide a description of the two Judgments and the Five-Year Water Quality and Supply Plan that make up the groundwater management plan for the Main Basin. In addition, this section describes Upper Water’s and San Gabriel Basin Water Quality Authority’s (WQA) policies to promote groundwater basin clean-up. Operations of the Groundwater Basin Through the Long Beach Judgment and the Main Basin Judgment, operations of the Main Basin are optimized to conserve local water to meet the needs of the parties of the Main Basin Judgment. Typically, water producers within Upper Water rely upon groundwater from Main Basin for their water supply. The City of Alhambra has agreed to receive treated, imported water as part of the Cooperative Water Exchange Agreement (CWEA) to reduce the groundwater extractions from the western portion of the Main Basin and the associated drawdown concerns. Imported water for groundwater replenishment is delivered through the flood control channels and diverted and spread at spreading grounds through Main Basin Watermaster’s agreement with DPW. Groundwater replenishment utilizes imported water 5 Board of Water Commissioners of the City of Long Beach, et al., v. San Gabriel Valley Water Company, et al., Los Angeles County Case No. 722647, Judgment entered September 24, 1965. 6 Upper San Gabriel Valley Municipal Water District v. City of Alhambra, et al., Los Angeles County Case No. 924128, Judgment entered January 4, 1973. 2025 Urban Water Management Plan City of Arcadia Page 6-24 and is considered Replacement Water under the terms of the Main Basin Judgment. In addition, it can be stored in the Main Basin through Cyclic Storage agreements, authorized by terms of the Main Basin Judgment, but such stored water may be used only to supply Supplemental Water to the Main Basin Watermaster. The Main Basin Watermaster has entered into a Cyclic Storage Agreement with each of the three municipal water districts. One is with MWD and Upper Water, which permits MWD to deliver and store imported water in the Main Basin in an amount not to exceed 200,000 acre-feet for future Replacement Water use. The second Cyclic Storage Agreement is with Three Valleys District and permits Three Valleys District to deliver and store up to 50,000 acre-feet for future Replacement Water use. The third is with San Gabriel District and permits San Gabriel District to deliver and store up to 50,000 acre- feet for future Replacement Water use. Imported Makeup Water has been delivered to lined stream channels and conveyed to the Lower Area. Makeup Water is required to be delivered to the Lower Area by the Upper Area when the Lower Area entitlement under the Long Beach Judgment exceeds the usable water received by the Lower Area. Imported water is used to fulfill the Makeup Water Obligation when the amount of Makeup Water cannot be fulfilled by reimbursing the Lower Area interests for their purchase of recycled water. The amount of recycled water for which reimbursement may be made as a delivery of Makeup Water is limited by the terms of the Long Beach Judgment to the annual deficiency in Lower Area Entitlement water or to 14,735 acre-feet, whichever is the lesser quantity. Salt and Nutrient Management Plan On February 9, 2009, the State Water Board adopted Resolution 2009-0011 that created the “Recycled Water Policy”. The Recycled Water Policy recognized that “…collapse of the Bay Delta ecosystem, climate change, and continuing population growth have 2025 Urban Water Management Plan City of Arcadia Page 6-25 combined with a severe drought on the Colorado River, and failing levees in the Delta, to create a new reality that challenges California’s ability to provide the clean water need for a healthy environment, a healthy population and a healthy economy, both now and in the future.” The Recycled Water Policy encourages appropriate water recycling, water conservation and use of stormwater to increase water supplies within California. The primary goal of the San Gabriel Valley Salt and Nutrient Management Plan (SNMP) is to assist the Main Basin Watermaster and participating/potential stakeholders to comply with the Recycled Water Policy regarding the use of the recycled water from municipal wastewater treatment facilities as a safe source of water supply, while maintaining the water quality objectives for salt and nutrients in the Basin Plan established by the Los Angeles Regional Water Quality Control Board. The primary objective of the SNMP is to comply with the specific requirements described in the Recycled Water Policy. They include: 1) Characterization of the Main Basin, 2) Identification of sources of salt, nutrients, and constituents of emerging concern (CECs) (when deemed necessary by the Recycled Water Policy) and their fate and transport, 3) Estimation of salt, nutrients, and CECs (if necessary) loadings and assimilative capacities, 4) Identification of water recycling and stormwater recharge/use goals and objectives, 5) Verification of compliance with Resolution No. 68-16 through antidegradation analyses, and 6) Development of a monitoring plan to verify compliance with the Basin water quality objectives. The SNMP reviewed the geology, hydrology and hydrogeology of the San Gabriel Basin, along with the institutional and management structure for the San Gabriel Basin. Total 2025 Urban Water Management Plan City of Arcadia Page 6-26 dissolved solids (TDS), Nitrate, Sulfate, and Chloride were identified as the primary constituents of concern. Sources of loading (precipitation, subsurface inflow, infiltration of applied water, storm runoff and untreated imported water replenishment) and unloading (groundwater pumping and subsurface outflow) were included in a spreadsheet computer model, along with average water quality data for TDS, Nitrate, Sulfate, and Chloride, on an annual basis. The SNMP proposed to use the Main Basin Watermaster’s existing Title 22 water quality monitoring program for groundwater and San Gabriel River water, with increased frequencies of monitoring for Total Dissolved Solids and nitrate, to satisfy the monitoring plan requirement of the SNMP. The following are recommendations for on-going salt and nutrient management in the San Gabriel Basin: x Regularly update the SNMP spreadsheet data so that impacts of potential future projects on salt and nutrient loading may be evaluated. x Continue to collect water quality data throughout the San Gabriel Basin. x Continue to meet with stakeholders on a regular basis to coordinate San Gabriel Basin management activities with an emphasis on stormwater runoff replenishment and continued use of SWP water for groundwater replenishment In-Lieu Program During calendar year 2014, the ability to deliver Supplemental Water (State Water Project water and Colorado River water) to replenish the Basin was severely limited. Consequently, during fiscal year 2014-15, Watermaster developed and implemented a program to have Producers purchase additional treated imported water for direct delivery in-lieu of pumping groundwater (In-Lieu Program), in an effort to reduce the amount of groundwater pumped from the Basin. The Watermaster uses the In-Lieu Assessment on all production to fund the additional direct cost incurred by a producer participating in the 2025 Urban Water Management Plan City of Arcadia Page 6-27 In-Lieu Program. Watermaster has implemented this program during fiscal year 2014-15 and 2015-16. Supplemental Water Reliability Storage Program (RDA) The 2012 Main Basin Judgment Amendments provided the Main Basin Watermaster with increased management flexibility and adaptability; and provided more discretion in making Basin management decisions. A key component of the Judgment Amendments was the new Water Resource Development Assessment to be levied on all production. The Supplemental Water Reliability Storage Program provides a process for the Main Basin Watermaster to generate funds to purchase and store Supplemental Water in the Basin to be used (applied) when there are limitations on the availability of Supplemental Water from the Responsible Agencies. As a result of the severe long-term drought conditions resulting in significant reductions on the quantity of local water replenishment to the Basin, the Main Basin Watermaster expanded RDA into the Supplemental Water Stormwater Augmentation Program described below. Supplemental Water Stormwater Augmentation Program The Water Resource Development Assessment for Stormwater Augmentation Program was developed by the Main Basin Watermaster to help manage Basin water supplies under the perceived “worst case” hydrologic conditions, which was assumed to be two additional consecutive 5-year droughts, using the same hydrologic conditions as the recent FY 2011-12 through 2015-16 severe drought. Based upon ten (10) additional consecutive years of drought, the new RDA II Program is intended to purchase imported replenishment water (when available), for stormwater augmentation, to maintain the Baldwin Park Key Well (Key Well) elevation above 180 feet by the end of the tenth year. This Key Well elevation essentially ensures continued Basin water supply to the Basin Producers under a worst case, 15-year sustained drought. The RDA II Program has an 2025 Urban Water Management Plan City of Arcadia Page 6-28 assessment of $175/AF on all FY 2024-25 production and is planned to also be $175/AF on all FY 2025-26 production with a potential to increase in the next three to five years. The Main Basin Watermaster will use the RDA II funds to purchase untreated imported water to replenish the Main Basin for the “general benefit” of all Producers within the Main Basin. Unlike the original RDA (Supplemental Water Replenishment Storage Program), which is a Watermaster pre-purchase of Replacement Water, the RDA II untreated imported water will supplement local stormwater replenishment, enhance overall Basin conditions, and have “no right of recovery” using a water right, by any Main Basin producer. MWD Letter Agreement Since 2017, Watermaster, Upper Water, the Three Valleys District, and MWD entered into a series of letter agreements to pre-deliver untreated imported water in support of Basin management programs (Letter Agreement). Through these agreements, MWD has delivered a cumulative total of 405,517.5 acre-feet of imported water. While deliveries have varied depending on hydrological conditions and local stormwater capture, these agreements have provided a critical means of supplementing the Basin’s supplies over time. During fiscal year 2023–24, Watermaster and Upper Water entered into a fourth agreement with MWD to pre-deliver an additional 87,000 acre-feet of untreated imported water during calendar year 2024. In addition, Watermaster and Three Valleys District entered into a separate agreement with MWD to pre-deliver about 35,000 acre-feet during calendar year 2024. During fiscal year 2024–25, Watermaster and Upper Water entered into a fifth agreement with MWD to pre-deliver an additional 86,000 acre-feet of untreated imported water during calendar year 2025. 2025 Urban Water Management Plan City of Arcadia Page 6-29 Three Year Purchased Water Plan On June 21, 2012, the Superior Court of the State of California for the County of Los Angeles (Court) approved certain proposed Judgment amendments. Some of these Judgment amendments help Watermaster address Supplemental Water supply concerns. One of the amendments, Exhibit H(3)(d), requires that “…on or before November 1 of each year, Watermaster shall prepare and distribute to the Responsible Agencies a three-year projection of its Supplemental Water purchases from each agency. Watermaster shall, to the extent feasible, coordinate the tentative schedule for delivery and payment of those purchases with each agency.” Judgment Amendment, Section 45(b)(7), allows Watermaster to “…levy an Assessment on all Pumping, as determined through Rules and Regulations … to support the purchase, financing, and/or development of new or additional Supplemental Water sources, in cooperation with one or more Responsible Agencies as appropriate.” Section 45(b)(7) established the “Water Resource Development Assessment” for the purchase or development of additional Supplemental Water supplies. Based on these Judgment amendments, Main Basin Watermaster also amended its Rules and Regulations to include a policy/criteria to develop the “Three-Year Purchased Water Plan” (Three-Year Plan). Under Section 26(d)(5) of the Rules and Regulations, the first priority for spreading of Supplemental Water is “…Supplemental Water ordered by Watermaster from Responsible Agencies for direct delivery to the Basin as Replacement Water…”. Recognizing many Producers currently pre-purchase Supplemental Water for delivery into their Cyclic Storage accounts, those pre-purchases are considered to have the same priority as Replacement Water. 2025 Urban Water Management Plan City of Arcadia Page 6-30 Exhibit M of Watermaster’s amended Rules and Regulations7 provides the policy/criteria for the “Three-year Purchased Water Plan,” and requires Main Basin Watermaster to estimate Supplemental Water purchases from the Responsible Agencies for each of the three subsequent years. The policy/criteria indicate estimated Supplemental Water purchases may be based on the following: 1) The first year shall be, at a minimum, the total Replacement Water requirement for the three Responsible Agencies (Upper Water, San Gabriel District, and Three Valleys. 2) The second and third years may be estimated as follows: a) Operating Safe Yield (OSY) established by Watermaster for the current fiscal year and next succeeding years; b) Alternative projections of the OSY; c) Evaluation of potential wet, average, and dry hydrologic conditions; d) Future groundwater production provided by or estimated for each producer; and e) Depending on Basin conditions, Watermaster may consider additional factors as necessary. As a result of the negotiated pre-delivery of significant MWD imported replenishment water by Watermaster, and subsequently transferred by MWD to Upper Water and Three Valleys District, the above policy/criteria has been superseded by this delivery of imported water to supplement local rainfall and runoff replenishment. Five-Year Water Quality and Supply Plan The Main Basin Watermaster was created in 1973 to resolve water issues that had arisen among water users in the San Gabriel Valley. Main Basin Watermaster’s mission was to generally manage the water supply of the Main Basin. During the late 1970s and early 7 https://www.watermaster.org/about-us (Rules and Regulations) 2025 Urban Water Management Plan City of Arcadia Page 6-31 1980s, significant groundwater contamination was discovered in the Main Basin. The contamination was caused in part by past practices of local industries that had carelessly disposed of industrial solvents referred to as Volatile Organic Compounds (VOCs) as well as by agricultural operations that infiltrated nitrates into the groundwater. Cleanup efforts were undertaken at the local, state, and federal level. Local water agencies adopted a joint resolution in 1989 regarding water quality issues that stated Main Basin Watermaster should coordinate local activities aimed at preserving and restoring the quality of groundwater in the Main Basin. The joint resolution also called for a cleanup plan. In 1991, the Court granted Main Basin Watermaster the authority to control pumping for water quality purposes. Accordingly, Main Basin Watermaster added Section 28 to its Rules and Regulations regarding water quality management. The new responsibilities included development of a Five-Year Water Quality and Supply Plan8, updating it annually, submitting it to the California Regional Water Quality Control Board, Los Angeles Region, and making it available for public review by November 1 of each year. Main Basin Watermaster prepares and annually updates the Five-Year Water Quality and Supply Plan in accordance with the requirements of the Section 28 Rules and Regulations. The objective is to coordinate groundwater-related activities so that both water supply and water quality in the Main Basin are protected and improved. Many important issues are detailed in the Five-Year Plan, including how Main Basin Watermaster plans to: 1. Monitor groundwater supply and quality; 2. Develop projections of future groundwater supply and quality; 8 https://www.watermaster.org/reports 2025 Urban Water Management Plan City of Arcadia Page 6-32 3. Ensure adequate supplemental water is available for groundwater replenishment; 4. Review and cooperate on cleanup projects, and provide technical assistance to other agencies; 5. Assure that pumping does not lead to further degradation of water quality in the Basin; 6. Address Perchlorate, N-nitrosodimethylamine (NDMA), and other emerging contaminants in the Basin; 7. Develop a cleanup and water supply program consistent with the U.S. Environmental Protection Agency (USEPA) plans for its San Gabriel Basin Superfund sites; and 8. Coordinate and manage the design, permitting, construction, and performance evaluation of the Baldwin Park Operable Unit (BPOU) cleanup and water supply plan. The Main Basin Watermaster, in coordination with Upper Water, has worked with state and federal regulators, along with local water companies to clean up water supplies. Section 28 of the Main Basin Watermaster’s Rules and Regulations require all producers (including the City) to submit an application to 1) construct a new well, 2) modify an existing well, 3) destroy a well, or 4) construct a treatment facility. The Main Basin Watermaster prepares a report on the implications of the proposed activity. As a party to the Main Basin Judgment, the City reviews a copy of these reports and is provided the opportunity to submit comments on the proposed activity before the Main Basin Watermaster Board takes final action. Water Quality Authority 406 Plan The WQA was established by the State Legislature on February 11, 1993 to develop, finance and implement groundwater treatment programs in the Main Basin. Section 406 2025 Urban Water Management Plan City of Arcadia Page 6-33 of the WQA Act requires the WQA “to develop and adopt a basinwide groundwater quality management and remediation plan” that is required to be consistent with the EPA’s National Contingency Plan (“NCP”) and Records of Decision (“ROD”) and all requirement of the Los Angeles Regional Water Quality Control Board (“LARWQCB”). According to the WQA Act, the Section 406 Plan, which is incorporated in this Plan by reference, must include: 1) Characterization of Basin contamination; 2) A comprehensive cleanup plan; 3) Strategies for financing the design, construction, operation and maintenance of groundwater cleanup facilities; 4) Provision for a public information program; and 5) Coordination of activities with federal, state, and local entities. WQA reviews and adopts the Section 406 Plan on an annual basis and as necessary, makes revisions according to changing regulatory, political and/or funding environments. In support of the Section 406 Plan, WQA also adopts an annual FY budget (July 1 through June 30) which includes all projects (actual or planned) WQA is facilitating through its participation during that time period. The budget identifies the various funding sources, and combinations thereof, to ensure full funding for each project (capital and/or O&M) can be achieved. Main Basin – Historical and Projected Basin Production The City’s currently produces groundwater from the Main Basin. The City’s share of the Operating Safe Yield is 4.23099 percent. Over the past five years, the City has produced 9,425 AFY to 12,116 AFY (see Table 6-1), with an average of 10,545 AFY from the Main Basin. The City’s projected production from the Main Basin, over the next 25 years in five- year increments, is provided in Table 6-9. 2025 Urban Water Management Plan City of Arcadia Page 6-34 As discussed above, the Main Basin is managed by the Main Basin Watermaster. The most recent amendments to the Main Basin Judgment were made in June 2012. Historical fluctuation of the Key Well elevation illustrates that since the Main Basin was adjudicated in 1973, it generally operated between an elevation 250 feet and 200 feet above MSL. Furthermore, at an elevation of 169 feet above MSL at the Key Well, which represents the historical low, the Main Basin has about 7,400,000 acre-feet of available storage. During the period of management under the Judgment, significant drought events have occurred from 1969 to 1977, 1983 to 1991, 1998 to 2004, 2006 to 2009, and 2011 to 2015. In each drought cycle the Main Basin has been managed to maintain water levels. RAYMOND BASIN Raymond Basin - Sustainable Groundwater Management Act The Raymond Basin is identified as Basin Number 4-013 pursuant to DWR Bulletin 118. The Sustainable Groundwater Management Act of 2014, identifies the Raymond Basin as an adjudicated groundwater basin, is exempt from the requirements of developing a Groundwater Sustainability Plan and subsequently was designated a very-low-priority basin in DWR’s 2019 SGMA Basin Prioritization report. In compliance with SGMA, the Raymond Basin Management Board submits its Annual Report to DWR. Raymond Basin - Adjudication In 1937, the City of Pasadena filed suit to adjudicate water rights of the Raymond Basin. A copy of the Raymond Basin adjudication is located in Appendix H. DWR was retained to prepare a Report of Referee which described the geology and hydrogeology of the Raymond Basin and identified the Safe Yield of the Raymond Basin as 21,900 acre-feet. 2025 Urban Water Management Plan City of Arcadia Page 6-35 In 1950, the City of Pasadena requested the Safe Yield of the Raymond Basin to be re- determined. Subsequently, the Court issued a Modification of Judgment on April 29, 1955 increasing the Safe Yield of the Raymond Basin to 30,622 acre-feet. This is referred to as the “Decreed Right of 1955” and water rights for all parties are provided. On January 17, 1974, the second modification of the Raymond Basin Judgment was signed allowing Parties credit for spreading of canyon diversions in spreading grounds in the vicinity of the Arroyo Seco, Eaton Wash and Santa Anita Creek Canyon. On March 26, 1984, the third modification of the Raymond Basin Judgment was signed establishing the Raymond Basin Management Board as the Watermaster for the Raymond Basin. The Raymond Basin Judgment adjudicated groundwater rights based on a long-term average yield of the Raymond Basin. The Raymond Basin Judgment allows a party to exceed its Decreed Right by no more than 10 percent, which will be deducted from the following year’s total allowable extraction. Conversely, a party is not allowed to carryover more than 10 percent of its Decreed Right to a subsequent year. Raymond Basin – Description The Raymond Basin is located in Los Angeles County about 10 miles north-easterly of downtown Los Angeles. Raymond Basin is a wedge in the northwesterly portion of the San Gabriel Valley and is bounded on the north by the San Gabriel Mountains, on the west by the San Rafael Hills and is separated from the Main San Gabriel Basin on the southeast by the Raymond Fault. The Raymond Basin is divided into an eastern unit, which is the Santa Anita sub-area, and the Western unit which is the Pasadena sub-area and the Monk Hill Basin. The location of the Raymond Basin and the subareas, as shown on Figure 4, the surface area of Raymond Basin is about 40.9 square miles. The principal streams in the Raymond Basin are the Arroyo Seco, Eaton Wash and Santa Anita Wash. The Arroyo Seco drains to the Los Angeles River, while Eaton Wash and Santa Anita Wash drain to the Rio Hondo, a distributary of the San Gabriel River. 2025 Urban Water Management Plan City of Arcadia Page 6-36 The geology of the Raymond Basin is described in detail in the “Report of Referee” prepared in 1943 by the State of California Division of Water Resources. The Raymond Basin is roughly triangular in shape. Its northern boundary, about twelve miles in length, is formed by a portion of the southerly front of the San Gabriel Mountains. The western boundary of the Raymond Basin is about eight miles long and is also composed of the same Basement Complex rocks which form the mountains and are continuous at depth, together with a small area of marine Tertiary sediment at the southern end. The Raymond Fault, the southern boundary of the triangle, crosses the Valley floor for a distance of about nine miles, connecting a granitic spur from the mountains at the eastern end of the Raymond Basin with Tertiary sediments outcropping in its southwestern corner. The Raymond Fault separates Raymond Basin from the Main San Gabriel Basin. The fault zone is not completely impervious and groundwater can flow across this boundary into the Main Basin, particularly in the northeasterly portion of the boundary. The source of natural groundwater supply to the Raymond Basin is direct rainfall, percolation from surface runoff from the northern and western sides, and presumably underground percolation of water from the mountain mass to the alluvium. DWR describes the hydrogeology of the Raymond Basin in its Bulletin 118 report, Basin Number 4-023. According to the report, the water-bearing materials of the Raymond Basin are dominated by unconsolidated Quaternary alluvial gravel, sand, and silt deposited by streams flowing out of the San Gabriel Mountains. Younger alluvium typically follows active streambeds and reaches a maximum thickness of about 150 feet. Older alluvium generally thickens southward from the mountain front, reaching a maximum of about 1,140 feet near Pasadena, then thins to about 200 feet near the Raymond Fault. However, confined groundwater conditions have existed locally in the Raymond Basin, particularly along the Raymond Fault near Raymond Hill where layers of finer grained sediments become more abundant. 2025 Urban Water Management Plan City of Arcadia Page 6-37 The Raymond Fault trends east-northeast and acts as a groundwater barrier along the southern boundary of the Raymond Basin. This fault acts as a complete barrier along its western end and becomes a less effective barrier at its eastward end. East of Santa Anita Wash, this fault ceases to be an effective barrier and the flow of groundwater southward into the Main Basin becomes essentially unrestricted. A north-trending divide paralleling the Eaton Wash separates both surface and subsurface water flow in the eastern portion of the Raymond Basin. The water level is higher on the eastern side of this divide, ranging from 300 feet higher in the north to about 50 feet higher in the south. Monk Hill, an emergent mound of consolidated bedrock within the Raymond Basin, causes groundwater to flow around it, but does not appreciably change the regional flow pattern. Groundwater elevation contour maps for the Raymond Basin are presented in the Raymond Basin Annual Reports9. Natural recharge to the Raymond Basin is mainly from direct percolation of precipitation and percolation of ephemeral stream flow from the San Gabriel Mountains in the north. The principal streams bringing surface inflow are the Arroyo Seco, Eaton Creek and Santa Anita Creek. Some stream runoff is diverted into spreading grounds and some is impounded behind small dams allowing the water to infiltrate and contribute to groundwater recharge of the Raymond Basin. An unknown amount of underflow enters the Raymond Basin from the San Gabriel Mountains through fracture systems. No recent estimates of available groundwater storage have been made for in the Raymond Basin. DWR (1971) study estimated the available stored water to be 1,000,000 acre-feet in 1970, leaving about 450,000 acre-feet of storage space available. 9 https://www.raymondbasin.org/reports 2025 Urban Water Management Plan City of Arcadia Page 6-38 Groundwater quality within the Raymond Basin is generally good quality with regards to most constituents except for high fluoride concentrations in the foothills and high nitrate concentrations in the Monk Hill and Pasadena Subareas. Volatile Organic Compounds including Trichloroethylene (TCE) and Tetrachloroethylene (PCE) have been detected in the Raymond Basin (particularly near the Arroyo Seco). In 1997, Perchlorate was first detected in several monitoring wells at the National Aeronautics and Space Administration’s (NASA) Jet Propulsion Laboratory (JPL) Superfund Site. Additionally, the Raymond Basin Management Board monitors for Hexavalent Chromium and other constituents to manage water quality effectively in the Raymond Basin. Raymond Basin - Historical Production The Decreed Right of 1955 provided the City with water rights to 2,118.0 AFY from the Pasadena Subarea and with water rights to 3,526.0 AFY from the Santa Anita Subarea. Due to recent multiple dry year conditions, the Raymond Basin Management Board has phased in a 30 percent reduction requirement over five years for all Decreed Rights to the Pasadena Subarea, beginning fiscal year 2009-10. As a result, the City’s current adjusted right to the Pasadena Subarea is 1,482.6 AFY (0.7 x 2,118.0 AFY). The Raymond Basin Management Board also implemented the 500-foot level limitation for all Decreed Rights to the Santa Anita Subarea in 2013. As a result, the City’s adjusted right to the Santa Anita Subarea is 2,321.0 AFY. The City’s total adjusted water right in the Raymond Basin is 3,803.6 AFY (1,482.6 AFY + 2,321.0 AFY). Over the past five years, the City has produced 2,345 AFY to 2,939 AFY (see Table 6-1), with an average of 2,671 AFY from the Raymond Basin. The City’s projected production from the Raymond Basin, over the next 25 years in five-year increments, is provided in Table 6-9. SURFACE WATER The City does not use surface water supplies to meet its water demands. 2025 Urban Water Management Plan City of Arcadia Page 6-39 STORMWATER The City does not directly use stormwater to meet its water demands. WASTEWATER AND RECYCLED WATER CWC 10633R. The plan shall provide, to the extent available, information on recycled water and its potential for use as a water source in the service area of the urban water supplier. The preparation of the plan shall be coordinated with local water, wastewater, groundwater, and planning agencies that operate within the supplier’s service area, and shall include all of the following: (a) A description of the wastewater collection and treatment systems in the supplier’s service area, including a quantification of the amount of wastewater collected and treated and the methods of wastewater disposal. (b) A description of the quantity of treated wastewater that meets recycled water standards, is being discharged, and is otherwise available for use in a recycled water project. (c) A description of the recycled water currently being used in the supplier’s service area, including, but not limited to, the type, place, and quantity of use. (d) A description and quantification of the potential uses of recycled water, including, but not limited to, agricultural irrigation, landscape irrigation, wildlife habitat enhancement, wetlands, industrial reuse, potable reuse, and other appropriate uses, and a determination with regard to the technical and economic feasibility of serving those uses. (e) The projected use of recycled water within the supplier’s service area at the end of 5, 10, 15, and 20 years, and a description of the actual use of recycled water in comparison to uses previously projected pursuant to this subdivision. (f) A description of actions, including financial incentives, which may be taken to encourage the use of recycled water, and the projected results of these actions in terms of acre-feet of recycled water used per year. (g) A plan for optimizing the use of recycled water in the supplier’s service area, including actions to facilitate the installation of dual distribution systems, to promote recirculating uses, to facilitate the increased use of treated wastewater that meets recycled water standards, and to overcome any obstacles to achieving that increased use. 2025 Urban Water Management Plan City of Arcadia Page 6-40 Discussion of wastewater collection, treatment, and recycled water use is included in this chapter. Municipal recycled water is municipal wastewater that has been treated at a municipal wastewater facility in a manner specified by the SWRCB-DDW to a specified quality to enable it to be used again for a beneficial purpose. Municipal wastewater must meet two requirements; it must be reused beneficially pursuant to Title 22 of the California Code of Regulations and it must be reused in accordance with a Regional Water Quality Control Board permit. Title 22 of the California Code of Regulations defines beneficial reuse of recycled water as “...the use of recycled water that has been transported from the point of treatment or production to the point of use without an intervening discharge to water of the State....” The City currently does not have access to recycled water supplies due to the lack of infrastructure to convey recycled water to the City. Subject to the availability of recycled water, the City would construct transmission and distribution facilities to deliver recycled water to customers within its service area. Additional information regarding the potential use of recycled water is provided below. 6.2.5.1 RECYCLED WATER COORDINATION CWC 10633. The plan shall provide, to the extent available, information on recycled water and its potential for use as a water source in the service area of the urban water supplier. The preparation of the plan shall be coordinated with local water, wastewater, groundwater, and planning agencies that operate within the supplier’s service area… The City does not have access to recycled water due to the lack of infrastructure to convey recycled water supplies to the City. However, the City is a sub-agency, and is located within the service area, of Upper Water, which provides recycled water service. 2025 Urban Water Management Plan City of Arcadia Page 6-41 Upper Water has developed a recycled water program to provide direct delivery of recycled water to serve non-potable demands in the southerly-most portion of its service area, thereby offsetting reliance on imported water supplies. Upper Water’s recycled water program is in various stages ranging from completed projects to planned and conceptual options. Recycled water supply is obtained from the two water reclamation plants described in the Section 6.2.5.2. 6.2.5.2 WASTEWATER COLLECTION, TREATMENT, AND DISPOSAL CWC 10633. (a) A description of the wastewater collection and treatment systems in the supplier’s service area, including a quantification of the amount of wastewater collected and treated and the methods of wastewater disposal. Wastewater generated by the City is treated by the Sanitation Districts of Los Angeles County (LACSD). Wastewater is collected within the City’s local sewer collection system. The City’s local sewers tie into one of LACSD’s regional trunk sewers crossing through the City. The regional trunk sewer lines deliver wastewater to one or more water reclamation plants owned by LACSD for treatment. The water reclamation plants are not located within the City’s service area. The water reclamation plants serving the City include the Whittier Narrows Water Reclamation Plant (WNWRP), the San Jose Creek Water Reclamation Plant (SJCWRP), and the A.K. Warren Water Resource Facility (formerly known as the Joint Water Pollution Control Plant), however, the percentage breakdown between these three plants in treating the City’s wastewater in unknown. LACSD estimates approximately 69 gallons of wastewater is generated per person per day within LACSD’s service area. Based on a 2025 population of approximately 54,700 within the City, the estimated amount of wastewater collected within the City’s service 2025 Urban Water Management Plan City of Arcadia Page 6-42 area is approximately 4,227 AFY, as shown in Table 6-2. As indicated previously and in Table 6-3, wastewater is not treated or disposed within the City’s service area. The WNWRP began operations in 1962 and has a treatment capacity of about 15 million gallons per day (MGD). During FY 2018-19, about 7.1 MGD of recycled water produced at the WNWRP is used at 29 different reuse sites. The WNWRP provides coagulated, filtered and disinfected tertiary effluent. All wastewater treated at the WNWRP meets recycled water standards. Approximately 99 percent of treated water at the WNWRP is reused in a recycled water project. The method of disposal when treated recycled water is not used (non-recycled) is discharge to the San Gabriel River/Rio Hondo and eventually flows to the ocean. The SJCWRP, which began operations in 1971, has a treatment capacity of about 100 MGD and provides coagulated, filtered and disinfected tertiary effluent. Consequently, approximately 24 percent of treated water effluent from the SJCWRP would be available for subsequent recycled water projects. The SJCWRP plant serves a largely residential population of approximately 1 million people. The method of disposal when treated recycled water is not used (non-recycled) is discharge to the San Gabriel River/Rio Hondo and eventually flows to the ocean. The A.K. Warren Water Resource Facility, which began operation in 1928 in the City of Carson, currently has a treatment capacity of about 400 MGD. The treatment level is primary and secondary treatment with disinfection. The plant serves a population of approximately 4.8 million people. Solids collected in primary and secondary treatment are processed in anaerobic digestion tanks where bacteria break down organic material and produce methane gas. Treated wastewater is ultimately disinfected prior to being discharged to the Pacific Ocean. All water discharged to the ocean is monitored to ensure compliance with applicable local, state, and federal standards for discharge water. 2025 Urban Water Management Plan City of Arcadia Page 6-43 6.2.5.3 RECYCLED WATER SYSTEM DESCRIPTION CWC 10633. (c) A description of the recycled water currently being used in the supplier’s service area, including, but not limited to, the type, place, and quantity of use. The City currently does not have access to recycled water supplies due to the lack of infrastructure to convey recycled water to the City. Subject to the availability of recycled water, the City would consider transmission and distribution facilities to deliver recycled water to customers within its service area. However, the City prepared the “Draft Recycled Water Feasibility Study” in November 2006 (See Appendix I), which identified potential recycled water customers within the City. 6.2.5.4 CURRENT, PROJECT, AND PROJECTED RECYCLED WATER USES CWC 10633. (b) A description of the recycled water currently being used in the supplier’s service area, including, but not limited to, the type, place, and quantity of use. A description of the quantity of treated wastewater that meets recycled water standards, is being discharged, and is otherwise available for use in a recycled water project. (d) A description and quantification of the potential uses of recycled water, including, but not limited to, agricultural irrigation, landscape irrigation, wildlife habitat enhancement, wetlands, industrial reuse, groundwater recharge, indirect potable reuse, and other appropriate uses, and a determination with regard to the technical and economic feasibility of serving those uses. (e) The projected use of recycled water within the supplier’s service area at the end of 5, 10, 15, and 20 years, and a description of the actual use of recycled water in comparison to uses previously projected pursuant to this subdivision. 2025 Urban Water Management Plan City of Arcadia Page 6-44 The City’s “Draft Recycled Water Feasibility Study”, November 2006, identified potential recycled water customers within the City based on recycled water use for large-volume irrigation purposes (e.g. municipal parks, fields, golf courses, etc.). Recycled water use factors were applied to overall water demands for these customers to determine the potential recycled water demands. A proposed recycled distribution water pipeline route was based on maximizing recycled water demands and minimizing pipeline and infrastructure costs (See Appendix I). Although the City has identified potential uses for recycled water, the City does not anticipate it will have access to recycled water supplies over the next 25 years due to the lack of infrastructure to convey recycled water to the City. Therefore, Table 6-4 and Table 6-5 are intentionally blank. 6.2.5.5 ACTIONS TO ENCOURAGE AND OPTIMIZE FUTURE RECYCLED WATER USE CWC 10633. The plan shall provide, to the extent available, information on recycled water and its potential for use as a water source in the service area of the urban water supplier. The preparation of the plan shall be coordinated with local water, wastewater, groundwater, and planning agencies that operate within the supplier’s service area, and shall include all of the following: (g) A plan for optimizing the use of recycled water in the supplier’s service area, including actions to facilitate the installation of dual distribution systems, to promote recirculating uses, to facilitate the increased use of treated wastewater that meets recycled water standards, and to overcome any obstacles to achieving that increased use. Due to the lack of infrastructure to convey recycled water to the City, the City is not planning or expanding recycled water use in the future within a specified timeframe, as 2025 Urban Water Management Plan City of Arcadia Page 6-45 indicated in Table 6-6. Methods by the City to encourage and optimize future recycled water use are provided below. The City’s “Draft Recycled Water Feasibility Study” identified potential funding sources. Funding for construction, operation, maintenance, and replacement of facilities for the proposed City’s recycled water distribution system would be obtained from federal, state, and local sources, including City revenues. The City’s “Draft Recycled Water Feasibility Study” also identified potential recycled water customers within the City (e.g. municipal parks, fields, golf courses, etc.) and a proposed recycled distribution water pipeline route was based on maximizing recycled water demands and minimizing pipeline and infrastructure costs. The Study also identified recycled water facilities, including recycled water distribution pipelines, booster pumps, reservoirs, and backflow prevention assemblies, and identified potential funding sources for these facilities. Although the proposed recycled water project is not projected to change any land use or planning designations of the proposed recycled customers, implementation of the proposed facilities may cause temporary and/or permanent changes to the physical environment during construction. However, the Study indicates mitigation measures are available for any potential air quality, water quality, hydrology, soils, traffic, land use, and aesthetics impacts from implementation of the proposed facilities. The City’s “Draft Recycled Water Feasibility Study” identified LACSD’s WNWRP as the preferred source of recycled water (although all WNWRP recycled water is currently used). The WNWRP supplies recycled water to Upper Water’s Phase IIA recycled water system (Whittier Narrows, Rosemead Extension, and the South El Monte Recycled Water Expansion Project). 2025 Urban Water Management Plan City of Arcadia Page 6-46 Upper Water provides wholesale deliveries of recycled water to member agencies. Upper Water supplies treated recycled water through Upper Water’s Phase I (Rose Hills), Phase IIA (Whittier Narrows, Rosemead, and South El Monte), Phase IIB (City of Industry), and La Puente Valley County Water District recycled water projects. Upper Water will continue to study future recycled water expansion projects, including recycled water deliveries to the City of Arcadia. DESALINATED WATER OPPORTUNITIES CWC 10631. (g) Describe the opportunities for development of desalinated water, including, but not limited to, ocean water, brackish water, and groundwater, as a long-term supply. Main Basin Groundwater produced from the Main Basin is low in TDS and does not require desalination. The SWRCB-DDW recommended TDS level is 500 milligrams per liter (mg/L) and water can be provided for long-term domestic use with TDS concentrations of up to 1,000 mg/L. Recent water quality data indicates the TDS values for the City’s groundwater wells are less than 500 mg/L. Due to the high quality (low TDS concentration) of the groundwater, the City does not need to investigate the use of desalination to develop or reestablish a new long-term supply. The City is currently not considering the development of a desalinated water project. However, there may be opportunities for use of desalinated ocean water as a potential water supply source in the future, if needed, through coordination with other agencies that have ocean desalination programs. 2025 Urban Water Management Plan City of Arcadia Page 6-47 Raymond Basin The City pumps groundwater from the Raymond Basin which is low in TDS and does not require desalination. The SWRCB-DDW recommended level is 500 milligrams per liter and water can be provided for long-term domestic use with TDS concentrations of up to 1,000 mg/L. Recent water quality data indicates the TDS values for the City’s groundwater wells are less than 500 mg/L. Due to the low TDS concentration of the groundwater from the Raymond Basin, the City does not need to investigate the use of desalination as a long-term supply. However, there may be opportunities for use of desalinated ocean water as a potential water supply source in the future, through coordination with other agencies that have ocean desalination programs. WATER EXCHANGES AND TRANSFERS CWC 10631. (c) Describe the opportunities for development of desalinated water, including, but not limited to, ocean water, brackish water, and groundwater, as a long-term supply. 6.2.7.1 EXCHANGES Pursuant to DWR’s 2025 Final Guidebook, “Water exchanges are typically water delivered by one water user to another water user, with the receiving water user providing water in return at a specified time or when the conditions of the parties’ agreement are met. Water exchanges can be strictly a return of water on a basis agreed upon by the participants or it can include payment and the return of water.” The City does not have any current or planned water exchange opportunities. 2025 Urban Water Management Plan City of Arcadia Page 6-48 6.2.7.2 TRANSFERS As a Party to the Main Basin Judgment, the City can pump from the Main Basin. The Main Basin Judgment does not restrict the quantity of groundwater that can be produced, but provides for a Replacement Water assessment for production in excess of water rights. In addition, the City has entered into a Cyclic Storage agreement, described in Section 6.2.2, with the Main Basin Watermaster to store imported water in the Main Basin for a period of up to five years to be used to offset a future Replacement Water requirement. 6.2.7.3 EMERGENCY INTERTIES The City has emergency interties (or interconnections) with other water agencies that serve as short-term emergency exchange opportunities. Emergency interconnections are distribution system interconnections between water agencies for use during critical situations where one system or the other is temporarily unable to provide sufficient potable water to meet its water demands and/or fire protection needs. An emergency interconnection will allow a water system to continue serving water during critical situations such as local water supply shortages as a result of earthquakes, fires, prolonged power outages, and droughts. The City has the ability to receive water from interconnections with the following water agencies: x Golden State Water Company (8-inches, two way) x Sunny Slope Water Company (6-inches, two way) x San Gabriel Valley Water Company (4-inches, two way) x California American Water Company (8-inches, two way) x MWD – USG-6 Connection (one way- in) 2025 Urban Water Management Plan City of Arcadia Page 6-49 SUPPLY FROM STORAGE Section 6.2.8 is not applicable. The City does not remove water from either surface storage or underground storage for use (including surface water placed into storage in a given year and retrieved in the following year). OTHER The City does not rely on any additional water supply sources. FUTURE WATER PROJECTS CWC 10631. (f) Include a description of all water supply projects and water supply programs that may be undertaken by the urban water supplier to meet the total projected water use, as established pursuant to subdivision (a) of Section 10635. The urban water supplier shall include a detailed description of expected future projects and programs that the urban water supplier may implement to increase the amount of the water supply available to the urban water supplier in normal and single-dry water years and for a period of drought lasting five consecutive water years. The description shall identify specific projects and include a description of the increase in water supply that is expected to be available from each project. The description shall include an estimate with regard to the implementation timeline for each project or program. In partnership with the City of Sierra Madre, the City is currently developing a new joint well project (Goldring Well) located at the City of Arcadia Public Works Services Department property. This project is expected to yield over 2,000 gpm (with 1,000 gpm going to the City of Arcadia) from the Main Basin. The project is estimated to be completed by 2027. 2025 Urban Water Management Plan City of Arcadia Page 6-50 The 2016 City of Arcadia Water Master Plan Update report also identified potential reservoir, pipeline, and booster station projects. In addition to Decreed Rights in the Raymond Basin and groundwater extraction from the Main Basin, the City has the ability to obtain supplemental water supplies from the following sources: x Cyclic storage provisions allow producers, including the City, to store supplemental water within the Main Basin for the purpose of supplying replacement water. x The City can receive direct deliveries of treated imported water through its MWD connection, USG-6, which has a capacity of 20 cubic feet per second (about 14,500 acre-feet per year if used continuously). The City does not typically use service connection USG-6 because the City’s current collective groundwater supplies are sufficient to meet water demands. ENERGY USE CWC 10631.2. (a) In addition to the requirements of Section 10631, an urban water management plan shall include any of the following information that the urban water supplier can readily obtain: (1) An estimate of the amount of energy used to extract or divert water supplies. (2) An estimate of the amount of energy used to convey water supplies to the water treatment plants or distribution systems. (3) An estimate of the amount of energy used to treat water supplies. (4) An estimate of the amount of energy used to distribute water supplies through its distribution systems. (5) An estimate of the amount of energy used for treated water supplies in comparison to the amount used for nontreated water supplies. 2025 Urban Water Management Plan City of Arcadia Page 6-51 (6) An estimate of the amount of energy used to place water into or withdraw from storage. (7) Any other energy-related information the urban water supplier deems appropriate. “Energy intensity” is defined as the quantity of energy consumed, measured in kilowatt hours (kWh), divided by the volume of water, measured in AF for a water management process over a one-year period. The information used to calculate the estimated energy intensity associated with the City’s water system is provided below. The energy intensity information is based on readily obtainable energy and water use data for the following water management processes: 1) extraction or diversion of water supplies; 2) placement into storage; 3) conveyance to distribution; 4) treatment; and 5) water system distribution. The City has tabulated its energy intensity using readily obtainable energy consumption data obtained from monthly electricity bills from Southern California Edison (SCE) for the whole water system and the corresponding water use data obtained from available water meter readings. The City has reported the energy intensity associated with the water management processes which occur within its operational control. Because the City does not track individual energy usage for each water management process identified above, the City has estimated the energy intensity using the a “total utility approach” (i.e. sum of all water management processes). The total energy consumed was approximately 10,785,416 kWh during FY 2024-25. Although the total energy consumption reported includes electricity usage for general administration (e.g. at City Hall) which is not associated with any water management processes, the general administration energy usage is considered negligible compared to overall water system use and has not been netted out. 2025 Urban Water Management Plan City of Arcadia Page 6-52 The total volume of water entering the potable water system was approximately 13,294 AF during FY 2024-25 and is consistent with the total volume of water provided in Table 4-1. The total energy intensity associated with the City’s water management processes is estimated at 2,490 kWh per million gallons. The energy intensity data and calculations based on the “total utility approach” are provided in Table O-1B below. The City’s water management processes do not include “consequential hydropower generation” where the energy generation is a direct consequence of water delivery (i.e. all water passing through the energy generation devices is delivered to users). The City’s water management processes do not include “non-consequential hydropower generation” where the energy generation is not a direct consequence of water delivery (i.e. energy could be generated even if no water was being delivered to water users). In addition, the City’s water management processes do not include any substantial “self-generated energy sources” including solar, wind, geothermal, biomass, co-generation, and diesel generator sources. 2025 Urban Water Management Plan City of Arcadia Page 6-53 Table O-1B. Recommended Energy Reporting — Total Utility Approach Water Delivery Product drop down list (If delivering more than one type of product recommend using Table O-1C) Retail Potable Deliveries Start Date of Reporting Period 7/1/2024 End Date of Reporting Period 6/30/2025 Is upstream embedded energy in the values reported?No Units of Measure for Water AF Total Utility See DWR NOTES Hydropower Net Utility 13,294 13,294 10,785,416 10,785,416 2,490 - 2,490 Quantity of Self-Generated Renewable Energy 0kWh Data Quality (Estimate, Metered Data, Combination of Estimates and Metered Data) Combination of Estimates and Metered Data Data Quality Narrative: Narrative: Energy Intensity (kWh/vol. converted to MG) Optional Submittal Table O-1B: Recommended Energy Reporting - SINGLE DELIVERY PRODUCT - TOTAL UTILITY APPROACH The total energy consumed was identified based on Southern California Edison (SCE) billing records. Although the total energy consumed includes electricity usage for general administration (which is not an identified water management process), general administration energy use is considered to be negligible compared to overall water system use and has not been netted out. Only for Water Delivery Products Under the Urban Water Supplier's Operational Control Sum of All Water Management Processes Non-Consequential Hydropower DWR NOTES: Total Utility:The volume of water entered in the “Total Utility” column should equal the volume of water entering the distribution system (ex cluding recycled water); in most cases, this is the total volume calculated in UWMP Table 4-1: 2025 Actual Total Uses for Potable and Non-Potable Water. Note if recycled water is included in your Submittal Table 4-1, you must exclude it from your volume in this table. NOTES: The total energy consumption includes energy associated with operating groundwater production wells and booster pumps to deliver water in the distribution system. Energy consumption is associated with operating groundwater water treatment. Energy consumption is also associated with plant lighting and air conditioning, and operating the Supervisory Control and Data Acquisition (SCADA) system and chlorination injection pumps. Volume of Water Entering Process Energy Consumed (kWh) 2025 Urban Water Management Plan City of Arcadia Page 6-54 SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 6 are provided below. TABLE 6-1: GROUNDWATER VOLUME PUMPED Table 6-1 Groundwater Volume Pumped 2025 Urban Water Management Plan City of Arcadia Page 6-55 TABLE 6-2: WASTEWATER COLLECTED WITHIN SERVICE AREA Table 6-2 Wastewater Collected Within Service Area 2025 Urban Water Management Plan City of Arcadia Page 6-56 TABLE 6-3: WASTEWATER TREATMENT AND OUTCOMES WITHIN UWMP SERVICE AREA Table 6-3 Wastewater Treatment and Outcomes Within UWMP Service Area 2025 Urban Water Management Plan City of Arcadia Page 6-57 TABLE 6-4: RECYCLED WATER DIRECT BENEFICIAL USES WITHIN SERVICE AREA Table 6-4 Recycled Water Direct Beneficial Uses Within Service Area 2025 Urban Water Management Plan City of Arcadia Page 6-58 TABLE 6-5: 2020 UWMP RECYCLED WATER-USE PROJECTION COMPARED TO 2025 ACTUAL Table 6-5 2020 UWMP Recycled Water-Use Projection Compared to 2025 Actual 2025 Urban Water Management Plan City of Arcadia Page 6-59 TABLE 6-6: METHODS TO ENCOURAGE FUTURE RECYCLED WATER USE Table 6-6 Methods to Encourage Future Recycled Water Use 2025 Urban Water Management Plan City of Arcadia Page 6-60 TABLE 6-7: EXPECTED FUTURE WATER SUPPLY PROJECTS OR PROGRAMS Table 6-7 Expected Future Water Supply Projects or Programs TABLE 6-8: WATER SUPPLIES—ACTUAL As discussed in Section 6.2, the City’s water supply sources consist of treated imported water purchased from Metropolitan Water District of Southern California through Upper Water (see Section 6.2.1) and groundwater from the Main and Raymond Basins (see Section 6.2.2). The actual quantities of the water supply sources available to the City during FY 2024-25 are summarized in Table 6-8. The reliable quantities of projected water supply sources available to the City in five-year increments through FY 2049-50 during normal or average years are summarized in Table 6-9. The reliability of these sources of 2025 Urban Water Management Plan City of Arcadia Page 6-61 supply are addressed in Section 7.2.3, including during normal years, single dry years, and five consecutive year droughts. The order of use of the City’s projected reliable water supplies from FY 2024-25 through FY 2049-50 in five-year increments is based on historical practices, water supply availability, and the cost of water. It is anticipated the City will initially use groundwater produced from the Main Basin and the Raymond Basin. The City will also use treated imported water, if needed. It is important to note that the Main Basin is adjudicated (as discussed in Section 6.2.2) and that there is no limit to the amount of groundwater which can be produced annually. Consequently, in the event treated imported water may be limited, the City has the flexibility to increase groundwater production from the Main Basin. The City’s projected quantities of treated imported water supplies are based on historical long-term averages and available supplies during previous dry year conditions. The City’s projected quantities of groundwater supplies from Main Basin are based on meeting the remainder of the City’s total water demands. As noted above, in the event treated imported water may be limited, the City has the flexibility to increase groundwater production from the Main Basin. Consequently, it is anticipated the City will have sufficient water supplies available to meet projected demands. 2025 Urban Water Management Plan City of Arcadia Page 6-62 Table 6-8 Water Supplies—Actual OPTIONAL TABLE 6-8DS: SOURCE DESALINATION BY SUPPLIER As discussed in Section 6.2.6, the City is currently not considering the development of a desalinated water project. As a result, optional Table 6-8DS is not included. Water Supply Drop down list May use each category multiple times. These are the only water supply categories that will be recognized by the WUEdata online submittal tool Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop Down list Actual Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Groundwater (not desalinated) East Raymond Basin Potable 2,167 Groundwater (not desalinated) West Raymond Basin Potable 772 Groundwater (not desalinated) Main Basin Potable 10,355 Purchased or Imported Water MWD Potable 0 13,294 0 00 13,294 0 Submittal Table 6-8 Retail: Water Supplies — Actual Water Code Section 10631(b) 2025 NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Total Entitlement: e.g. Water Right, Groundwater Allocation, Contracted Amount. Add additional rows as needed Total Subtotal Potable Subtotal Non-Potable Additional Description (as needed) 2025 Urban Water Management Plan City of Arcadia Page 6-63 TABLE 6-9: WATER SUPPLIES—PROJECTED Table 6-9 Water Supplies—Projected Water Supply Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Groundwater (not desalinated) East Raymond Basin Potable 2,300 2,300 2,300 2,300 2,300 Groundwater (not desalinated) West Raymond Basin Potable 800 800 800 800 800 Groundwater (not Main Basin Potable 11,673 13,044 13,125 13,208 13,288 Purchased or Imported Water MWD Potable 0 0 0 0 0 14,773 0 16,144 0 16,225 0 16,308 0 16,388 0 00 0 0000000 14,773 0 16,144 0 16,225 0 16,308 0 16,388 0 Submittal Table 6-9 Retail: Water Supplies — Projected Water Code Section 10631 (b) Projected Water Supply (Report to the Extent Practicable) Drop down list May use each category multiple times. These are the only water supply categories that will be recognized by the WUEdata online submittal tool Additional Detail on Water Supply Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop Down list 2050 (opt) Add additional rows as needed Total NOTES: 2030 2035 2040 2045 Subtotal Non-Potable Subtotal Potable DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Total Entitlement: e.g. Water Right, Groundwater Allocation, Contracted Amount. 2025 Urban Water Management Plan City of Arcadia Page 7-1 CHAPTER 7 WATER SERVICE RELIABILITY AND DROUGHT RISK ASSESSMENT LAY DESCRIPTION – CHAPTER 7 WATER SERVICE RELIABILITY AND DROUGHT RISK ASSESSMENT Chapter 7 (Water Service Reliability and Drought Risk Assessment) of the City’s 2025 Plan discusses and provides the following: x FY 2019-20 represents an “average” or “normal” water year for the City in which the total amount of rainfall was similar to the historical average rainfall. x A “single dry” year for the City was represented in FY 2017-18, in which the total amount of rainfall was below the historical average rainfall. x A “five consecutive year drought” period for the City is represented from FY 2011- 12 to FY 2015-16, where the total amount of rainfall during each of these years was less than the historical average rainfall. x The City’s current and projected water supplies available during normal years in five-year increments over the next 25 years are provided (through Fiscal Year 2049-50) as shown on Table 7-2. x The City’s current and projected water supplies available during single dry years in five-year increments over the next 25 years are provided (through Fiscal Year 2049-50) as shown on Table 7-3. x The City’s current and projected water supplies available during each year of a five consecutive year drought in five-year increments over the next 25 years are provided (through Fiscal Year 2049-50) as shown on Table 7-4. x The reliability of the City’s water supply sources, including a review of water supply constraints, is provided. A single dry year or a five consecutive year drought period 2025 Urban Water Management Plan City of Arcadia Page 7-2 will not compromise the City’s ability to provide a reliable supply of water to its customers. x A Drought Risk Assessment is provided which includes an assessment of the City’s water supply reliability over a five consecutive year drought period. The City’s DRA assumes a five consecutive year drought from FY 2025-26 through FY 2029-30 and includes a review of water supplies, water uses, and water supply reliability for each water supply source during this period. The City’s water system has experienced a prior five consecutive year drought with no limitation to its collective water supplies. However, the cost of those water supplies may have increased based on the mix of water supplies which are used. Consequently, the City has the ability to enact varying water shortage levels (see Chapter 8) to help educate its customers and provide an economic incentive for the retail customers to reduce their water consumption. CONSTRAINTS ON WATER SOURCES CONSIDERATIONS CWC 10631. (b)(1) A detailed discussion of anticipated supply availability under a normal water year, single dry year, and droughts lasting at least five years, as well as more frequent and severe periods of drought, as described in the drought risk assessment. For each source of water supply, consider any information pertinent to the reliability analysis conducted pursuant to Section 10635, including changes in supply due to climate change. Water Code Section 10634 The plan shall include information, to the extent practicable, relating to the quality of existing sources of water available to the supplier over the same five-year increments as described in subdivision (a) of Section 10631, and the manner in which water quality affects water management strategies and supply reliability. Water Code Section 10635 2025 Urban Water Management Plan City of Arcadia Page 7-3 (b)(2) A determination of the reliability of each source of supply under a variety of water shortage conditions. This may include a determination that a particular source of water supply is fully reliable under most, if not all, conditions. Water Code Section 10635 (b)(4) Considerations of the historical drought hydrology, plausible changes on projected supplies and demands under climate change conditions, anticipated regulatory changes, and other locally applicable criteria. This section of the City’s UWMP describes the City’s ability to meet retail customer water demands by analyzing a variety of factors which affect the City’s water supply. This section assesses the City’s water service reliability during average years, single dry years, and during a five consecutive year drought period to meet the water needs of its customers. This section also includes the discussion of a Drought Risk Assessment which provides a mechanism for the City to evaluate the risk to its water supply under a drought lasting for the next five consecutive years. SERVICE RELIABILITY - CONSTRAINTS ON WATER SOURCES The City’s sources of supplies consist of groundwater pumped from the Main Basin and Raymond Basin, and treated, imported surface water from Metropolitan Water District of Southern California purchased through Upper Water, as described in Section 6.2. Although all of these supplies are managed, the following constraints may occur which the City has considered in this reliability analysis. Main Basin The City produces groundwater from the Main Basin. The groundwater historically had been impacted by contamination. However, the City has developed and implemented appropriate treatment (blending and/or treatment facilities) which have been approved by 2025 Urban Water Management Plan City of Arcadia Page 7-4 SWRCB-DDW. These groundwater supplies are considered reliable both from a water quality and quantity standpoint. Raymond Basin The City produces groundwater from the Raymond Basin. The groundwater historically had been impacted by contamination. However, the City has developed and implemented appropriate treatment (blending and/or treatment facilities) which have been approved by SWRCB-DDW. These groundwater supplies are considered reliable both from a water quality and quantity standpoint. Imported Water The City also receives treated surface water from MWD through Upper Water. Water quality from MWD relating to supply reliability is addressed separately in MWD’s 2025 Regional Urban Water Management Plan. WATER SERVICE RELIABILITY ASSESSMENT CWC 10635. (a) Every urban water supplier shall include, as part of its urban water management plan, an assessment of the reliability of its water service to its customers during normal, dry, and multiple dry water years. This water supply and demand assessment shall compare the total water supply sources available to the water supplier with the long-term total projected water use over the next 20 years, in five-year increments, for a normal water year, a single dry water year, and a drought lasting five consecutive water years. The water service reliability assessment shall be based upon the information compiled pursuant to Section 10631, including available data from state, regional, or local agency population projections within the service area of the urban water supplier. 2025 Urban Water Management Plan City of Arcadia Page 7-5 Information regarding the reliability of the City’s water supplies is based on the historical precipitation data in the San Gabriel Valley. Historical annual precipitation in the San Gabriel Valley is discussed in Section 3.3 and is based on historical data collected from Station 159 (Monrovia). Furthermore, Section 4.2.5.6 of this Plan notes that potential future climate change impacts may result in an increase in the average annual precipitation within the City’s service area, thus indicating use of historical data is a reasonable and conservative approach. As indicated in Section 3.3, the historical average rainfall in the vicinity of the City’s service area is 19.9 inches. FY 2019-20 represents an average or normal water year for the City in which the total amount of rainfall was similar to the historical average rainfall. A single dry year for the City was represented in FY 2017-18, in which the total amount of rainfall was below the historical average rainfall. A five consecutive year drought period for the City is represented from FY 2011-12 to FY 2015-16, where the total amount of rainfall during each of these years was less than the historical average rainfall. Table 7-1 summarizes these “base years” for average, single dry, and five consecutive year drought and provides the total amount of water supplies available to the City during those base years. The following discussion assesses the water service reliability of the City’s water supply sources. Water Service Reliability - Imported Water The City’s treated imported water supplies from MWD, through Upper Water, may be impacted during a multi-year drought or other conditions which limits MWD from delivering sufficient water supplies to all of its member agencies, and consequently to the City. In anticipation of such a reduction in supplies, MWD developed a WSAP which is briefly described below. The WSAP provides a means of equitably providing reduced water supplies to each of MWD’s member agencies for up to 10 levels of reduction representing up to a 50 percent reduction. 2025 Urban Water Management Plan City of Arcadia Page 7-6 During calendar year 2007, critically dry conditions impacted MWD’s water supply sources. In addition, a ruling in the Federal Courts in August 2007 provided protective measures for the Delta Smelt (and subsequently other aquatic species) in the Sacramento-San Joaquin River Delta resulting in restrictions on the availability of State Water Project water. As a result, MWD adopted a WSAP in February 2008 to allocate available water supplies to its member agencies. MWD revised the WSAP in December 2014. The WSAP establishes ten different shortage levels and a corresponding Allocation to each member agency. Based on the shortage levels established by MWD, the WSAP provides a separate reduced Allocation to a member agency for its 1) Municipal and Industrial (M&I) retail demand and 2) replenishment demand. The WSAP formula considers historical local water production, full service treated water deliveries, agricultural deliveries and water conservation efforts when calculating each member agency’s Allocation. In general, the WSAP process calculates total historical member agency demand. That historical demand is then compared to member agency projected local supply for a specific Allocation year. The balance required from MWD, less an Allocation reduction factor, is the member agency’s “Water Supply Allocation” of imported water from MWD. When a member agency reduces its local demand through conservation or other means, the Allocation of imported water will increase. Depending on MWD’s available supply, MWD can establish a specific WSAP shortage level. The shortage level causes a regional reduction and calculates an allocation for each of its member agency. Additional information about MWD’s WSAP is provided in MWD’s Regional 2025 UWMP which is incorporated by reference. The following is a summary of MWD’s water shortage levels: Level 1 – Regional Percent Reduction of 5% Level 2 – Regional Percent Reduction of 10% 2025 Urban Water Management Plan City of Arcadia Page 7-7 Level 3 – Regional Percent Reduction of 15% Level 4 – Regional Percent Reduction of 20% Level 5 – Regional Percent Reduction of 25% Level 6 – Regional Percent Reduction of 30% Level 7 – Regional Percent Reduction of 35% Level 8 – Regional Percent Reduction of 40% Level 9 – Regional Percent Reduction of 45% Level 10 – Regional Percent Reduction of 50% In response to a fourth consecutive year of below average rainfall and critically dry conditions, MWD declared a WSAP Allocation Level 3 for fiscal year 2015-16, which represented a regional reduction of 15 percent. MWD rescinded the WSAP for fiscal year 2016-17 and has not reinstated the WSAP since that time. Water Service Reliability - Groundwater Main Basin The Main Basin groundwater supplies are managed by the Main Basin Watermaster, as discussed in Section 6.2.2. During a normal year (FY 2019-20), the City met about 83 percent of its total demands with supplies from the Main Basin. During a single dry year (FY 2017-18), the City met about 84 percent of its total demands with supplies from the Main Basin. During a five consecutive year drought period (FY 2011-12 to FY 2015-16), the City met between 71 and 81 percent of its total demands with supplies from the Main Basin. 2025 Urban Water Management Plan City of Arcadia Page 7-8 Raymond Basin The Raymond Basin groundwater supplies are managed by the Raymond Basin Management Board, as discussed in Section 6.2.2. During a normal year (FY 2019-20), the City met about 17 percent of its total demands with supplies from the Raymond Basin. During a single dry year (FY 2017-2018), the City met about 16 percent of its total demands with supplies from the Raymond Basin. During a five consecutive year drought period (FY 2011-12 to FY 2015-16), the City met between 19 and 29 percent of its total demands with supplies from the Raymond Basin. Water Service Reliability Summary Table 7-1 shows the water supplies during the base years (for average year, single dry year and a five consecutive year drought). As a result of the City’s diverse water supply portfolio, water supplies may be re-apportioned during a five consecutive year drought to meet the City’s water demands. WSRA YEAR-TYPE CHARACTERIZATION 7.2.1.1 TYPES OF YEARS The City’s base years for an average year, a single dry year, and a five consecutive year drought are discussed in Section 7.2 and are summarized in Table 7-1. As indicated in Chapter 6, the City’s water supplies sources have been sufficient in meeting the City’s historical water demands during an average year, a single dry year, and a five consecutive year drought. An average year was based on a historical year during the past 15 years with a total precipitation similar to the historical average precipitation in the vicinity of the City’s service area. Because a single dry year or a five consecutive year drought period will not compromise the City’s ability to provide a reliable supply of water to its customers, 2025 Urban Water Management Plan City of Arcadia Page 7-9 a single dry year in this Plan was selected based one of the driest years during the past 15 years. The five consecutive year drought period was based on a period of five consecutive dry years during the past 15 years. As indicated in Section 3.3, the historical average rainfall in the vicinity of the City’s service area is 19.9 inches. FY 2019-20 represents an average or normal water year for the City in which the total amount of rainfall was similar to the historical average rainfall. A single dry year for the City was represented in FY 2017-18, in which the total amount of rainfall was less than the historical average rainfall. A five consecutive year drought period for the City is represented from FY 2011-12 to FY 2015-16, where the total amount of rainfall during each of these years was less than the historical average rainfall. Table 7-1 summarizes these “base years” for an average year, a single dry year, and a five consecutive year drought period and provides the total amount of water supplies available to the City during those base years. 7.2.1.2 SOURCES FOR WATER DATA The monthly historical average temperatures (including minimum and maximum), monthly historical average rainfall, and monthly ETo in the vicinity of the City’s service area are discussed in Section 3.3 Historical climate information was obtained from the WRCC, DPW, and from DWR’s CIMIS. WSRA SUPPLY AND DEMAND COMPARISON CWC 10635. (a) Every urban water supplier shall include, as part of its urban water management plan, an assessment of the reliability of its water service to its customers during normal, dry, and multiple dry water years. This water supply and demand assessment shall compare the total water supply sources available to the water supplier with the long-term total projected water use over the next 20 years, in five-year increments, for a normal water year, a single dry water 2025 Urban Water Management Plan City of Arcadia Page 7-10 year, and a drought lasting five consecutive water years. The water service reliability assessment shall be based upon the information compiled pursuant to Section 10631, including available data from state, regional, or local agency population projections within the service area of the urban water supplier. The City primarily obtains its water supplies from groundwater wells located in the Main Basin. As discussed in Section 7.3 and shown in Table 7-2, Table 7-3, and Table 7-4, each of the City’s water supply sources share the same base years. As previously discussed in Section 7.2.1, a single dry year or a five consecutive year drought period will not compromise the City’s ability to provide a reliable supply of water to its customers. The City’s projected normal year water demands over the next 25 years are discussed in Section 4.2.6.The ratio of total water supplies (including potable and recycled water supplies) available to the City during a historical normal year in FY 2019-20 (or 13,935 AF) and during a historical single dry year in FY 2017-18 (or 14,416 AF) was used to estimate the City’s projected water demands during single dry years. The ratio of water supplies available to the City during a historical normal year in FY 2019-20 (or 13,935 AF) and a historical five consecutive year drought period from FY 2011-12 to FY 2015-16 (or 16,399 AF, 17,211 AF,17,452 AF, 15,326 AF, and 12,369 AF, respectively) was used to estimate the City’s projected water demands during a five consecutive year drought period. The City’s projected dry year water supplies over the next 25 years were based on the minimum supplies needed by the City to meet projected single-dry year demands. Table 7-2, Table 7-3, and Table 7-4 summarize the City’s projected water demands and supplies over the next 25 years in five-year increments, including during normal years, single dry years, and a five consecutive year drought periods. These tables indicate the City can meet water demands during normal years, single dry years, and a five consecutive year drought periods over the next 25 years. 2025 Urban Water Management Plan City of Arcadia Page 7-11 7.2.2.1 NORMAL YEAR Table 7-2 summarizes the City’s projected water demands and supplies over the next 25 years in five-year increments during normal years. Table 7-2 indicates the City can meet water demands during normal years over the next 25 years. 7.2.2.2 SINGLE DRY YEAR Table 7-3 summarizes the City’s projected water demands and supplies over the next 25 years in five-year increments during single dry years. Table 7-3 indicates the City can meet water demands during single dry years over the next 25 years. 7.2.2.3 FIVE CONSECUTIVE DRY YEARS Table 7-4 summarizes the City’s projected water demands and supplies over the next 25 years in five-year increments during five consecutive year drought periods. Table 7-4 indicates the City can meet water demands during five consecutive year drought periods over the next 25 years. WSRA DESCRIPTION OF MANAGEMENT TOOLS AND OPTIONS CWC 10620. (f) An urban water supplier shall describe in the plan water management tools and options used by that entity that will maximize resources and minimize the need to import water from other regions. 2025 Urban Water Management Plan City of Arcadia Page 7-12 Main Basin As noted in Section 6.2.2, the Main Basin is managed by the Main Basin Watermaster. During the period of management under the Judgment, significant drought events have occurred. In each drought cycle the Main Basin has been managed to maintain water levels. Therefore, based on historical and on-going management practices, the City will be able to rely on the Main Basin for adequate supply over the next 25 years under single dry years and a five consecutive year drought periods. Section 6.2.2 provides a description of the management of groundwater resources in the Main Basin, as well as information on basin management. Chapter 6 also demonstrates the management structure of the Main Basin provides a reliable source of groundwater supply for the City during a normal year, a single-dry year and a five consecutive year drought. Historical data indicates the Main Basin has been well managed for the full period of the adjudication, resulting in a stable and reliable water supply. Basin management changes are discussed in Section 6.2.2, and include increased direct use of recycled water (see Section 6.2.5) and the planned use of treated recycled water for groundwater replenishment in the Main Basin to reduce the need to import water from other regions. Therefore, the groundwater supplies in the Main Basin are deemed reliable. Raymond Basin As noted in Section 6.2.2, the Raymond Basin is managed by the Raymond Basin Management Board. During the period of management under the Judgment, significant drought events have occurred. In each drought cycle the Raymond Basin has been managed to maintain water levels. Therefore, based on historical and on-going management practices, the City will be able to rely on the Raymond Basin for adequate supply over the next 25 years under single dry years and a five consecutive year drought periods. 2025 Urban Water Management Plan City of Arcadia Page 7-13 Section 6.2.2 provides a description of the management of groundwater resources in the Raymond Basin, as well as information on basin management. Chapter 6 also demonstrates the management structure of the Raymond Basin provides a reliable source of groundwater supply for the City during a normal year, a single-dry year and a five consecutive year drought. Historical data indicates the Raymond Basin has been well managed for the full period of the adjudication, resulting in a stable and reliable water supply. Therefore, the groundwater supplies in the Raymond Basin are deemed reliable. DROUGHT RISK ASSESSMENT CWC 10612. “Drought Risk Assessment” means a method that examines water shortage risks based on the driest five-year historic sequence for the agency’s water supply, as described in subdivision (b) of Section 10635. CWC 10635. (b) Every urban water supplier shall include, as part of its urban water management plan, a drought risk assessment for its water service to its customers as part of information considered in developing the demand management measures and water supply projects and programs to be included in the urban water management plan. The urban water supplier may conduct an interim update or updates to this drought risk assessment within the five-year cycle of its urban water management plan update. The drought risk assessment shall include each of the following: (1) A description of the data, methodology, and basis for one or more supply shortage conditions that are necessary to conduct a drought risk assessment for a drought period that lasts five consecutive water years, starting from the year following when the assessment is conducted. (2) A determination of the reliability of each source of supply under a variety of water shortage conditions. This may include a determination that a particular source of water supply is fully reliable under most, if not all, conditions. (3) A comparison of the total water supply sources available to the water supplier with the total projected water use for the drought period. 2025 Urban Water Management Plan City of Arcadia Page 7-14 (4) Considerations of the historical drought hydrology, plausible changes on projected supplies and demands under climate change conditions, anticipated regulatory changes, and other locally applicable criteria. The City’s sources of supplies consist of groundwater pumped from the Main Basin and Raymond Basin, and treated, imported surface water from Metropolitan Water District of Southern California purchased through Upper Water. The following discussion provides a Drought Risk Assessment which assesses the City’s water supply reliability over a five consecutive year drought period. The City’s DRA incorporates a five consecutive year drought from FY 2025-26 through FY 2029-30 and includes a review of water supplies, water uses, and water supply reliability. DRA, DATA, METHODS, AND BASIS FOR WATER SHORTAGE CONDITIONS The City’s DRA was prepared using historical production data from the City’s water supply sources. The following assumptions were considered during the preparation of the City’s DRA for each year of the five consecutive year drought. x The five consecutive year drought period associated with the 2025 Plan is based on five consecutive dry years from FY 2025-26 through FY 2029-30 x The projected water supplies available during each year of this five consecutive year drought are assumed to be identical to the water supplies produced during each year between FY 2011-12 and FY 2015-16 (which represents the most recent and historical five consecutive year drought). x The projected demands during this five consecutive year drought are based on water demands from FY 2019-20 (a normal year) which were adjusted based on projected population over the next five years along with the ratio of the normal year 2025 Urban Water Management Plan City of Arcadia Page 7-15 demands to actual demands over each year of the most recent and historical five consecutive year drought period (from FY 2011-12 and FY 2015-16). x The projected demands were compared to the projected supplies to identify potential water supply deficits which may require implementation of the Water Shortage Contingency Plan (discussed further in Chapter 8). The following methodologies were considered during the preparation of the City’s DRA during for each year of the five consecutive year drought: x Drought Year 1: The region had experienced an average to above average year of precipitation in the prior year. Water use in the prior year had been below average due to a reduce need for outdoor water use, the groundwater basin had been replenished from above average local stormwater runoff, and imported water supplies were not restricted. x Drought Year 2: The region experienced a second year of below average precipitation and runoff. Retail customers increased water use for outdoor irrigation to compensate for lack of precipitation. Groundwater and imported water supplies have not been impacted. x Drought Year 3: The region experienced a third year of below average precipitation and runoff. Retail customers increased water use for outdoor irrigation to compensate for lack of precipitation. Groundwater and imported water supplies have not been impacted. However, there is an increased demand on both groundwater and treated imported water. x Drought Year 4: The region experienced a fourth year of below average precipitation and runoff. Groundwater supplies have not been impacted. However, there is an increased demand on groundwater. x Drought Year 5: Fifth year of below average precipitation and runoff. Groundwater supplies have not been impacted. However, there is an increased demand on groundwater. 2025 Urban Water Management Plan City of Arcadia Page 7-16 DRA INDIVIDUAL WATER SOURCE RELIABILITY The City’s DRA incorporates a five consecutive year drought based on five consecutive dry years commencing in FY 2025-26. The quantity of water supplies available for each year during this five consecutive year drought period included in the City’s DRA is assumed to be the same as the quantity of water supplies produced by the City (i.e. demands) during the most recent and historical five consecutive year drought which occurred from FY 2011-12 through FY 2015-16. Production data for those years have been tabulated in Section 6.1. The following describes the anticipated reliability of each water source for each year of the five consecutive year drought based on recent experience. Groundwater – Main Basin The City receives water supplies from the Main Basin which is actively managed by the Main Basin Watermaster, as described in Section 6.2.2. Each year the Main Basin Watermaster reviews water supply conditions including local rainfall, groundwater levels, local stormwater runoff available for replenishment, imported water availability and the amount of imported water stored in the groundwater basin for future demands. The Watermaster identifies the annual amount of groundwater which may be pumped (such as an Operating Safe Yield) before more expensive imported water would need to be purchased from MWD through the Upper Water to replenish the Basin for all production in excess of the water rights. Regardless of the annual safe yield adopted there is never a restriction on the amount of water which may be pumped from the Main Basin, only the cost of producing the groundwater is impacted. The Main Basin Watermaster is not restricted as to when or how much untreated imported water be delivered to the Main Basin, only that it ultimately be delivered. In addition, the City has established an untreated imported water (cyclic) storage account in the Main Basin which the City may 2025 Urban Water Management Plan City of Arcadia Page 7-17 draw upon to offset its potential future production in excess of its water rights. In doing so, the City reduces its need to purchase untreated imported water in the future in the midst of a drought when imported water supplies may be limited. The quantity of groundwater used (and reliably available) during the most recent and historical five consecutive year drought period have been tabulated in Section 6.1. During this period, the City was able to increase its production of its groundwater supplies from an adjudicated and managed groundwater basin. The City also had the ability to systematically implement aspects of its Water Shortage Contingency Plan (see Chapter 8). As a result of these collective actions (and experience during prior consecutive five- year droughts), the City does not anticipate a water supply shortage from the Main Basin. Groundwater- Raymond Basin The City receives water supplies from the Raymond Basin which is actively managed by the Raymond Basin Management Board, as described in Section 6.2.2. The Raymond Basin is adjudicated; however, the City’s water rights are fixed each year. Consequently, the City cannot produce in excess of its own water rights or rights it may have leased from others. The City also has access to water supplies from Main Basin and treated imported water. The quantity of groundwater used (and reliably available) during the most recent and historical five consecutive year drought period have been tabulated in Section 6.1. The City manages its water supply portfolio to optimize the water supplies available each year and to avoid a water supply shortage. The City also had the ability to systematically implement aspects of its Water Shortage Contingency Plan (see Chapter 8). As a result of these collective actions (and experience during prior consecutive five-year droughts), the City does not anticipate a water supply shortage. 2025 Urban Water Management Plan City of Arcadia Page 7-18 Imported Water The City obtains imported water from the Metropolitan Water District of Southern California through Upper Water. Section 6.2.1 describes the planning conducted by the Metropolitan Water District of Southern California regarding treated imported water supplies available to the City. The reliability of MWD’s supplies is also discussed in its 2025 Regional UWMP and is incorporated by reference. The City purchases treated imported water which is delivered directly within its distribution system. The City’s purchases of treated, imported water over the past 15 years have been tabulated in Section 6.1. In the event of a drought which limits imported water supplies, the City will rely on its groundwater production and will pay the applicable assessments to purchase untreated imported water to be delivered in the future when supplies are available. The imported water purchases by the City during the most recent and historical five consecutive year drought period have been tabulated in Section 6.1. Because the City’s DRA assumes the most recent and historical five consecutive year drought scenario will be repeated over the next five years, it is assumed the quantity of treated imported water supplies purchased during the most recent and historical five consecutive year drought scenario will be available. Furthermore, this constitutes the minimum amount of treated imported water which may be available in a future five consecutive year drought absent MWD’s programs which it has since implemented. Summary The City’s water system has experienced a prior five consecutive year drought with no limitation to its collective water supplies. However, the cost of those water supplies may have increased based on the mix of supplies which are used. Consequently, the City has the ability to enact varying Demand Management Measures (see Chapter 9) to help 2025 Urban Water Management Plan City of Arcadia Page 7-19 educate its customers and provide an economic incentive for the retail customers to reduce their water consumption. DRA TOTAL WATER SUPPLY AND USE COMPARISON Gross water use for the projected five consecutive year drought is shown on Table 7-5. Section 7.3.2 describes the water source reliability for each source of supply the City will rely on during a five consecutive year drought. The annual quantities are summed and are also provided on Table 7-5. The most important aspect of the City’s water supplies is the groundwater which can be produced from a managed groundwater basin without restriction on the amount the City is allowed to produce. However, for the purposes of the City’s DRA, as a worst-case scenario, the City has considered no water supply augmentation (as indicated in Table 7-5) from its groundwater supplies. When necessary, the City can implement various water shortage levels of its Water Shortage Contingency Plan (as discussed in Chapter 8) in order to reduce its water demands. The total water supplies available to the City shown in Table 7-5 are based on the quantity of supplies produced by the City (i.e. demands) during the most recent historical five consecutive drought period (from FY 2011-12 through FY 2015-16). As shown in Table 7-5, assuming no additional water supply benefits will be available from groundwater supplies, the City can implement various stages of its Water Shortage Contingency Plan to balance water demands with available supplies during each year of the projected five consecutive year drought. OPTIONAL PLANNING TOOL WORKBOOK DWR has deemed the “Planning Tool Worksheet” as optional and the City is not required by DWR to use the tool. The City has provided sufficient water supplies to its customers, including during long-term droughts and years with historically high water demands. The City has also been able to provide water service to meet maximum day water demands 2025 Urban Water Management Plan City of Arcadia Page 7-20 for these years, including during the summer months. The City obtains the majority of its water supplies from managed groundwater basins which are not subject to seasonal fluctuation. Consequently, an evaluation regarding water supplies on a monthly basis was not considered. SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 7 are provided below. OPTIONAL TABLE 7-1: BASIS OF WATER-YEAR DATA (WSRA) Table 7-1 Basis of Water-Year Data (Reliability Assessment) 2025 Urban Water Management Plan City of Arcadia Page 7-21 TABLE 7-2: NORMAL-YEAR SUPPLY AND USE COMPARISON Table 7-2 Normal-Year Supply and Use Comparison 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF) 2050 (AF) Supply totals (autofill from Submittal Table 6-9 R) 14,773 16,144 16,225 16,308 16,388 Use totals (autofill from Submittal Table 4-2 R) 14,773 16,144 16,225 16,308 16,388 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) OPTIONAL Planned WSCP Actions Submittal Table 7-2 Retail: Normal Year Supply and Use Comparison Water Code Section 10635 (a) NOTES: DWR NOTES : Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. 2025 Urban Water Management Plan City of Arcadia Page 7-22 TABLE 7-3: SINGLE-DRY-YEAR SUPPLY AND USE COMPARISON Table 7-3 Single-Dry-Year Supply and Use Comparison Supply totals 15,283 16,701 16,785 16,871 16,954 Use totals 15,283 16,701 16,785 16,871 16,954 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) 2050 (AF) DWR NOTES : Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. NOTES Submittal Table 7-3 Retail: Single Dry Year Supply and Use Comparison Water Code Section 10635(a) OPTIONAL Planned WSCP Actions 2030 (AF)2035 (AF)2040 (AF)2045 (AF) 2025 Urban Water Management Plan City of Arcadia Page 7-23 TABLE 7-4: MULTIPLE DRY YEARS SUPPLY AND USE COMPARISON Table 7-4 Multiple Dry Years Supply and Use Comparison 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF) 2050 (AF) Supply totals 17,385 18,998 19,094 19,191 19,286 Use totals 17,385 18,998 19,094 19,191 19,286 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 18,246 19,939 20,039 20,142 20,241 Use totals 18,246 19,939 20,039 20,142 20,241 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 18,501 20,218 20,320 20,424 20,524 Use totals 18,501 20,218 20,320 20,424 20,524 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 16,248 17,755 17,844 17,936 18,024 Use totals 16,248 17,755 17,844 17,936 18,024 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 13,113 14,330 14,402 14,475 14,546 Use totals 13,113 14,330 14,402 14,475 14,546 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Submittal Table 7-4 Retail: Multiple Dry Years Supply and Use Comparison Water Code Section 10635(a) OPTIONAL Planned WSCP Actions Third year Fifth year DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. OPTIONAL Planned WSCP Actions OPTIONAL Planned WSCP Actions OPTIONAL Planned WSCP ActionsFourth year NOTES: First year OPTIONAL WSCP Actions Second year 2025 Urban Water Management Plan City of Arcadia Page 7-24 TABLE 7-5: FIVE-YEAR DROUGHT RISK ASSESSMENT Table 7-5 Five-Year Drought Risk Assessment 2026 Total Total Water Use (AF) 15,993 Total Supplies (AF) 16,399 Surplus/Shortfall w/o WSCP Action 406 WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) Revised Surplus/(shortfall) 2027 Total Total Water Use (AF) 17,150 Total Supplies (AF) 17,211 Surplus/Shortfall w/o WSCP Action 61 WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) Revised Surplus/(shortfall) 2028 Total Total Water Use (AF) 17,760 Total Supplies (AF) 17,452 Surplus/Shortfall w/o WSCP Action (308) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) 308 Revised Surplus/(shortfall) 0 2029 Total Total Water Use (AF) 15,922 Total Supplies (AF) 15,326 Surplus/Shortfall w/o WSCP Action (596) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) 596 Revised Surplus/(shortfall) 0 2030 Total Total Water Use (AF) 13,113 Total Supplies (AF) 12,369 Surplus/Shortfall w/o WSCP Action (744) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) 744 Revised Surplus/(shortfall) 0 NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Submittal Table 7-5 Retail: Five-Year Drought Risk Assessment Water Code Section 10635(b)(3) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) 2025 Urban Water Management Plan City of Arcadia Page 8-1 CHAPTER 8 WATER SHORTAGE CONTINGENCY PLAN LAY DESCRIPTION – CHAPTER 8 WATER SHORTAGE CONTINGENCY PLAN Chapter 8 (Water Shortage Contingency Plan) of the City’s 2025 Plan discusses and provides the following: x The City’s Water Shortage Contingency Plan is a detailed approach which presents how the City intends to act, or respond, in the case of an actual water shortage contingency. x Preparation of the City’s “Annual Water Supply and Demand Assessment” (or Annual Assessment) is discussed. The City is required to submit annually an Annual Assessment. The Annual Assessment includes a review of the City’s “unconstrained” water demands for the current year and for a potential upcoming single dry year. Unconstrained water demands represent the City’s water demands prior to any “response actions” the City may invoke pursuant to the City’s Water Shortage Contingency Plan. x The City will manage water supplies to minimize the adverse impacts of water shortages. The City’s plan for water usage during periods of shortage is designed to incorporate six standard water shortage levels corresponding to progressive ranges from up to a 10, 20, 30, 40, and 50 percent shortage, and greater than a 50 percent shortage. x For each declared water supply shortage level, customers will be required to reduce their consumption by the percentage specified in the corresponding water supply shortage level. 2025 Urban Water Management Plan City of Arcadia Page 8-2 x For each declared water supply shortage level, the City has established response actions to reduce demand on water supplies and to reduce any shortage gaps in water supplies. These demand reduction actions include irrigation and other outdoor use restrictions, rate structure changes, and other water use prohibitions. x The operational changes the City will consider in addressing water shortages on a short-term basis are discussed and include improved monitoring, analysis, and tracking of customer water usage to enforce demand reduction measures. x The City’s Emergency Response Plan is summarized. The Emergency Response Plan provides the management, procedures, and designated actions the City and its employees will implement during emergency situations (including catastrophic water shortages) resulting from natural disasters, system failures, and other unforeseen circumstances. x The preparation of the City’s seismic risk assessment and mitigation plan is discussed. The locations of earthquake faults in the vicinity of the City’s water service area are provided. x The effectiveness of the shortage response actions for each of the City’s standard water shortage levels is presented. The City has been able to provide sufficient water supplies to its customers, including during long-term droughts and years with historically high water demands. x The communication protocols implemented by the City when it declares any water shortage level are presented. x The compliance and enforcement procedures associated with City’s standard water shortage levels are presented. x The legal authorities associated with City’s standard water shortage levels are presented. x The financial consequences associated with City’s standard water shortage levels are presented. 2025 Urban Water Management Plan City of Arcadia Page 8-3 x The City will evaluate the need for revising the Water Shortage Contingency Plan in order to resolve any water shortage gaps, as necessary. The steps necessary for the City to adopt and amend its Water Shortage Contingency Plan are presented. The following Water Shortage Contingency Plan includes references to Chapters and Sections from the City of Arcadia’s 2025 Urban Water Management Plan: WATER SUPPLY RELIABILITY ANALYSIS CWC 10632. (a)(1) The analysis of water supply reliability conducted pursuant to Section 10635. CWC 10632.5. (a) In addition to the requirements of paragraph (3) of subdivision (a) of Section 10632, beginning January 1, 2020, the plan shall include a seismic risk assessment and mitigation plan to assess the vulnerability of each of the various facilities of a water system and mitigate those vulnerabilities. The City’s sources of supply were discussed in Section 6.2 of the 2025 Plan and consist of groundwater from Main and Raymond Basins, and treated imported water purchased from MWD through Upper Water. The Main and Raymond Basins are adjudicated and groundwater supplies are managed. The reliability of the various sources of supply are discussed in Chapter 7 of the 2025 Plan. Imported water supplies (treated) may be impacted in the event MWD implements its WSAP due to a water supply shortage. A seismic risk assessment and mitigation plan is discussed in Section 8.4.6. 2025 Urban Water Management Plan City of Arcadia Page 8-4 ANNUAL WATER SUPPLY AND DEMAND ASSESSMENT PROCEDURES CWC 10632. (a) Every urban water supplier shall prepare and adopt a water shortage contingency plan as part of its urban water management plan that consists of each of the following elements CWC 10632. (a)(2) The procedures used in conducting an annual water supply and demand assessment that include, at a minimum, both of the following: (A) The written decision-making process that an urban water supplier will use each year to determine its water supply reliability. (B) The key data inputs and assessment methodology used to evaluate the urban water supplier’s water supply reliability for the current year and one dry year, including all of the following: (i) Current year unconstrained demand, considering weather, growth, and other influencing factors, such as policies to manage current supplies to meet demand objectives in future years, as applicable. (ii) Current year available supply, considering hydrological and regulatory conditions in the current year and one dry year. The annual supply and demand assessment may consider more than one dry year solely at the discretion of the urban water supplier. (iii) Existing infrastructure capabilities and plausible constraints. (iv) A defined set of locally applicable evaluation criteria that are consistently relied upon for each annual water supply and demand assessment. (v) A description and quantification of each source of water supply. CWC 10632.1. An urban water supplier shall conduct an annual water supply and demand assessment pursuant to subdivision (a) of Section 10632 and, on or before July 1 of each year, submit an annual water shortage assessment report to the department with information for anticipated shortage, triggered shortage response actions, compliance and enforcement actions, and communication actions consistent with the supplier’s water shortage contingency plan. An urban water supplier that relies on imported water from the State Water Project or the Bureau of Reclamation shall submit its annual water supply and demand assessment within 14 days of receiving its final allocations, or by July 1 of each year, whichever is later. 2025 Urban Water Management Plan City of Arcadia Page 8-5 By July 1st of every year, the City is required to submit an “Annual Water Supply and Demand Assessment” (Annual Assessment) in accordance with DWR’s guidance and requirements. The Annual Assessment includes a review of the City’s unconstrained water demands (i.e. water demands prior to any projected response actions the City may trigger under this Water Shortage Contingency Plan) for the current year and the upcoming (potential single dry) year. The Annual Assessment also includes information regarding anticipated shortages, triggered shortage response actions, compliance and enforcement actions, and communication actions consistent with the City’s Water Shortage Contingency Plan. For each Annual Assessment, the City plans to prepare a preliminary assessment which evaluates the adequacy of its water supplies for the current and upcoming years by April of each year. The preliminary assessment will include a review of water supplies for at least a single dry year. During the preparation of each Annual Assessment, the City will evaluate the adequacy of its water supplies for the current and upcoming years. The evaluation will include a review of water supplies for at least a single dry year. DECISION-MAKING PROCESS The City produces groundwater from the Main Basin as its primary source of water supply and that basin is managed on a fiscal year basis. Consequently, during the third quarter of each fiscal year the City will review its water demands from the initial six months along with the current groundwater basin conditions and local hydrology. This information will be used to help develop the Annual Assessment. A draft of the Annual Assessment will be circulated internally within the City for peer review and comment. Based on comments received, a redraft will be prepared and provided to City managers during the Spring of each year. The draft will subsequently be provided to the General Manager for final 2025 Urban Water Management Plan City of Arcadia Page 8-6 review. If necessary, a final draft of the Annual Assessment will be provided to the City Council for review and included in the agenda as part of a City meeting such that it can be approved and any recommended specific shortage response actions may be enacted. The final Annual Assessment will be provided to DWR no later than July 1 of each year. The Annual Assessments will be instrumental in providing guidance to the City for decisions regarding potential declarations of a water supply shortage and implementation of water reduction stages, instituting mandatory water restrictions, promoting water use efficiency and conservation programs, water rates and drought rate surcharges, and the necessity of pursuing alternative water supplies. This process will help ensure adequate water supplies resources are available to the City. DATA AND METHODOLOGIES The key data inputs and methodologies which will be evaluated by the City during the preparation of the Annual Assessment will include the following: 1) Evaluation Criteria: The locally applicable evaluation criteria used to prepare the Annual Assessment will be identified. The evaluation criteria will include, but is not limited to, an analysis of current local hydrology (including rainfall and groundwater levels), current water demands, a review of water system improvement plans which may impact infrastructure availability, and water quality regulations which may impact groundwater availability. 2) Water Supply: A description of each available water supply source will be provided. The descriptions will include a quantification of each available water supply source and will be based on review of current production capacities, historical production, Urban Water Management Plans, and prior water supply studies (including Water Supply Assessments and/or Master Plans). 2025 Urban Water Management Plan City of Arcadia Page 8-7 3) Unconstrained Water Demand: The potential unconstrained water demands during the current year and the upcoming (potential single dry) year will be reviewed. The review will include factors such as weather, existing and projected land uses and populations, actual customer consumption and water use factors, monthly Urban Water Supplier Monthly Reports, existing water shortage levels (see Section 8.3), and existing water conservation ordinances (see Section 9.1). 4) Planned Water Use for Current Year Considering Dry Subsequent Year: The water supplies available to meet the demands during the current year and the upcoming (potential single dry) year will be considered and identified by each type of supply. The evaluation will include factors such as estimated water demands, weather, groundwater basin operating safe yields, water quality results, existing available pumping capacities, imported water allocations, contractual obligations, regulatory issues, use of emergency interconnections, and the costs associated with producing each water supply source. 5) Infrastructure Considerations: The capabilities of the water distribution system infrastructure to meet the water demands during the current year and the upcoming (potential single dry) year will be considered. Available production capacities (e.g. groundwater well capacities) and distribution system water losses (see Section 4.3) will be reviewed. In addition, capital improvement and replacement projects, as well as potential projects which may increase water system and production capacities (see Section 6.2.10), will be considered. 2025 Urban Water Management Plan City of Arcadia Page 8-8 SIX STANDARD WATER SHORTAGE LEVELS CWC 10632. (a)(3)(A) Six standard water shortage levels corresponding to progressive ranges of up to 10, 20, 30, 40, and 50 percent shortages and greater than 50 percent shortage. Urban water suppliers shall define these shortage levels based on the suppliers’ water supply conditions, including percentage reductions in water supply, changes in groundwater levels, changes in surface elevation or level of subsidence, or other changes in hydrological or other local conditions indicative of the water supply available for use. Shortage levels shall also apply to catastrophic interruption of water supplies, including, but not limited to, a regional power outage, an earthquake, and other potential emergency events. (a)(3)(B) An urban water supplier with an existing water shortage contingency plan that uses different water shortage levels may comply with the requirement in subparagraph (A) by developing and including a cross-reference relating its existing categories to the six standard water shortage levels. The City has a legal responsibility to provide water utility services, including water for residential, commercial, industrial, public authority, and for public fire hydrants and private fire services. The City will manage water supplies prudently to minimize the adverse impacts of water shortages. The City’s plan for water usage during periods of shortage is designed to provide a minimum of 50 percent of normal supply during a severe or extended water shortage. Water shortage trigger mechanisms have been established to ensure that this policy is implemented. For each declared water supply shortage level, customers will be required to reduce their water consumption by the percentage specified in the corresponding water supply shortage level. The City’s water conservation plan previously established eight (8) water shortage levels. A copy of City’s water conservation plan is provided in Appendix J. In accordance with the California Water Code in which urban water suppliers are required to define six standard water shortage level, the City has developed the crosswalk illustrated below 2025 Urban Water Management Plan City of Arcadia Page 8-9 (also included in the City’s 2020 Plan) that translated the City’s previously established shortage levels to the mandated standard shortage levels. Table 8-1 also provides a cross-reference between the City’s previously established shortage levels and the mandated standard shortage levels. Corresponding Relationships Between Supplier's Established Shortage Levels and the WSCP Mandated Shortage Levels Established Level Supply Condition/Shortage WSCP Standard Level Shortage Level 1 1 ” to 10% 2 10% 2 10 to 20% 3 11 to 15% 3 20 to 30% 4 16 to 20% 4 30 to 40 % 5 21 to 25% 5 40 to 50 % 6 26 to 30% 6 > 50 % 7 31 to 40% 8 41 to 50% SHORTAGE RESPONSE ACTIONS CWC 10632. (a)(4) Shortage response actions that align with the defined shortage levels and include, at a minimum, all of the following: (A) Locally appropriate supply augmentation actions. (B) Locally appropriate demand reduction actions to adequately respond to shortages. (C) Locally appropriate operational changes. 2025 Urban Water Management Plan City of Arcadia Page 8-10 (D) Additional, mandatory prohibitions against specific water use practices that are in addition to state-mandated prohibitions and appropriate to the local conditions. (E) For each action, an estimate of the extent to which the gap between supplies and demand will be reduced by implementation of the action. SUPPLY AUGMENTATION As discussed in Chapter 6, the City’s sources of water supply include groundwater produced from the Main Basin and Raymond Basin and imported surface water purchased from MWD through Upper Water. As noted in Section 8.2, the City is required to annually prepare and submit an Annual Assessment which will include a review of water supplies available to meet water demands for the current and upcoming years. If the City is currently in, or considers entering into, one of the standard water shortage levels identified in Section 8.3, the City will consider the water supply augmentation actions described below. For each water shortage level discussed in Section 8.3, the City will consider supplementing its existing water supplies through purchase of additional imported water supplies. Due to previous critically dry conditions, MWD developed the “Water Supply Allocation Plan” whereby available supplies are equitably allocated to its member agencies, including Upper Water. The WSAP establishes ten different shortage levels and a corresponding drought allocation to each member agency. Based on the shortage level established by MWD, the WSAP provides a reduced drought allocation to a member agency for its Municipal and Industrial retail demand. The ratio of MWD water supply drought allocation to local water supply will change based on the WSAP stage. The MWD drought allocation can be used to make Full Service water deliveries at the Tier 1 rate up to a Tier 1 allocation. Any Full Service water delivered in excess of a drought allocation is subject to a penalty rate in addition to the normal rate paid for the water. 2025 Urban Water Management Plan City of Arcadia Page 8-11 In addition to the WSAP, MWD describes supply augmentation actions in its Regional 2025 UWMP, which is incorporated by reference. MWD’s primary first response to any gap between core supplies (from the State Water Project and Colorado River) and demand is to make optimal use of its supply augmentation options, consisting of drawing from flexible supply programs and storage reserves. MWD has developed and actively manages a portfolio of water supply programs including water transfer, storage, and exchange agreements. MWD pursues voluntary water transfer and exchange programs to help mitigate supply/demand imbalances and provide additional dry-year supply sources. In addition, MWD has developed significant storage capacity in reservoirs, conjunctive use, and other groundwater storage programs totaling approximately 6.0 million AF. Based on MWD’s historical and on-going water supply and storage programs and management practices, the City can potentially rely on purchased imported water supplies from MWD through Upper Water for adequate supply augmentation in response to each of the standard water shortage levels identified in Section 8.3. The City will consider supplementing its existing water supplies through production of additional groundwater from the Main Basin. As noted in Section 6.2.2, the Main Basin is managed by the Main Basin Watermaster. During the period of management under the Main Basin Judgment, significant drought events have occurred. In each drought cycle the Main Basin has been managed to maintain water levels. Parties to the Main Basin Judgment, including the City, are authorized to produce groundwater in excess of their rights and pay assessments for such production to the Main Basin Watermaster. The assessments are used to purchase untreated imported water to replenish the Main Basin. The Main Basin Watermaster purchases untreated imported water to replenish the Main Basin from MWD through Upper Water. An additional potential source of replenishment water is recycled water. Groundwater quality is carefully monitored and managed by the Main Basin Watermaster. Treatment facilities and/or blend plans have been developed by water agencies to meet potable water standards and to prevent the spread of any groundwater contamination. Groundwater quality in the Main Basin is not expected to 2025 Urban Water Management Plan City of Arcadia Page 8-12 impact potable supplies or constrain supply reliability. Based on historical and on-going management practices, the City will be able to continue relying on the Main Basin for adequate supplies in response to each of the standard water shortage levels identified in Section 8.3. DEMAND REDUCTION The City may establish water shortage response actions to reduce demand on water supplies. These demand reduction actions include irrigation and other outdoor use restrictions, rate structure changes, and other water use prohibitions. Depending on the percent reduction in the City’s water supply and corresponding water shortage level, regulations are made to conserve water and reduce the shortage gap in normal supply levels. Many demand reduction actions, identified as voluntary or mandatory conservation measures, are applicable to all levels of water shortages. The structure of water shortage levels are designed to strongly encourage customers with high per capita usage to achieve proportionally greater reduction than those with low usage. Violations of these demand reduction actions will be considered waste and an unreasonable use of water. Table 8-3 describes each demand reduction action and its effect on reducing the shortage gap. Upon adoption of a water supply shortage stage, as described Table 8-1, the restrictions and mandatory water reduction demands will be effective immediately. A full listing of the restrictions/prohibitions associated with each shortage level is provided below. Water Shortage Level 1 (a) There shall be no hose washing of sidewalks, walkways, driveways, or parking areas. 2025 Urban Water Management Plan City of Arcadia Page 8-13 (b) There shall be no hose washing of a motor vehicle, except where the hose is fitted with a shut-off nozzle or similar device that causes the hose to cease dispensing water immediately when not in use. (c) No water shall be used to clean, fill or maintain levels in decorative fountains unless such water is part of a recirculating system. (d) No restaurant, hotel, cafe, cafeteria, bar or other public place where food or beverage is served or offered for sale, shall serve drinking water to any customer unless expressly requested by the customer. (e) No hotel or motel shall launder towels and linens of an occupied guestroom on a daily basis, unless expressly requested by the guest. The hotel or motel shall prominently display a notice in each guestroom of the guest's option not to have towels and linens laundered daily. (f) No customer of the Water Division shall permit water to leak from any facility on his premises. (g) No lawn, landscape, or other turf areas shall be watered or irrigated between the hours of 9:00 a.m. and 6:00 p.m. Pacific time. (h) No lawn, landscape, or other turf areas shall be watered or irrigated during and within 48 hours after measurable rainfall. (i) No lawn, landscape, or other turf areas shall be watered or irrigated more than 3 days per week, or such other number of days as the City Council may prescribe by resolution from time to time10. The three days per week shall be Tuesday, Thursday, and Saturday or such other days as the City Council may prescribe by resolution from time to time. Notwithstanding the foregoing, upon written application to and approval by the City's Public Works Services Director, an owner of property used primarily for commercial, industrial or institutional 10 Pursuant to Resolution No. 7430 adopted by City Council in May 2022, no lawn, landscape, or other turf areas shall be watered or irrigated more than two (2) days per week (on Tuesday and Saturday). From May to October, outdoor watering of lawn, landscape or other turf areas shall be limited to no more than 10 minutes per station on each day allowed. Resolution No, 7430 is provided in Appendix N. 2025 Urban Water Management Plan City of Arcadia Page 8-14 purposes may irrigate lawn, landscape or other turf areas of such property such number of days per week as approved by the Public Works Services Director if such owner provides evidence, to the satisfaction of the Public Works Services Director, that the owner has reduced overall bi-monthly water use for such property by at least twenty-five percent (25%) from the same bi-monthly period in 2013, or by such other measurement of reduction adopted by resolution of the City Council from time to time11. (j) No lawn, landscape or other turf areas shall be watered in a wasteful manner. For example, in a manner that causes runoff such that water flows onto adjacent property, non-irrigated areas, private and public walkways, roadways, parking lots, or structures. (k) Additional restrictions and conservation measures may be adopted from time to time by resolution of the City Council and shall become effective upon their adoption. Any and all such restrictions and measures shall be subject to all enforcement provisions, including without limitation fines and penalties, as are otherwise applicable to the provisions set forth in this Section. Water Shortage Level 2 No use of water may be made contrary to the provisions of Water Shortage Level 1. No customer shall make, cause use or permit the use of water from the Water Division for any purpose in an amount in excess of eighty percent (80%) of the amount used during the base period as defined in this Urgency Ordinance. 11 Pursuant to Resolution No. 7430 adopted by City Council in May 2022, an owner of property used primarily for commercial, industrial, or institutional purposes may not irrigate non-functional turf areas. "Non- functional turf' means turf that is solely ornamental and not regularly used for human recreational purposes or for civic or community events. Resolution No, 7430 is provided in Appendix N. 2025 Urban Water Management Plan City of Arcadia Page 8-15 Water Shortage Level 3 No use of water may be made contrary to the provisions of Water Shortage Level 1. No customer shall make, cause, use or permit the use of water from the Water Division for any purpose in an amount in excess of seventy percent (70%) of the amount used during the base period as defined in this Urgency Ordinance. Water Shortage Level 4 No use of water may be made contrary to the provisions of Water Shortage Level 1. No customer shall make, cause, use or permit the use of water from the Water Division for any purpose in an amount in excess of sixty percent (60%) of the amount used during the base period as defined in this Urgency Ordinance. Water Shortage Level 5 No use of water may be made contrary to the provisions of Water Shortage Level 1. No customer shall make, cause, use or permit the use of water from the Water Division for any purpose in an amount in excess of fifty percent (50%) of the amount used during the base period as defined in this Urgency Ordinance. Water Shortage Level 6 No use of water may be made contrary to the provisions of Water Shortage Level 1. No customer shall make, cause, use or permit the use of water from the Water Division for any purpose in an amount more than fifty (50%) of the amount used during the base period as defined in this Urgency Ordinance. 2025 Urban Water Management Plan City of Arcadia Page 8-16 OPERATIONAL CHANGES During a water supply shortage situation, the City will manage its water supply resources to provide sufficient water supplies capable of meeting the demands of its customers. Section 8.4.1 describes the City’s water supply sources and water supply augmentation actions available. Section 8.4.2 describes the City’s standard water shortage levels and associated demand reduction measures. The supply augmentation actions and demand reduction measures, when implemented, may potentially result in short-term operational changes which are necessary to allow the City to utilize all available water supply sources in response to water shortage situations. As noted in Section 8.2, the City is required to annually prepare and submit an Annual Assessment which will include a review of the water supplies available to meet water demands for the current and upcoming years. Preparation of the Annual Assessment will assist the City in determining any potential operational changes. In addition, the City’s standard water shortage levels and the associated demand reduction measures, in conjunction with the City’s existing Demand Management Measures (discussed in Chapter 9), will be essential to the City in reducing water demands during any water shortage period. The operational changes the City will consider in addressing non- catastrophic water shortages on a short-term basis include the following: x Improved monitoring, analysis, and tracking of customer water usage to enforce demand reduction measures x Optimized production from existing available water supply sources x Potential use of emergency supply sources, including emergency interconnections x Potential blending of water supply resources x Improved monitoring, maintenance, and repairs to reduce water distribution system losses 2025 Urban Water Management Plan City of Arcadia Page 8-17 ADDITIONAL MANDATORY RESTRICTIONS The mandatory restrictions which are implemented by the City to reduce customer demands are discussed in Section 8.4.2. There are no additional mandatory restrictions planned at this time. EMERGENCY RESPONSE PLAN Catastrophic water shortages are incorporated in the City’s standard water shortage levels (identified in Section 8.3) and the associated demand reduction measures (described in Section 8.4.2). In addition to the water supply augmentation actions (Section 8.4.1) and potential operational changes (Section 8.4.3) which the City may consider in order to continue providing sufficient water supplies, the City will review and implement any necessary steps included in its “Emergency Response Plan”. The City’s Emergency Response Plan (ERP), updated in 2021, provides the management, procedures, and designated actions the City and its employees will implement during emergency situations (including catastrophic water shortages) resulting from natural disasters, system failures and other unforeseen circumstances. The City’s ERP (which is incorporated by reference) provides the guidelines for evaluating an emergency situation, procedures for activating an emergency response, and details of the different response phases in order to ensure that customers receive a reliable and adequate supply of potable water. The scope of the ERP includes emergencies which directly affect the water system and the ability to maintain safe operations (such as a chlorine release, and earthquake or a threat of contamination). The ERP also incorporates the following: 2025 Urban Water Management Plan City of Arcadia Page 8-18 x Strategies and resources to improve resilience, including physical and cybersecurity x Plans and procedures for responding to a natural hazard or malevolent act x Actions and equipment to lessen the impact of a natural hazard or malevolent act x Strategies to detect natural hazards or malevolent act The City will review the ERP for procedures regarding the utilization of alternative water supply sources in response to water supply shortages, including during the standard water shortage levels. The City will also review applicable procedures described in the ERP regarding any necessary temporary shutdown of water supply facilities, including appropriate regulatory and public notifications. SEISMIC RISK ASSESSMENT AND MITIGATION PLAN CWC 10632.5. (a) In addition to the requirements of paragraph (3) of subdivision (a) of Section 10632, beginning January 1, 2020, the plan shall include a seismic risk assessment and mitigation plan to assess the vulnerability of each of the various facilities of a water system and mitigate those vulnerabilities. (b) An urban water supplier shall update the seismic risk assessment and mitigation plan when updating its urban water management plan as required by Section 10621. (c) An urban water supplier may comply with this section by submitting, pursuant to Section 10644, a copy of the most recent adopted local hazard mitigation plan or multihazard mitigation plan under the federal Disaster Mitigation Act of 2000 (Public Law 106-390) if the local hazard mitigation plan or multihazard mitigation plan addresses seismic risk. The City prepared a “Local Hazard Mitigation Plan” in 2022. The Hazard Mitigation Plan identifies effective ways to assess the significant natural hazards (including earthquakes) that may affect the City and its residents. The Hazard Mitigation Plan provides resources, information, and strategies to reduce the City’s vulnerability to these hazards, while providing guidance for the coordination of mitigation activities throughout the City. The 2025 Urban Water Management Plan City of Arcadia Page 8-19 Hazard Mitigation Plan includes mitigation projects necessary to reduce seismic risk to the City’s water distribution system facilities (including its distribution system pipelines, groundwater wells, booster pumps, and storage reservoirs) and potential disruptions in providing water service. The City’s Hazard Mitigation Plan is provided in Appendix K. The County of Los Angeles prepared a “All-Hazards Mitigation Plan” in 2025 which identified methods to assess significant natural hazards (including earthquakes) affecting areas throughout Los Angeles County, and the mitigation strategies necessary to reduce risks, including seismic risk. The County’s All-Hazards Mitigation Plan is provided in Appendix L. The California Geological Survey has published the locations of numerous faults which have been mapped in the Southern California region. Although the San Andreas fault is the most recognized and is capable of producing an earthquake with a magnitude greater than 8 on the Richter scale, some of the lesser-known faults have the potential to cause significant damage. The locations of these earthquake faults in the vicinity of the City’s water service area are provided in the figure below. The faults that are located in close proximity to and could potentially cause significant shaking in the City’s water service area include the San Andreas fault, the Walnut Creek fault, the Whittier fault, the San Jose fault, the Raymond fault, the Cucamonga fault, the Chino fault, the Sierra Madre fault, and the East Montebello fault. 2025 Urban Water Management Plan City of Arcadia Page 8-20 Location of Earthquake Faults Source: https://maps.conservation.ca.gov/cgs/fam/App/ The California Geological Survey provides earthquake hazard maps12 based on the Modified Mercalli Intensity (MMI) scale, which measures earthquake shaking intensity and its impacts on people, objects, and buildings. The area within the City’s service area has an MMI of approximately 9.6 calculated based on the level of shaking that has a 2 percent chance of being exceeded in 50 years (or the level of shaking with an approximate 2,500- year average repeat time). An MMI at this intensity (violent shaking) can result in buildings shifted off foundations, cracked, or tilted, the ground cracked, and underground pipes broken. As discussed in Section 8.4.5, the City has prepared an Emergency Response Plan which provides the management, procedures, and designated actions the 12 https://conservation.ca.gov/cgs/sh/earthquake-shaking-potential City’s Service Area 2025 Urban Water Management Plan City of Arcadia Page 8-21 City and its employees will implement during emergency situations resulting from natural disasters, including during earthquakes, to ensure that customers receive a reliable and adequate supply of potable water. The City’s ERP is referenced herein. SHORTAGE RESPONSE ACTION EFFECTIVENESS The effectiveness of the shortage response actions for each of the standard water shortage levels identified in Section 8.3 is evident in the City’s historical ability to meet its customer’s water demands in response to a water supply shortage. In addition, the City imposes water consumption regulations and restrictions, and supports local agencies in efforts to enforce regulations and prohibitions on water use. The effectiveness of each of the City’s shortage response actions, in order to reduce any potential gaps between supply and demand, has been quantified in the expected demand reduction provided in Table 8-2 and Table 8-3. Section 6.1 provides a tabulation of the City’s historical annual water demands for each water supply source. During the past 15 years, the City experienced a five-year consecutive drought within its service area from FY 2011-12 to FY 2015-16. Throughout this extended dry year period, the City’s annual water production ranged from 12,369 AF to 17,452 AF, with an average of approximately 15,751 AF. In addition, historical records indicate the City previously produced a maximum of up to 18,668 AF during FY 2006-07. The City has been able to provide sufficient water supplies to its customers, including during long-term droughts and years with historically high water demands. In addition, the City has been able to provide water service to meet maximum day water demands for these years, including during the summer months. The City’s water demands during the most recent five years (from FY 2020-21 to FY 2024- 25) averaged approximately 13,215 AFY. Due to conservation efforts and demand management measures (discussed in Chapter 9), the City’s recent water demands have 2025 Urban Water Management Plan City of Arcadia Page 8-22 been significantly less than its historical water demands, including during long-term droughts. The City’s projected water demands (during normal, single dry, and multiple dry years) are provided in Section 7.2.3 and are anticipated to incorporate similar reductions in water use rates as a result of the shortage response actions, ongoing conservation efforts, and demand management measures. Because the City’s projected water demands are similar to or less than its historical water demands, it is anticipated the City will be able to continue providing sufficient water supplies to its customers to meet projected water demands, including during long-term droughts. In addition, as discussed in Section 8.4.1, based on historical and on-going management practices, the City will be able to continue relying on its water supply sources from the Main Basin and Raymond Basin for adequate supply augmentation in response to each of the standard water shortage levels identified in Section 8.3. Based on the City’s ability in meeting water demands during past water supply shortages, adopted water shortage levels, adjusted operating safe yields, and long-term droughts, it is anticipated that the City will be able to continue providing sufficient water supplies to its customers during any of its standard water shortage levels. Although adequate supplies are anticipated, the cost of those water supplies may become incrementally more expensive. The City will enact varying levels of its water shortage contingency plan to encourage retail customers to reduce water consumption and at the same time reduce the need to use the more expensive water supplies. Notwithstanding, the effectiveness of each of the City’s shortage response actions, in order to reduce any potential gaps between supply and demand, has been quantified in the expected demand reduction provided in Table 8-2 and Table 8-3. The effectiveness of the City’s shortage response actions is based on the City’s water demands prior to 2015 (unconstrained demands). The City reduced its water demands in 2015 in response to the Governor’s April 1, 2015 Executive Order B-29-15 which mandated statewide reduction in water use of 25 percent. During this period, the City was able to reduce its water demands by approximately 29 percent. This historical water demand reduction was used to estimate the extent of water 2025 Urban Water Management Plan City of Arcadia Page 8-23 use reductions for the City’s Water Shortage Stages. The City’s Water Shortage Levels 1, 2, 3, 4, 5, and 6 are expected to reduce water demands by up to 10%, 20%, 30%, 40%, 50%, and greater than 50%, respectively. Emergency regulations previously adopted by the SWRCB pursuant to Executive Order N-7-22 (issued on March 28, 2022 by California Governor Gavin Newsom) required urban water suppliers to implement Level 2 of their Water Shortage Contingency Plans meant to address up to a 20% shortage of water supplies. The regulations also required urban water suppliers to establish a ban on irrigating non-functional turf at commercial, industrial, and institutional properties (including grass in front of or next to large industrial or commercial buildings). The ban did not include watering turf that is used for recreation or other community purposes, water used at residences or water to maintain trees. Pursuant to Executive Order N-5-23 issued on March 24, 2023 by California Governor Gavin Newsom, the requirement for urban water suppliers to implement Level 2 of their Water Shortage Contingency Plans was removed. As of June 5, 2024, SWRCB statewide water conservation emergency regulations have expired and there are no current statewide water conservation emergency regulations. COMMUNICATION PROTOCOLS CWC 10632. (a)(5) Communication protocols and procedures to inform customers, the public, interested parties, and local, regional, and state governments, regarding, at a minimum, all of the following: (A) Any current or predicted shortages as determined by the annual water supply and demand assessment described pursuant to Section 10632.1. (B) Any shortage response actions triggered or anticipated to be triggered by the annual water supply and demand assessment described pursuant to Section 10632.1. (C) Any other relevant communications. 2025 Urban Water Management Plan City of Arcadia Page 8-24 The City is required to submit an “Annual Water Supply and Demand Assessment” (Annual Assessment) in accordance with DWR’s guidance and requirements. The Annual Assessment will include a review of the City’s unconstrained water demands (i.e. water demands prior to any projected response actions the City may trigger under this WSCP) for the current year and the upcoming (potential single dry) year. The City will also include information regarding anticipated shortages, triggered shortage response actions, compliance and enforcement actions, and communication actions consistent with the City’s WSCP. See Section 8.2 for further discussion regarding the Annual Assessment. The City will evaluate the projected supply and demand for water by its customers and shall recommend to the City Council the extent of the conservation required by the customers of the Water Division. The City Council will discuss the appropriate phase of water conservation be implemented, modified or rescinded. The City will publish information regarding the adoption of any resolution declaring a water shortage level in a daily newspaper of general circulation. The information provided will include the declared shortage level, response action associated with each shortage level, and any other relevant information relating to the resolution. COMPLIANCE AND ENFORCEMENT CWC 10632. (a)(6) For an urban retail water supplier, customer compliance, enforcement, appeal, and exemption procedures for triggered shortage response actions as determined pursuant to Section 10632.2. It is unlawful and a misdemeanor for any customer to fail to comply with any provisions of the regulations and restrictions on water use set forth in the City’s Ordinance. The City 2025 Urban Water Management Plan City of Arcadia Page 8-25 has implemented a three-step enforcement plan for the Phase I Prohibitions. Customers violating the mandatory prohibitions will be subject to the procedures and/or penalties as outlined below. First Violation: For the first violation by any customer of the Water Division of any of the provisions discussed in Section 8.4.2, a surcharge penalty, in addition to the current water rate, is imposed in an amount equal to two times the current water rate for those billing units used in excess of base. Second Violation: For the second violation by any customer of the Water Division of any of the provisions discussed in Section 8.4.2, a surcharge penalty, in addition to the current water rate, is imposed in an amount equal to three times the current water rate for those billing units used in excess of base. Third Violation: For the third violation by any customer of the Water Division of any of the provisions discussed in Section 8.4.2, a surcharge penalty, in addition to the current water rate, is imposed in an amount equal to four times the current water rate for those billing units used in excess of base. If any customer fails to comply with any provision of the regulations and restrictions on water use set forth in the City’s Ordinance, the Water Division may reduce the amount of water provided to that customer to the level which that customer would be using said water if he were complying with the provisions. The reduction in water supplies may be applied in lieu of, or in addition to, any other penalties provided in this Chapter, in the discretion of the Water Division, and will be applied without regard to the status or nature of the customer. The following procedural requirements shall apply with regard to an appeal: 2025 Urban Water Management Plan City of Arcadia Page 8-26 (a) An appeal may be filed within ten (10) working days after a final decision by the Water Division to the Water Appeals Board. The appeal should state the grounds upon which it is based, and what remedy, if any, the Appellant seeks. LEGAL AUTHORITIES CWC 10632. (a)(7)(A) A description of the legal authorities that empower the urban water supplier to implement and enforce its shortage response actions specified in paragraph (4) that may include, but are not limited to, statutory authorities, ordinances, resolutions, and contract provisions. (B) A statement that an urban water supplier shall declare a water shortage emergency in accordance with Chapter 3 (commencing with Section 350) of Division 1. [see below] (C) A statement that an urban water supplier shall coordinate with any city or county within which it provides water supply services for the possible proclamation of a local emergency, as defined in Section 8558 of the Government Code. CWC Division 1, Section 350 The governing body of a distributor of a public water supply, whether publicly or privately owned and including a mutual water company, shall declare a water shortage emergency condition to prevail within the area served by such distributor whenever it finds and determines that the ordinary demands and requirements of water consumers cannot be satisfied without depleting the water supply of the distributor to the extent that there would be insufficient water for human consumption, sanitation, and fire protection. In the event that the demand of water consumers cannot be satisfied without depleting a substantial amount of water supply needed for human consumption, sanitation, and fire protection, the City shall declare a water shortage emergency (in accordance with Water Code Chapter 3 commencing with Section 350 of Division 1 regarding water shortage emergencies). The City shall coordinate with any city or county within its service area for possible declaration of a local emergency, as defined in Section 8588 of the Government Code. 2025 Urban Water Management Plan City of Arcadia Page 8-27 The City’s Ordinance No. 2327 implements measures to ensure sufficient water supplies are available for sanitation, fire suppression, and domestic use. The City adopted Ordinance No. 2036 which added three water shortage levels, exceeding the State’s requirement. The City incorporated more shortage levels to provide additional flexibility and prevent over-mandated water conservation by its customers. FINANCIAL CONSEQUENCES OF WSCP CWC 10632. (a)(8) A description of the financial consequences of, and responses for, drought conditions, including, but not limited to, all of the following: (A) A description of potential revenue reductions and expense increases associated with activated shortage response actions described in paragraph (4). (B) A description of mitigation actions needed to address revenue reductions and expense increases associated with activated shortage response actions described in paragraph (4). (C) A description of the cost of compliance with Chapter 3.3 (commencing with Section 365) of Division 1. [retail urban suppliers only] During periods of water supply shortages, state-mandated water use restrictions, or emergency conditions, the City may require its customers to reduce demands below levels projected under the current water rate structure. Under any of these circumstances, the City may experience a decrease in revenues that may result in insufficient funds to meet projected expenses. The City’s Water Fund, commonly referred to as “financial reserves”, is comprised of an Operating Fund and Equipment Fund. The Water Fund is available to be used for water system expenditures to make up for shortfalls in water revenue. Based on the Cost of 2025 Urban Water Management Plan City of Arcadia Page 8-28 Service Study, the City targets an Operating Fund equivalent to 90 days of operating expenses and has historically maintained an Equipment Fund (Facilities Reserve). Revenue collected as a result of penalties imposed (discussed in Section 8.6) shall be used for, but not limited to the purchase of imported water, increasing water supplies, maintenance of the City's water system, and water conservation efforts including public education. MONITORING AND REPORTING CWC 10632. (a)(9) For an urban retail water supplier, monitoring and reporting requirements and procedures that ensure appropriate data is collected, tracked, and analyzed for purposes of monitoring customer compliance and to meet state reporting requirements. The City employs a Management Analyst who is responsible for responding to reports of water waste or noncompliance. Upon receiving public reports, work orders will be generated and two written notices, which will include a date by which a customer must resolve violations, will be physically left at the property and sent by mail. In addition, courtesy phone calls may be made to follow up with the violator. The SFR water meter will be data logged showing hourly use over 7 days after the mailed deadline. If the violator is nonresponsive after review of the data log, then a citation will be issued for $100. Subsequent violations may receive citations up to $500. 2025 Urban Water Management Plan City of Arcadia Page 8-29 WSCP REFINEMENT PROCEDURES CWC 10632. (a)(10) Reevaluation and improvement procedures for systematically monitoring and evaluating the functionality of the water shortage contingency plan in order to ensure shortage risk tolerance is adequate and appropriate water shortage mitigation strategies are implemented as needed. The City’s Water Shortage Contingency Plan has been prepared as an adaptive management plan. As discussed in Section 8.9, the City will monitor and report on the implementation of the Water Shortage Contingency Plan. The City will review the implementation results for any current or potential shortage gaps between water supplies and demands. The City will evaluate the need for revising the Water Shortage Contingency Plan in order to resolve any shortage gaps, as necessary. The City will consider the following potential revisions in the event of a potential shortage gap: x Implementation of additional public outreach, education, and communication programs (in addition to the programs discussed in Chapter 9). x Implementation of more stringent water use restrictions under the standard water shortage levels (discussed in Section 8.4) x Implementation of stricter enforcement actions and penalties (discussed in Section 8.6) x Improvements to the water supply augmentation responses (discussed in Section 8.4.1), as well as any associated operational changes (discussed in Section 8.4.3) which may be required x Incorporation of additional actions recommended by City staff or other interested parties 2025 Urban Water Management Plan City of Arcadia Page 8-30 The City will use the monitoring and reporting data to evaluate the ability for these potential revisions to resolve any shortage gaps which may occur within the standard water shortage levels. This Water Shortage Contingency Plan is adopted as part of the City’s 2025 Urban Water Management Plan adoption process discussed in Section 10.3. It is anticipated the City will review, revise, and adopt an updated Water Shortage Contingency Plan as part of preparing its 2030 Urban Water Management Plan as necessary. However, the City will continue to review the monitoring and reporting data, and if needed, update the Water Shortage Contingency Plan more frequently. Any updates to the City’s Water Shortage Contingency Plan will include a public hearing and adoption process by the City Council (see Section 8.12). SPECIAL WATER FEATURE DISTINCTION CWC 10632. (b) For purposes of developing the water shortage contingency plan pursuant to subdivision (a), an urban water supplier shall analyze and define water features that are artificially supplied with water, including ponds, lakes, waterfalls, and fountains, separately from swimming pools and spas, as defined in subdivision (a) of Section 115921 of the Health and Safety Code. The City’s Water Shortage Contingency Plan defines “decorative water features” as water features which are artificially supplied with water, including ponds, lakes, waterfalls, and fountains, but excluding pools and spas. In general, there are additional health and safety considerations in the water supplied to pools and spas compared to decorative water features. As a result, the City’s Water Shortage Contingency Plan has reviewed the response actions, enforcement actions, and monitoring and reporting programs separately for decorative water features and for pools and spas, as applicable. As noted 2025 Urban Water Management Plan City of Arcadia Page 8-31 under Water Shortage Level 1, “No water shall be used to clean, fill or maintain levels in decorative fountains unless such water is part of a recirculating system”. PLAN ADOPTION, SUBMITTAL, AVAILABILITY, AND AMENDMENT PROCEDURES CWC 10632. (c) The urban water supplier shall make available the water shortage contingency plan prepared pursuant to this article to its customers and any city or county within which it provides water supplies no later than 30 days after adoption of the water shortage contingency plan. The City’s Water Shortage Contingency Plan is adopted as part of the City’s 2025 Urban Water Management Plan adoption process discussed in Chapter 10. The process for adopting the City’s Water Shortage Contingency Plan includes the following: x The City will conduct a public hearing and make the Water Shortage Contingency Plan available for public inspection. x The City will provide notification of the time and place of the public hearing to any city or county in which water is provided. x The City will publish notice of public hearing in a newspaper once a week, for two successive weeks (with at least five days between publication dates). x The City Council will adopt the 2025 Urban Water Management Plan and the Water Shortage Contingency Plan x As part of submitting the 2025 Urban Water Management Plan to DWR, the City will also submit the Water Shortage Contingency Plan (electronically through DWR’s online submittal tool) within 30 days of adoption and by July 1, 2026. The City will submit a copy of the Water Shortage Contingency Plan to the California 2025 Urban Water Management Plan City of Arcadia Page 8-32 State Library and to any city or county in which water is provided within 30 days of adoption. In addition, the City will make the Water Shortage Contingency Plan available for public review within 30 days of adoption. If there are any subsequent amendments required, the process for adopting an amended Water Shortage Contingency Plan includes the following: x The City will conduct a public hearing and make the amended Water Shortage Contingency Plan available for public inspection. x The City Council will adopt the amended Water Shortage Contingency Plan x The City will submit the amended Water Shortage Contingency Plan to DWR (electronically through DWR’s online submittal tool) within 30 days of adoption Additional information regarding the adoption, submittal, and availability of the City’s Water Shortage Contingency Plan (and 2025 Urban Water Management Plan) is provided in Chapter 10. RESOURCES AND REFERENCES DWR’s Final 2025 UWMP Guidebook provides a listing of resources and references which can be helpful during the preparation of a Water Shortage Contingency Plan. SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 8 are provided below. 2025 Urban Water Management Plan City of Arcadia Page 8-33 TABLE 8-1: CROSS REFERENCE FOR STANDARD VS. SUPPLIER SHORTAGE LEVELS Table 8-1 Cross-Reference for Standard vs. Supplier Shortage Levels 2025 Urban Water Management Plan City of Arcadia Page 8-34 TABLE 8-2: SUPPLY AUGMENTATION AND OTHER ACTION Table 8-2 Supply Augmentation and Other Actions Yes Volume or Percentage Drop down Shortage Gap Reduction Value (May be a range) (AF) 1 Transfers Volume 0 Not applicable (see Notes) 2 Transfers Volume 0 Not applicable (see Notes) 3 Transfers Volume 0 Not applicable (see Notes) 4 Transfers Volume 0 Not applicable (see Notes) 5 Transfers Volume 0 Not applicable (see Notes) 6 Transfers Volume 0 Not applicable (see Notes) Submittal Table 8-2 Retail: Supply Augmentation and Other Actions Water Code Section 10632(a)(4)(A),(C) and (E) Add additional rows as needed NOTES: The City will consider increased production from the Main Basin using existing facilities to address increased demands. As noted on Table 8-3, the City plans to implement demand reduction measures in the event water supplies from existing sources are not sufficient to meet anticipated demands. Is the Supplier completing this table using the standard six levels? (yes/no) How much is this going to reduce the shortage gap? DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Shortage Level Supply Augmentation Methods and Other Actions by Water Supplier Drop down list These are the only categories that will be accepted by the WUEdata online submittal tool Additional Explanation or Reference (OPTIONAL) 2025 Urban Water Management Plan City of Arcadia Page 8-35 TABLE 8-3: DEMAND-REDUCTION ACTIONS Table 8-3 Demand-Reduction Actions Yes Volume or Percentage Drop down Shortage Gap Reduction Value (May be a range) (AF) 1 Landscape - Restrict or prohibit runoff from landscape irrigation Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Require automatic shut of hoses Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Landscape - Limit landscape irrigation to specific days Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Pursuant to Resolution No. 7430 adopted by City Council in May 2022, no lawn, landscape, or other turf areas shall be watered or irrigated more than two (2) days per week (on Tuesday and Saturday). Yes 1 Landscape - Limit landscape irrigation to specific times Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF No lawn, landscape, or other turf areas shall be watered or irrigated between the hours of 9:00 a.m. and 6:00 p.m. Pacific time. Yes 1 Landscape - Prohibit certain types of landscape irrigation Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Pursuant to Resolution No. 7430 adopted by City Council in May 2022, an owner of property used primarily for commercial, industrial, or institutional purposes may not irrigate non- functional turf areas. Yes 1 Landscape - Other landscape restriction or prohibition Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF No irrigation during and within 48 hrs of measurable rainfall Yes Is the Supplier completing this table using the standard six levels? (yes/no) Submittal Table 8-3 Retail: Demand Reduction Actions Water Code Section 10632(a)(4)(B),(D), and (E) Add additional rows as needed How much is this going to reduce the shortage gap? Shortage Level Demand Reduction Actions Drop down list These are the only categories that will be accepted by the WUEdata online submittal tool. Select those that apply. Additional Explanation or Reference (OPTIONAL) Penalty, Charge, or Other Enforcement? For Retail Suppliers Only Drop Down List 2025 Urban Water Management Plan City of Arcadia Page 8-36 1 CII - Lodging establishment must offer opt out of linen service Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 CII - Restaurants may only serve water upon request Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Water Features - Restrict water use for decorative water features, such as fountains Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Customers must repair leaks, breaks, and malfunctions in a timely manner Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Prohibit use of potable water for washing hard surfaces Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 2Other Volume Collective reduction from all Shortage Level 2 actions is up to 3,442 AF All actions under Shortage Level 1 Yes 3Other Volume Collective reduction from all Shortage Level 3 actions is up to 5,163 AF All actions under Shortage Level 2 Yes 4Other Volume Collective reduction from all Shortage Level 4 actions is up to 6,884 AF All actions under Shortage Level 3 Yes 5Other Volume Collective reduction from all Shortage Level 5 actions is up to 8,605 AF All actions under Shortage Level 4 Yes 6Other Volume Collective reduction from all Shortage Level 6 actions is greater than 8,605 AF All actions under Shortage Level 5 Yes NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. 2025 Urban Water Management Plan City of Arcadia Page 9-1 CHAPTER 9 DEMAND MANAGEMENT MEASURES LAY DESCRIPTION – CHAPTER 9 DEMAND MANAGEMENT MEASURES Chapter 9 (Demand Management Measures) of the City’s 2025 Plan discusses and provides the following: x The City has implemented “Demand Management Measures” to reduce its water demands and achieve its water use targets (discussed in Chapter 5) x The City’s Demand Management Measures include adoption of an ordinance to prevent water waste. x The City’s Demand Management Measures include metering of all customer connections, including separate metering for single-family residential, commercial, industrial, large landscape and institutional/governmental facilities. x The City’s Demand Management Measures include conservation pricing. The City’s current water rate structure is tiered to promote water conservation by customers. x The City’s Demand Management Measures include public education and outreach programs regarding water conservation. x The City’s Demand Management Measures include various actions to assess and manage water distribution system losses. x Additional Demand Management Measures including rebate, conservation, and educational programs are discussed. x A summary of the Demand Management Measures the City has implemented over the past five (5) years is provided. The City met the 2020 Water Use Target 2025 Urban Water Management Plan City of Arcadia Page 9-2 (discussed in Chapter 5) through the implementation of these Demand Management Measures. DEMAND MANAGEMENT MEASURES FOR RETAIL SUPPLIERS CWC 10631. (e) Provide a description of the supplier’s water demand management measures. This description shall include all of the following: (1)(A) For an urban retail water supplier, as defined in Section 10608.12, a narrative description that addresses the nature and extent of each water demand management measure implemented over the past five years. The narrative shall describe the water demand management measures that the supplier plans to implement to achieve its water use targets pursuant to Section 10608.20. (B) The narrative pursuant to this paragraph shall include descriptions of the following water demand management measures: (i) Water waste prevention ordinances. (ii) Metering. (iii) Conservation pricing. (iv) Public education and outreach. (v) Programs to assess and manage distribution system real loss. (vi) Water conservation program coordination and staffing support. (vii) Other demand management measures that have a significant impact on water use as measured in gallons per capita per day, including innovative measures, if implemented. IMPLEMENTATION OVER THE PAST FIVE YEARS The City is committed to implementing water conservation programs and works collaboratively with Upper Water to provide water conservation programs for its residents. 2025 Urban Water Management Plan City of Arcadia Page 9-3 As a sub-agency of Upper Water, the City’s residents have the benefit of participating in Upper Water’s conservation efforts. The highlights of DMM implementation over the past five years are described below. As discussed in Section 9.1.3.1, the City has adopted and implemented Ordinance No. 2327 and Resolution 7430 concerning outdoor irrigation and prohibited water uses. New restrictions on outdoor irrigation and prohibited water uses were adopted. As discussed in Section 9.1.3.2, the City metered all customer connections, including separate metering for single-family residential, commercial, large landscape, and institutional/governmental facilities during the past five years. Furthermore, if there was new development within the City, each facility was individually metered. Service charges for the City are based on the customers’ connection size. As discussed in Section 9.1.3.3, The City’s Mandatory Water Conservation Program contains penalties for overuse of water during drought times that are based on the various stages enacted upon by resolutions passed by the Arcadia City Council. The City maintains a tiered rate structure for residential customers to promote water conservation. A water rate sheet showing current rates is provided in Appendix M. As discussed in Section 9.1.3.4, The City informs and educates its customers on water conservation through its quarterly newsletters, water bills, bill stuffers, biannual postcards, social media websites, and the City’s website. The City participates in numerous workshops throughout the year to promote water conservation (e.g. rain harvesting, leak detection, etc.) Upper Water partners with the Discovery Science Center and THINK Together to provide a free water conservation and sustainable watershed curriculum program for fourth through sixth graders at schools within Upper Water. In 2020, the program was proposed to expand to provide online options, as well as adding a seventh- grade curriculum. 2025 Urban Water Management Plan City of Arcadia Page 9-4 As discussed in Section 9.1.3.5, the City utilizes WaterSmart Software that sends customized monthly to quarterly consumption reports to residents. WaterSmart can alert customers of irregular use, which may be caused by a leak. The City distributed water conservation literature that alerted customers to be on the lookout for water system leaks and to correct them promptly. As a part of normal operation and maintenance of the water system, City staff performed preventive maintenance. This included regular checks on valves and meters, and pipeline maintenance. The City monitored the water system for losses by comparing water production to water sales. As described in Section 9.1.3.6, the City employs a Management Analyst who manages the City’s water conservation program, completing state mandated reports, enforcing ordinance, seeking grants, and conducting public outreach. The City plans to continue to provide water conservation programs and staffing support. As discussed in Section 9.1.3.7, the City participates in a regional rebate program, which is available to the City’s residential and commercial customers. There are rebates available for indoor plumbing including high efficiency clothes washers and toilets. Rebates are also available for outdoor plumbing including those for weather-based irrigation controllers, rotating sprinkler nozzles, and replacement of irrigated lawn with drought tolerant plants or other approved landscape options. The City’s commercial customers are offered rebates for retrofitting certain high water-use fixtures/equipment with more water efficient models. The City plans to continue implementation of the programs described to promote water conservation. 2025 Urban Water Management Plan City of Arcadia Page 9-5 IMPLEMENTATION TO ACHIEVE WATER USE TARGETS CWC 10631. (e)(1)(A) For an urban retail water supplier, as defined in Section 10608.12, a narrative description that addresses the nature and extent of each water demand management measure implemented over the past five years. The narrative shall describe the water demand management measures that the supplier plans to implement to achieve its water use targets pursuant to Section 10608.20. As indicated in Section 5.2.2, the City previously met its 2020 Water Use Target as part of the 2020 Plan. The City met the 2020 Water Use Target through the implementation of the Demand Management Measures discussed in Section 9.1.3. Continued implementation of these Demand Management Measures will assist the City in meeting water use targets and objectives. REQUIRED DEMAND MANAGEMENT MEASURES 9.1.3.1 WATER WASTE PREVENTION ORDINANCES The City adopted Ordinance No. 2327 in April 2015 concerning outdoor irrigation and prohibited water uses. The water demand reduction actions associated with Ordinance No. 2327 are included under Water Shortage Level 1 described in Section 8.4.2. As part of Ordinance No. 2327, the City Council is able to adjust the number of days per week in which lawn, landscape, or other turf areas can be watered or irrigated. In May 2022, the City adopted Resolution No. 7430 which includes the following updated provisions: 2025 Urban Water Management Plan City of Arcadia Page 9-6 x In winter (November through April) no lawn, landscape, or other turf areas shall be watered or irrigated more than two (2) days per week, or such other number of days as the City Council may prescribe by resolution from time to time. The two days per week shall be Tuesday and Saturday or such other days as the City Council may prescribe by resolution from time to time. x In summer (May through October) no lawn, landscape, or other turf areas shall be watered or irrigated more than two (2) days per week, or such other number of days as the City Council may prescribe by resolution from time to time. The two days per week shall be Tuesday and Saturday or such other days as the City Council may prescribe by resolution from time to time. Furthermore, outdoor watering of lawn, landscape or other turf areas shall be limited to no more than 10 minutes per station on each day allowed for such watering. x Notwithstanding the foregoing, an owner of property used primarily for commercial, industrial, or institutional purposes may not irrigate non-functional turf areas. "Non- functional turf' means turf that is solely ornamental and not regularly used for human recreational purposes or for civic or community events. Non-functional turf does not include sports fields and turf that is regularly used for human recreational purposes or for civic or community events. Copies of the resolution and ordinance are provided in Appendix N. The City’s service crews and meter readers also report wasteful uses of water, and residents are contacted regarding leaks and significant sprinkler run-off. 2025 Urban Water Management Plan City of Arcadia Page 9-7 9.1.3.2 METERING CWC 526. (a) Notwithstanding any other provision of law, an urban water supplier that, on or after January 1, 2004, receives water from the federal Central Valley Project under a water service contract or subcontract… shall do both of the following: (1) On or before January 1, 2013, install water meters on all service connections to residential and nonagricultural commercial buildings… located within its service area. CWC 527. (a) An urban water supplier that is not subject to Section 526 shall do both of the following: (1) Install water meters on all municipal and industrial service connections located within its service area on or before January 1, 2025. The City is fully metered for all customer sectors, including separate meters for single- family residential, multifamily residential, commercial, institutional and governmental facilities. Furthermore, if there is new development within the City, each facility is individually metered. Service charges for the City are based on the customers’ connection size. The City’s system effectively promotes water conservation by being completely metered. The City is continuing to install radio frequency read meters. Further information regarding the City’s service fees and conservation pricing is provided in Section 9.1.3.3. 9.1.3.3 CONSERVATION PRICING The City’s Mandatory Water Conservation Program, as outlined in its Municipal Code, contains penalties for overuse of water during drought times that are based on the various stages enacted upon by resolutions passed by the Arcadia City Council. The City’s water rate structure consists of two components; a monthly service charge and 2025 Urban Water Management Plan City of Arcadia Page 9-8 a monthly water rate. The monthly water rate includes three tiers for single family residential customers and two tiers for multi-family residential customers. The City’s rate structure is designed to proportionately allocate a greater share of the costs of service to those whose higher water usage generates additional costs to the water utility and promotes efficient water usage and conservation. A water rate sheet showing current rates is provided in Appendix M. In addition, Upper Water implements conservation pricing to encourage subagencies to conserve water. Additional information regarding Upper Water's conservation pricing can be found in its 2025 Plan and is incorporated by reference. 9.1.3.4 PUBLIC EDUCATION AND OUTREACH The City informs its customers about water conservation through its public information programs. The City has a quarterly newsletter that is sent to the City’s customers, which provides information about water conservation on a seasonal basis. The City also prints water conservation messages periodically on its customer’s water bills. In addition, the City’s “Hot Sheet”, which is mailed with the City’s water bills (a two-sided, one-page leaflet), is also used to remind residents of useful water conservation tips, purposely focused on a bimonthly basis either on indoor or outdoor conservation practices. The City mails biannual postcards informing its customers of the City’s Seasonal Watering Schedules. Lastly, the City is active on social media websites and the City’s website contains additional useful information. The City periodically holds public workshops to promote water conservation. The City provides rainwater harvesting workshops and hosts an annual Earth Day workshop on water conservation. The City’s Water Conservation Program also hosts free workshops on leak detection to promote awareness during national Fix-a-Leak Week. In addition, 2025 Urban Water Management Plan City of Arcadia Page 9-9 the City annually participates in the Wyland Foundation’s National Mayor’s Challenge for Water Conservation to spread awareness on good household water efficiency habits. The City customers can also receive public information about water conservation through Upper Water’s various public information programs. Upper Water offers conservation brochures, posters, activity booklets, public outreach display and workshops. Upper Water also raises awareness about water conservation through paid advertising, press releases, news ads and media events. The City participates annually in Upper Water’s annual Water 101 Forum, a large-scale educational event focused on water conservation. Furthermore, the City along with the Los Angeles County Office of Education and Los Angeles County of Public Works participate in the annual Los Angeles County Environmental Education Fair (LAEEF), held at the Arboretum which is located in the City of Arcadia. City staff is able to continue its dissemination of water conservation information and related take home items by manning booths and speaking with area residents, school-age children and educators. The City’s customers receive educational tools regarding water conservation through Upper Water’s school educational programs. Upper Water partners with the Discovery Science Center and THINK Together to provide a free water conservation and sustainable watershed curriculum program for fourth through sixth graders at schools within Upper Water. The City’s customers may also participate in educational school programs through MWD, which has extensive educational programs that includes schools within the City’s boundaries. Upper Water directly offers school education programs in an effort to raise awareness of water issues. Upper Water started its school education programs in September 1992 and the materials and presentations meet state education framework requirements. The following is a list of Upper Water’s school educational programs: 2025 Urban Water Management Plan City of Arcadia Page 9-10 x “Water is Life” Art Contest x Watershed Restoration Program x Sustainable Watershed Education Program 9.1.3.5 PROGRAMS TO ASSESS AND MANAGE DISTRIBUTION SYSTEM REAL LOSS The City’s estimated water system losses are discussed in Section 4.3. The City continues installing radio frequency read meters to provide secure and accurate meter data collection. The City repairs leaks within its distribution system on an as-needed basis. The City closely monitors its water production and consumption use tabulating the amount of “unaccounted for water”. The City has replaced many of its water meters with newer models, significantly reducing the water loss compared to previous years. The City’s current estimated “unaccounted for water” is less than one percent of the water demand. The City calculates the amount of “unaccounted for water” by finding the difference between the amount of water the City pumped and the amount of water sold to its customers. This program is effective in maintaining distribution systems that deliver water effectively and efficiently with the least amount of water loss. The amount of water conserved through the City’s system water audits, leak detection and repair program can be estimated by evaluating the average amount of “unaccounted for water”. The City monitors customer’s water use through its computerized billing system. The City utilizes WaterSmart Software that sends customized monthly to quarterly consumption reports to residents. The City’s billing system automatically audits customer’s water bills and flags those bills that show unusual or high consumption. The City’s billing system alerts the City when a customer’s bill is flagged for high consumption and a customer can make a request to have a service representative inspect their system to make necessary repairs. In addition, City staff can review water usage bills to determine if “excessive water 2025 Urban Water Management Plan City of Arcadia Page 9-11 use” occurred and can help customers individually determine the reason for the “excessive water use. The City will continue these programs to assess and manage distribution system real losses. 9.1.3.6 WATER CONSERVATION PROGRAM COORDINATION AND STAFFING SUPPORT The City’s Management Analyst is responsible for all aspects of environmental issues including water conservation measures for residents and business owners. The City’s Management Analyst coordinates public water awareness materials, public outreach events, seek grants, completing state mandated reports, speaks with residents/business owners who contact the City for water conservation information, and participates in the active dissemination of Upper Water efforts such as the High Efficiency Clothes Washer Rebate Program. The City has staff whose primary function is water conservation. Duties include outreach to various customer classes, response to customer inquiries, complaints, and provide assistance to business customers in achieving water use reduction. Staff will also work with field crews to enforce water conservation regulations. As a member of Upper Water, the City can utilize Upper Water’s water conservation coordinator to promote water conservation issues and programs within the City. The water conservation coordinator does research on water management practices and advises retail water purveyors on water conservation matters. Upper Water’s water conservation coordinator is effective at informing the public on water awareness and is involved in public information programs and school education programs. The water conservation coordinator employed by Upper Water promotes water conservation issues and programs. The position was created in 1992 as a full-time 2025 Urban Water Management Plan City of Arcadia Page 9-12 position. The water conservation coordinator does research on water managements practices and advises the Upper Water Board Members and its subagencies, including the City, on water conservation matters. More information about Upper Water’s conservation coordinator can be found in its 2025 Plan, which is incorporated by reference. 9.1.3.7 OTHER DEMAND MANAGEMENT MEASURES Rebate Programs Upper Water, in partnership with MWD, implement region-wide rebate programs through MWD’s SoCal Water$mart program. As a sub-agency of Upper Water, the City currently offers rebates to qualifying residential customers for high-efficiency washing machines, high-efficiency toilets, energy star dishwashers, weather-based irrigation controllers, rain barrels and pool covers. The rebate application, along with a list of qualifying appliances, are listed on MWD’s “Be Water Wise” website. DEMAND MANAGEMENT MEASURES FOR WHOLESALE SUPPLIERS CWC 10631. (e) Provide a description of the supplier’s water demand management measures. This description shall include all of the following: (2) For an urban wholesale water supplier, as defined in Section 10608.12, a narrative description of the items in clauses (ii), (iv), (vi), and (vii) of subparagraph (B) of paragraph (1), and a narrative description of its distribution system asset management and wholesale supplier assistance programs. 2025 Urban Water Management Plan City of Arcadia Page 9-13 The City is not a wholesale agency and is not required by DWR to complete Section 9.2. 2025 Urban Water Management Plan City of Arcadia Page 10-1 CHAPTER 10 PLAN ADOPTION, SUBMITTAL, AND IMPLEMENTATION LAY DESCRIPTION – CHAPTER 10 PLAN ADOPTION, SUBMITTAL, AND IMPLEMENTATION Chapter 10 (Plan Adoption, Submittal, and Implementation) of the City’s 2025 Plan discusses and provides the following: x The steps the City has performed to adopt and submit its 2025 Plan are detailed x The steps the City has performed to adopt and submit its Water Shortage Contingency Plan are detailed x The City coordinated the preparation of its 2025 Plan with the Main San Gabriel Basin Watermaster, Upper Water, City of Monrovia, City of Pasadena, City of Sierra Madre, San Gabriel Valley Water Company, Golden State Water Company, California American Water Company, and Sunny Slope Water Company. The City notified these agencies at least sixty (60) days prior to the public hearing of the preparation of the 2025 Plan and invited these agencies to participate in the development of the 2025 Plan. x The City provided a notice of the public hearing to the same agencies regarding the time, date, and place of the public hearing. x The City published a newspaper notification of the public hearing, once a week for two successive weeks x The City conducted a public hearing to discuss and adopt the City’s 2025 Plan and City’s Water Shortage Contingency Plan. x Within 30 days of adoption, the City submitted the 2025 Plan and Water Shortage Contingency Plan to the California Department of Water Resources. 2025 Urban Water Management Plan City of Arcadia Page 10-2 x Within 30 days of adoption, the City submitted all data tables associated with the 2025 Plan to the California Department of Water Resources. x Within 30 days of adoption, the City submitted a copy of the 2025 Plan to the State of California Library. x Within 30 days of adoption, the City submitted a copy of the 2025 Plan (and Water Shortage Contingency Plan) to the County of Los Angeles Registrar/Recorders office and the City Clerk’s Office. x Within 30 days after submittal of the 2025 Plan to the California Department of Water Resources, the City made the 2025 Plan (including the Water Shortage Contingency Plan) available at the City Clerk’s Office and on the City’s website. x The steps the City will perform to amend the 2025 Plan and/or the Water Shortage Contingency Plan, if necessary, are provided. PLAN COMPLETION TIMELINE The data provided in the City’s 2025 Plan and the Water Shortage Contingency Plan is provided on a FY basis through June 30, 2025 (as discussed in Section 2.5). NOTICE OF PLAN PREPARATION CWC 10621. (b) Every urban water supplier required to prepare a plan shall … at least 60 days prior to the public hearing on the plan … notify any city or county within which the supplier provides waters supplies that the urban water supplier will be reviewing the plan and considering amendments or changes to the plan. 2025 Urban Water Management Plan City of Arcadia Page 10-3 As discussed in Section 2.4.2., the City coordinated the preparation of the 2025 Plan with the Main San Gabriel Basin Watermaster, Upper Water, City of Monrovia, City of Pasadena, City of Sierra Madre, San Gabriel Valley Water Company, Golden State Water Company, California American Water Company, and Sunny Slope Water Company. The City notified these agencies, as well as to the cities and county within which the City provides water supplies, at least sixty (60) days prior to the public hearing of the preparation of the 2025 Plan and invited them to participate in the development of the Plan. A copy of the notification letters sent to these agencies is provided in Appendix D. NOTICE OF PUBLIC HEARING CWC 10642. …Prior to adopting either, the urban water supplier shall make both the plan and the water shortage contingency plan available for public inspection and shall hold a public hearing or hearings thereon. Prior to any of these hearings, notice of the time and place of the hearing shall be published within the jurisdiction of the publicly owned water supplier pursuant to Section 6066 of the Government Code. The urban water supplier shall provide notice of the time and place of a hearing to any city or county within which the supplier provides water supplies. Government Code 6066. Publication of notice pursuant to this section shall be once a week for two successive weeks. Two publications in a newspaper published once a week or oftener, with at least five days intervening between the respective publication dates not counting such publication dates, are sufficient. The period of notice commences upon the first day of publication and terminates at the end of the fourteenth day, including therein the first day. The City provided a notice of the public hearing to the County of Los Angeles Registrar Recorder, Main San Gabriel Basin Watermaster, Upper Water, City of Monrovia, City of Pasadena, City of Sierra Madre, San Gabriel Valley Water Company, Golden State Water Company, California American Water Company, and Sunny Slope Water Company. The notice includes the time and place of the public hearing. Copies of the notice of the public 2025 Urban Water Management Plan City of Arcadia Page 10-4 hearing are provided in Appendix D. Table 10-1 summarizes the agencies which were provided notifications by the City. The City encouraged the active involvement of the population within its service area prior to and during the preparation of the Plan. Pursuant to Section 6066 of the Government Code, the City published a notice of public hearing in the newspaper during the weeks of June 1, 2026 and June 8, 2026. A notice of public hearing was also provided to the City Clerk’s office and was posted throughout the City of Arcadia and on the City’s website. A copy of the published notice is provided in Appendix D. To ensure the draft 2025 Plan and the draft Water Shortage Contingency Plan were available for review, the City placed a copy at the City Clerk’s Office located at City Hall, at the Public Works Services Center located at 11800 Goldring Road, and made a copy available for review on its website at www.ArcadiaCA.gov/UWMP. PUBLIC HEARING AND ADOPTION CWC 10642. Each urban water supplier shall encourage the active involvement of diverse social, cultural, and economic elements of the population within the service area prior to and during the preparation of both the plan and the water shortage contingency plan. Prior to adopting either, the urban water supplier shall make both the plan and the water shortage contingency plan available for public inspection and shall hold a public hearing or hearings thereon…. After the hearing or hearings, the plan or water shortage contingency plan shall be adopted as prepared or as modified after the hearing or hearings. Government Code Section 7291 …every local public agency… serving a substantial number of non- English-Speaking people, shall employ a sufficient number of qualified bilingual persons in public contact positions or as interpreters to assist those in such positions, to ensure provision of information and services in the language of the non-English-speaking person. 2025 Urban Water Management Plan City of Arcadia Page 10-5 Prior to adopting the draft 2025 Plan and draft the Water Shortage Contingency Plan, the City held a public hearing on June 16, 2026 which included input from the community regarding the City’s draft 2025 Plan and the draft Water Shortage Contingency Plan. Following the public hearing, the City adopted both the draft 2025 Plan and the draft Water Shortage Contingency Plan (included in Chapter 8). A copy of the resolution adopting the 2025 Plan and the Water Shortage Contingency Plan is provided in Appendix O. PLAN SUBMITTAL CWC 10621. (e) .Each urban water supplier shall update and submit its 2025 plan to the department by July 1, 2026… CWC 10635. (c) The urban water supplier shall provide that portion of its urban water management plan prepared pursuant to this article to any city or county within which it provides water supplies no later than 60 days after the submission of its urban water management plan. CWC 10644. (a) (1) An urban water supplier shall submit to the department, the California State Library, and any city or county within which the supplier provides water supplies a copy of its plan no later than 30 days after adoption. The City’s submittal process for its 2025 Plan and the Water Shortage Contingency Plan is discussed below. 2025 Urban Water Management Plan City of Arcadia Page 10-6 SUBMITTING A UWMP AND WATER SHORTAGE CONTINGENCY PLAN TO DWR Within 30 days of adoption of the 2025 Plan by the City Council, the City submitted the adopted 2025 Plan (including the Water Shortage Contingency Plan) to DWR. The 2025 Plan and Water Shortage Contingency Plan were submitted through DWR’s “Water Use Efficiency (WUE) Data Portal” website. DWR developed a checklist which was used by the City to assist DWR with its determination that the City’s 2025 Plan has addressed the requirements of the California Water Code. The City has completed the DWR checklist by indicating where the required CWC elements can be found within the City’s 2025 Plan (See Appendix B). ELECTRONIC DATA SUBMITTAL CWC 10644. (a)(2) The plan, or amendments to the plan, submitted to the department …shall be submitted electronically and shall include any standardized forms, tables, or displays specified by the department. Within 30 days of adoption of the 2025 Plan, the City submitted all data tables associated with the 2025 Plan through DWR’s “Water Use Efficiency Data Portal” website. 2025 Urban Water Management Plan City of Arcadia Page 10-7 SUBMITTING A UWMP, INCLUDING WSCP, TO THE CALIFORNIA STATE LIBRARY Within 30 days of adoption of the 2025 Plan by the City Council, a copy (CD or hardcopy) of the 2025 Plan was submitted to the State of California Library. A copy of the letter to the State Library will be maintained in the City’s file. The 2025 Plan will be mailed to the following address if sent by regular mail: California State Library Government Publications Section Attention: Coordinator, Urban Water Management Plans P.O. Box 942837 Sacramento, CA 94237-0001 The 2025 Plan will be mailed to the following address if sent by courier or overnight carrier: California State Library Government Publications Section Attention: Coordinator, Urban Water Management Plans 900 N Street Sacramento, CA 95814 SUBMITTING A UWMP TO CITIES AND COUNTIES Within 30 days of adoption of the 2025 Plan (including the Water Shortage Contingency Plan) by the City Council, a copy of the 2025 Plan was submitted to the County of Los Angeles Registrar / Recorders office and the City Clerk’s Office. A copy of the letter to the County of Los Angeles will be maintained in the City’s file. 2025 Urban Water Management Plan City of Arcadia Page 10-8 PUBLIC AVAILABILITY CWC 10645. (a) Not later than 30 days after filing a copy of its plan with the department, the urban water supplier and the department shall make the plan available for public review during normal business hours. (b) Not later than 30 days after filing a copy of its water shortage contingency plan with the department, the urban water supplier and the department shall make the plan available for public review during normal business hours. Within 30 days after submittal of the 2025 Plan to DWR, the City made the 2025 Plan (including the Water Shortage Contingency Plan) available at the City Clerk’s Office located at City Hall during normal business hours and on the City’s website. NOTIFICATION TO PUBLIC UTILITIES COMMISSION CWC 10621. (c) An urban water supplier regulated by the Public Utilities Commission shall include its most recent plan and water shortage contingency plan as part of the supplier’s general rate case filings. The City is not regulated by the California Public Utilities Commission. 2025 Urban Water Management Plan City of Arcadia Page 10-9 PLAN IMPLEMENTATION CWC 10643. An urban water supplier shall implement its plan adopted pursuant to this chapter in accordance with the schedule set forth in its plan. The City will implement any schedules set forth in the adopted 2025 Plan. AMENDING AN ADOPTED UWMP OR WATER SHORTAGE CONTINGENCY PLAN CWC 10621. (d) The amendments to, or changes in, the plan shall be adopted and filed in the manner set forth in Article 3 (commencing with Section 10640). CWC 10644. (a)(1) Copies of amendments or changes to the plans shall be submitted to the department, the California State Library, and any city or county within which the supplier provides water supplies within 30 days after adoption. The City’s amendment process for its 2025 Plan is discussed below. AMENDING A UWMP OR WSCP If the City amends the adopted 2025 Plan, the City will conduct a similar notification and public hearing process for the amended 2025 Plan as discussed in Sections 10.2, 10.3, and 10.4. The amended Plan will undergo adoption by the City’s governing board. Within 2025 Urban Water Management Plan City of Arcadia Page 10-10 30 days of adoption, the amended Plan will then be submitted to DWR, the State of California Library, the County of Los Angeles Registrar / Recorders office, and the City Clerk’s Office. AMENDING A WATER SHORTAGE CONTINGENCY PLAN CWC 10644. (a) If an urban water supplier revises its water shortage contingency plan, the supplier shall submit to the department a copy of its water shortage contingency plan prepared…no later than 30 days after adoption, in accordance with protocols for submission and using electronic reporting tools developed by the department. If the City amends the adopted 2025 Plan (including the Water Shortage Contingency Plan), the amended Plan (and Water Shortage Contingency Plan) will undergo adoption by the City’s governing board. Within 30 days of adoption, the amended Plan (and Water Shortage Contingency Plan) will then be submitted to DWR, the State of California Library, the County of Los Angeles Registrar / Recorders office, and the City Clerk’s Office. CALIFORNIA DEPARTMENT OF WATER RESOURCES REVIEW OF SUBMITTED PLANS As discussed in Section 1.5, DWR will review the 2025 Plans to ensure that they address the California Water Code requirements. Following DWR’s review, water suppliers will be notified of the results of the review via a formal review letter. These review letters will also be available to the public on DWR’s WUEdata portal. In cases where DWR finds that a Plan does not properly address item(s) in the Water Code, DWR will reach out to the water supplier to discuss needed corrections and correction procedures. 2025 Urban Water Management Plan City of Arcadia Page 10-11 SUBMITTAL TABLES The applicable standardized Submittal Tables referenced within Chapter 10 are provided below. SUBMITTAL TABLE 10-1: NOTIFICATION TO CITIES AND COUNTIES Table 10-1 Notification to Cities and Counties City Name 60 Day Notice Drop Down (yes/no) Notice of Public Hearing Drop Down (yes/no) Arcadia Yes Yes Monrovia Yes Yes Sierra Madre Yes Yes Pasadena Yes Yes County Name Drop Down List 60 Day Notice Drop Down (yes/no) Notice of Public Hearing Drop Down (yes/no) Los Angeles County Yes Yes Submittal Table 10-1 Retail: Notification to Cities and Counties Water Code Section 10621(b) and 10642 Add additional rows as needed Add additional rows as needed NOTES: Service Layer Credits: Sources: Esri, HERE, Garmin, USGS, Intermap, INCREMENT P, NRCan, Esri Japan, METI, Esri China (Hong Kong), Esri Korea, Esri (Thailand), NGCC, (c) OpenStreetMap contributors, and the GIS User Community Do c u m e n t P a t h : J : \ j n 2 7 4 1 \ A r c a d i a _ S e r v i c e A r e a . m x d CITY OF ARCADIA WATER SERVICE AREA Ü 00.51 Miles FIGURE 1 Service Layer Credits: Sources: Esri, HERE, Garmin, USGS, Intermap, INCREMENT P, NRCan, Esri Japan, METI, Esri China (Hong Kong), Esri Korea, Esri (Thailand), NGCC, (c) OpenStreetMap contributors, and the GIS User Community Unincorporated Arcadia El Monte Irwindale Monrovia Pasadena Sierra Madre Temple City Mayflower Village North El Monte South Monrovia Island East Pasadena East San Gabriel El Monte Unincorporated Do c u m e n t P a t h : J : \ j n 2 7 4 1 \ A r c a d i a _ S e r v i c e A r e a _ C i t y B o u n d a r i e s . m x d CITY OF ARCADIA WATER SERVICE AREA AND CITY BOUNDARIES Ü 00.51 Miles FIGURE 2 City of Arcadia City Boundary UV710 UV66 UV72 UV60 UV57 UV71 UV134 UV110 UV19 §¨¦210 §¨¦605 §¨¦710 §¨¦5 §¨¦10 Document Path: J:\jn2741\Arcadia_SGBasin_Location.mxd CITY OF ARCADIA MAIN SAN GABRIEL BASIN LOCATION Ü01.53 Miles FI G U R E 3 Basin Boundary Water System Boundary Santa Anita Subarea Monk Hill Subarea Pasadena Subarea UV710 UV2 UV19 UV110 UV134 §¨¦210 §¨¦605§¨¦5 Document Path: J:\jn2741\Arcadia_RaymondBasin_Location.mxd CITY OF ARCADIA RAYMOND BASIN LOCATION Ü012 Miles FI G U R E 4 Basin Boundary Water System Boundary CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX A DWR STANDARDIZED TABLES CA1910003 City of Arcadia 15,564 13,294 15,564 13,294Total Public Water System Number Public Water System Name Number of Municipal Connections 2025 Submittal Table 2-1 Retail: Public Water Systems Add additional rows as needed NOTES: Units are in acre-feet (AF) Volume of Water Supplied 2025 (AF) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Select One Name of Regional Alliance or RUWMP (Drop Down List) NOTES: Submittal Table 2-2: Plan Identification Type of Plan Individual UWMP If Water Supplier is also a member of a SB X7-7 Regional Alliance, select name from the drop- down. Regional Urban Water Management Plan (RUWMP) If Supplier selected RUWMP, select name from the drop-down. Supplier is a wholesale supplier Supplier is a retail supplier UWMP Tables are in calendar years UWMP Tables are in fiscal years Unit AF Submittal Table 2-3: Supplier Identification Type of Supplier (select one or both) Fiscal or Calendar Year (select one) If using fiscal years provide month and date that the fiscal year begins (mm/dd) Units of measure used in UWMP (Select from the drop down list). 07/01 DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. NOTES: cal o Submittal Table 2-4 Retail: Water Supplier Information Exchange Water Code Section 10631(h) The retail Supplier has informed the following wholesale supplier(s) of projected water use. Wholesale Water Supplier Name Add additional rows as needed Upper San Gabriel Valley Municipal Water District NOTES: 2025 2030 2035 2040 2045 2050(opt) 54,700 60,303 65,903 66,233 66,564 66,897 Submittal Table 3-1 Retail: Population - Current and Projected Water Code Section 10631(a) Population Served NOTES: Use Type Drop down list May select each use multiple times These are the only use types that will be recognized by the WUEdata online submittal tool Potable or Non- Potable (OPTIONAL) Drop down list Volume (AF) Single Family Potable 7,010 Multi-Family Potable 1,863 Commercial Potable 2,284 Institutional/Governmental Potable 937 Other (optional) Fire Hydrants Potable 1 Landscape Potable 135 Distribution System Water Loss Potable 1,064 13294 0 13,294Total Submittal Table 4-1 Retail: Total Uses for Potable and Non-Potable Water — Actual Water Code Section 10631(d)(1) NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. 2025 Actual Water Use Add additional rows as needed Subtotal Potable Subtotal Non-Potable Additional Description (as needed) Use Type Drop down list May select each use multiple times These are the only Use Types that will be recognized by the WUEdata online submittal tool Potable or Non-Potable (OPTIONAL) Drop down list 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF)2050 opt (AF) Single Family Potable 7,790 8,513 8,556 8,599 8,642 Multi-Family Potable 2,070 2,262 2,273 2,285 2,296 Commercial Potable 2,538 2,774 2,788 2,802 2,816 Institutional/Governmental Potable 1,041 1,138 1,144 1,150 1,155 Other (optional) Fire Hydrants Potable 1 1 1 1 1 Landscape Potable 151 164 165 166 167 Distribution System Water Loss Potable 1,182 1,292 1,298 1,305 1,311 14,773 16,144 16,225 16,308 16,388 0000 0 14,773 16,144 16,225 16,308 16,388 Add additional rows as needed. Submittal Table 4-2 Retail: Total Uses for Potable, and Non-Potable Water — Projected Water Code Section 10631(d)(1) Projected Water Use (Report To the Extent that Records are Available) Additional Description (as needed) NOTES: Total DWR NOTES: Units of measure (AF, CCF, MG ) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Subtotal Non-Potable Subtotal Potable Are Future Water Savings Included in Projections? Drop down list (y/n) Yes If "Yes" to above, state the section or page number, in the cell to the right, where citations of the codes, ordinances, or otherwise are utilized in demand projections are found. Optional Suppliers may complete Optional Submittal Table 4-4 R to quantify the expected savings. Section 4.2.5 and Chapter 8 Are Lower Income Residential Demands Included In Projections? Drop down list (y/n)Yes Optional If the method for accounting Lower Income Residential Demands has been included, provide page number where this accounting can be found. Submittal Table 4-3 Retail: Inclusion in Water Use Projections Water Code Section 10631 (a), 10631 (d)(4)(A), and 10631 (d)(4)(B) NOTES: DWR NOTES: Additional guidance is provided in Appendix K. Public Water System ID # Reported in Table 2-1 R Reporting Period Submitted to DWR Water Loss Audit Program (yes/no) 2020 No 2021 No 2022 Yes 2023 No 2024 No Submittal Table 4-5 Retail: Water Loss Audit Reporting Water Code Section 10631(d)(3)(A) CA1910003 DWR NOTES: Suppliers will provide a link to the WUEdata submittals of their Water Loss Audit Reports. NOTES: The City has also prepared Water Loss Audits representing Calendar Year 2020, Calendar Year 2021, and Fiscal Year 2024-25 and w ill be submitting these audits to DWR. Report submittal status for all five years for each Public Water System as available. Add rows as needed 2028 Real Water Loss Standard per Unit per day Units for Real Water Loss Drop down list Number of Units (Connections or Miles corresponding with units selected) Volume of Total Real Loss (from AWWA Water Loss Audit) (AF) 2028 Apparent Water Loss Standard per Unit per Day Units for Apparent Water Loss Number of Connections Volume of Total Apparent Loss (from AWWA Water Loss Audit) (AF) CA1910003 Yes 19.0 Gallons per Service Connection per Day (GPSCD) 14958 792.144 47.3 44.4 Gallons per Service Connection per Day (GPSCD) 14958 162.426 9.7 Gallons per Service Connection per Day (GPSCD) Gallons per Service Connection per Day (GPSCD) Submittal Table 4-6 Retail: Progress Towards 2028 Water Loss Standard Water Code Section 10631(d)(3)(C) NOTES: Information used to complete the table above was based on the Water Loss Audit from FY 2022-23. The City has also prepared Water Loss Audits representing Calendar Year 2020, Calendar Year 2021, and Fiscal Year 2024-25 and will be submitting these audits to DWR. Apparent Water Loss Did the Water Board Calculate a Water Loss Standard for this Public Water System? (y/n) If no, Supplier will not complete this row. Real Water Loss Water Board's Calculated Water Loss Standards DWR NOTES: Units of measure (AF, CCF, MG) for Water Loss MUST remain consistent with units reported in Submittal Table 2-3. The units reported in Submittal Table 2-3 are used in this table's calculations. Public Water System ID # Reported in Submittal Table 2- 1 R Add additional rows as needed. Most Recent AWWA Water Loss Audit Real Water Loss Per Unit per Day Most Recent AWWA Water Loss Audit Apparent Water Loss Per Unit per Day State Water Board Standard State Water Board Standard Actual 2025 GPCD (From SB X7-7 Compliance Form) Did Supplier meet the 2020 Target in 2025? No Individual Target 238 230 Yes NA Submittal Table 5-1 Retail: SB X7-7 2020 Target Progress Water Code Section 10608.40 NOTES: Did Supplier Achieve Targeted Reduction for 2020? Actual 2020 GPCD2020 Target Regional Alliance Target or Individual Target? Drop down list DWR NOTES: Suppliers calculating a 2025 GPCD will need to complete and submit SB X 7-7 Compliance Tables to verify the use of SB X7-7 Methodologies. Suppliers that were part of a merger or consolidation since 2020 see Chapter 5 and Appendix P for guidance. Check the box if the Supplier was not an Urban Water Supplier during or before the 2020 UWMP reporting cycle. Proceed to the next table. Only for suppliers that did not meet the Target in 2020 See DWR NOTES below. Was Supplier part of a merger or consolidation since 2020? Groundwater Type Drop Down List May use each category multiple times Potable or Non-Potable (OPTIONAL) Drop down list Location or Basin Name 2021 (AF) 2022 (AF) 2023 (AF) 2024 (AF)2025 (AF) Alluvial Basin Potable East Raymond Basin 2216 2179 1734 2060 2167 Alluvial Basin Potable West Raymond Basin 678 621 641 286 772 Alluvial Basin Potable Main Basin 12116 11480 9245 9528 10355 15,010 14,280 11,620 11,874 13,294 Add additional rows as needed Submittal Table 6-1 Retail: Groundwater Volume Pumped Water Code Section 10631(4) and 10631(4)(c) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. NOTES Total Check the box if the Supplier does not pump groundwater. Proceed to the next table. Check the box if all or part of the groundwater described below is desalinated. (OPTIONAL) Name of Wastewater Collection Agency Wastewater Volume Metered or Estimated? OPTIONAL Drop Down List Volume of Wastewater Collected from UWMP Service Area 2025 (AF) Name of Wastewater Treatment Plant (WWTP) and Place ID Number Drop down list Is WWTP Located Within UWMP Area? Drop Down List LACSD Estimated 123 Whittier Narrows Water Reclamation Plant, Place ID 235826 No LACSD Estimated 821 San Jose Creek Water Reclamation Plant, Place ID 260156 No LACSD Estimated 3,283 A.K. Warren Water Resource Facility, Place ID 234156 No 4,227 Check the box if there is no wastewater collection system. Proceed to the next table. NOTES: Submittal Table 6-2 Retail: Wastewater Collected Within Service Area Water Code Section 10633(a) Percentage of 2025 service area population served by wastewater collection system (OPTIONAL) Percentage of 2025 service area served by wastewater collection system (OPTIONAL) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Additional Guidance : See Appendix M, Section M.21 for detailed guidance on this table. Wastewater Collection Recipient of Collected Wastewater Total Wastewater Received from UWMP Service Area in 2025: Add additional rows as needed Treatment Level Drop down list Volume (AF) Treatment Level Drop down list Volume (AF) Treatment Level Drop down list Volume (AF) Treatment Level Drop down list Volume (AF) Treatment Level Drop down list Volume (AF) Name of other entity 0- 0 0 0 0 0 Submittal Table 6-3 Retail: Wastewater Treatment and Outcomes Within UWMP Service Area Water Code Section 10633(b) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. IPR: Indirect Potable Reuse would have the treatment level of its end use requirement in the Level of Treatment drop-down. Additional Guidance: See Appendix M, Section M.21 for detailed guidance on this table. Water Recycled Outside of UWMP Service Area (enter data as applicable) Effluent Discharge that is not a Permitted Recycled Water Use (enter data as applicable) Required Discharge for Instream Flow (enter data as applicable) Delivered to Another Entity for Additional Treatment (enter data as applicable) Add additional rows as needed 2025 Outcomes of Treated Wastewater Check the box if no wastewater is treated or disposed of within the UWMP service area. Proceed to the next table. Does This Plant Treat Wastewater Generated Outside the UWMP Service Area? (OPTIONAL) Drop down list Wastewater Treatment Plant Name and Place ID Number Drop down list Total 2025 Volume of Water Treated (AF) NOTES: Total 2025 Volume of Wastewater Received from UWMP Service Area (As Reported in Submittal Table 6-2 R) (AF) Water Recycled Within UWMP Service Area (enter data as applicable) Volume Narrative page number (OPTIONAL) 0000000 0000000 0000000 0 Check box if recycled water is not used and is not planned for use within the service area of the supplier. The supplier will only complete the column on "Potential Recycled Water Use" and submit an accompanying narrative on the feasibility of that potential recycled water use. Submittal Table 6-4 Retail: Recycled Water Direct Beneficial Uses Within Service Area Water Code Section 10633 (c),(d),(e) Potential Recycled Water Use Name(s) of Facility/ies Producing (Treating) the Recycled Water (OPTIONAL) : Name of Supplier Operating the Recycled Water Distribution System (OPTIONAL) : Volume of Supplemental Water Added in 2025 (OPTIONAL) : Source of 2025 Supplemental Water (OPTIONAL) : Total Use Type Drop down list Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop down list Additional Information (as needed) Add additional rows as needed DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Additional Guidance: See Appendix M, Section M.21 for detailed guidance on this table. Potential recycled water use: a description of the feasibility of these uses must be included in the narrative. Multiple Producers: If you have multiple recycled water producers, submit a separate table for each. NOTES: 2050 (AF)2025 (AF)2030 (AF)2035 (AF) 2040 (AF) 2045 (AF) Subtotal Potable Subtotal Non-Potable 2020 Projection for 2025 (AF) 2025 Actual Use (AF) 00 Submittal Table 6-5 Retail: 2020 UWMP Recycled Water Use Projection Compared to 2025 Actual Water Code Section 10633(e) Check the box if recycled water was not used in 2025 nor previously projected for use in 2020. Proceed to the next table. Add additional rows as needed NOTES: Total DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure reported in Submittal Table 2-3 Additional Guidance: See Appendix M, Section M.21 for detailed guidance on this table. Use Type Drop Down list Section 6.2.5 Name of Action Description Expected Increase in Recycled Water Use (AF) 0 0 Total (AF) DWR NOTES: Units of measure (AF, CCF, MG) MUST remain consistent with units reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. The unit conversion to Acre Feet addresses the Water Code's requirement that this value be provided in acre-feet. NOTES: Submittal Table 6-6 Retail: Methods to Encourage Future Recycled Water Use Water Code Section 10633(f) Check the box if the Supplier does not plan to expand recycled water use in the future. Supplier will not complete the table below but will provide narrative explanation. Provide page location of narrative in the UWMP Add additional rows as needed Unit Conversion to AF Planned Implementation Year Section 6.2.10 Drop Down List (yes/no) If Yes, Supplier Name New Groundwater Well (Goldring)Yes City of Sierra Madre New Main Basin well Potable 2027 All Year Types 1,600 Planned for Use in Year Type Drop Down List NOTES: Submittal Table 6-7 Retail: Expected Future Water Supply Projects or Programs Water Code Section 10631(f) DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure reported in Submittal Table 2-3. Check the box if some or all of the supplier's future water supply projects or programs are not compatible with this table and are described in a narrative format. Check the box if there are no expected future water supply projects or programs that provide a quantifiable increase to the agency's water supply. Proceed to the next table. Planned Implementation Year Add additional rows as needed Joint Project with other suppliers?Expected Increase in Water Supply to Supplier (This may be a range) (AF) Provide page location of narrative in the UWMP Name of Future Projects or Programs Additional Description (as needed) Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop Down list Water Supply Drop down list May use each category multiple times. These are the only water supply categories that will be recognized by the WUEdata online submittal tool Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop Down list Actual Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Groundwater (not desalinated) East Raymond Basin Potable 2,167 Groundwater (not desalinated) West Raymond Basin Potable 772 Groundwater (not desalinated) Main Basin Potable 10,355 Purchased or Imported Water MWD Potable 0 13,294 0 00 13,294 0 Submittal Table 6-8 Retail: Water Supplies — Actual Water Code Section 10631(b) 2025 NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table identifies the unit of measure selected in Submittal Table 2-3. Total Entitlement: e.g. Water Right, Groundwater Allocation, Contracted Amount. Add additional rows as needed Total Subtotal Potable Subtotal Non-Potable Additional Description (as needed) Water Supply Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Reasonably Available Volume (AF) Total Entitlement (OPTIONAL) See 'DWR Notes' below (AF) Groundwater (not desalinated) East Raymond Basin Potable 2,300 2,300 2,300 2,300 2,300 Groundwater (not desalinated) West Raymond Basin Potable 800 800 800 800 800 Groundwater (not Main Basin Potable 11,673 13,044 13,125 13,208 13,288 Purchased or Imported Water MWD Potable 0 0 0 0 0 14,773 0 16,144 0 16,225 0 16,308 0 16,388 0 0000000000 14,773 0 16,144 0 16,225 0 16,308 0 16,388 0 Submittal Table 6-9 Retail: Water Supplies — Projected Water Code Section 10631 (b) Projected Water Supply (Report to the Extent Practicable) Drop down list May use each category multiple times. These are the only water supply categories that will be recognized by the WUEdata online submittal tool Additional Detail on Water Supply Potable or Non-Potable (after treatment if treated) (OPTIONAL) Drop Down list 2050 (opt) Add additional rows as needed Total NOTES: 2030 2035 2040 2045 Subtotal Non-Potable Subtotal Potable DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Total Entitlement: e.g. Water Right, Groundwater Allocation, Contracted Amount. Water Delivery Product drop down list (If delivering more than one type of product recommend using Table O-1C) Retail Potable Deliveries Start Date of Reporting Period 7/1/2024 End Date of Reporting Period 6/30/2025 Is upstream embedded energy in the values reported?No Units of Measure for Water AF Total Utility See DWR NOTES Hydropower Net Utility 13,294 13,294 10,785,416 10,785,416 2,490 - 2,490 Quantity of Self-Generated Renewable Energy 0kWh Data Quality (Estimate, Metered Data, Combination of Estimates and Metered Data) Combination of Estimates and Metered Data Data Quality Narrative: Narrative: Optional Submittal Table O-1B: Recommended Energy Reporting - SINGLE DELIVERY PRODUCT - TOTAL UTILITY APPROACH The total energy consumed was identified based on Southern California Edison (SCE) billing records. Although the total energy consumed includes electricity usage for general administration (which is not an identified water management process), general administration energy use is considered to be negligible compared to overall water system use and has not been netted out. Only for Water Delivery Products Under the Urban Water Supplier's Operational Control Sum of All Water Management Processes Non-Consequential Hydropower DWR NOTES: Total Utility:The volume of water entered in the “Total Utility” column should equal the volume of water entering the distribution system (excluding recycled water); in most cases, this is the total volume calculated in UWMP Table 4-1: 2025 Actual Total Uses for Potable and N on-Potable Water. Note if recycled water is included in your Submittal Table 4-1, you must exclude it from your volume in this table. NOTES: The total energy consumption includes energy associated with operating groundwater production wells and booster pumps to deliver water in the distribution system. Energy consumption is associated with operating groundwater water treatment. Energy consumption is also associated with plant lighting and air conditioning, and operating the Supervisory Control and Data Acquisition (SCADA) system and chlorination injection pumps. Volume of Water Entering Process Energy Consumed (kWh) Energy Intensity (kWh/vol. converted to MG) % of Average Supply Average Year 2020 100% Single-Dry Year 2018 103.5% Consecutive Dry Years 1st Year 2012 117.7% Consecutive Dry Years 2nd Year 2013 123.5% Consecutive Dry Years 3rd Year 2014 125.2% Consecutive Dry Years 4th Year 2015 110.0% Consecutive Dry Years 5th Year 2016 88.8% 13935 14416 Year Type Base Year If not using a calendar year, type in the last year of the fiscal, water year, or range of years, for example, water year 2024- 2025, use 2025 Optional Submittal Table 7-1 Retail: Basis of Water Year Data (Reliability Assessment) Available Supplies if Year Type Repeats Check the box if quantification of available supplies is not compatible with this table and is provided elsewhere in the UWMP. Location: [insert location from UWMP] Volume Available (AF) Quantification of available supplies is provided in this table as either volume only, percent only, or both. 16399 17211 NOTES: 17452 15326 12369 DWR NOTES: Supplier may use multiple versions of Submittal Table 7-1 R if different water sources have different base years and the supplier chooses to report the base years for each water source separately. If a Supplier uses multiple versions of Submittal Table 7-1 R, in the "Note" section of each submittal table, state that multiple versions of Submittal Table 7-1 R are being used and identify the particular water source that is being reported in each submittal table. Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. This table reports the units of measure reported in Submittal Table 2-3. 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF)2050 (AF) Supply totals (autofill from Submittal Table 6-9 R) 14,773 16,144 16,225 16,308 16,388 Use totals (autofill from Submittal Table 4-2 R) 14,773 16,144 16,225 16,308 16,388 Surplus/(shortfall)0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) OPTIONAL Planned WSCP Actions Submittal Table 7-2 Retail: Normal Year Supply and Use Comparison Water Code Section 10635 (a) NOTES: DWR NOTES : Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Supply totals 15,283 16,701 16,785 16,871 16,954 Use totals 15,283 16,701 16,785 16,871 16,954 Surplus/(shortfall)0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) 2050 (AF) DWR NOTES : Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. NOTES Submittal Table 7-3 Retail: Single Dry Year Supply and Use Comparison Water Code Section 10635(a) OPTIONAL Planned WSCP Actions 2030 (AF)2035 (AF)2040 (AF)2045 (AF) 2030 (AF) 2035 (AF) 2040 (AF) 2045 (AF)2050 (AF) Supply totals 17,385 18,998 19,094 19,191 19,286 Use totals 17,385 18,998 19,094 19,191 19,286 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 18,246 19,939 20,039 20,142 20,241 Use totals 18,246 19,939 20,039 20,142 20,241 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 18,501 20,218 20,320 20,424 20,524 Use totals 18,501 20,218 20,320 20,424 20,524 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 16,248 17,755 17,844 17,936 18,024 Use totals 16,248 17,755 17,844 17,936 18,024 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Supply totals 13,113 14,330 14,402 14,475 14,546 Use totals 13,113 14,330 14,402 14,475 14,546 Surplus/(shortfall) 0 0 0 0 0 WSCP - supply augmentation benefit WSCP - use reduction savings benefit Revised Surplus/(shortfall) Submittal Table 7-4 Retail: Multiple Dry Years Supply and Use Comparison Water Code Section 10635(a) OPTIONAL Planned WSCP Actions Third year Fifth year DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. OPTIONAL Planned WSCP Actions OPTIONAL Planned WSCP Actions OPTIONAL Planned WSCP ActionsFourth year NOTES: First year OPTIONAL WSCP Actions Second year 2026 Total Total Water Use (AF)15,993 Total Supplies (AF)16,399 Surplus/Shortfall w/o WSCP Action 406 WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) Revised Surplus/(shortfall) 2027 Total Total Water Use (AF)17,150 Total Supplies (AF)17,211 Surplus/Shortfall w/o WSCP Action 61 WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF) Revised Surplus/(shortfall) 2028 Total Total Water Use (AF)17,760 Total Supplies (AF)17,452 Surplus/Shortfall w/o WSCP Action (308) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF)308 Revised Surplus/(shortfall) 0 2029 Total Total Water Use (AF)15,922 Total Supplies (AF)15,326 Surplus/Shortfall w/o WSCP Action (596) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF)596 Revised Surplus/(shortfall) 0 2030 Total Total Water Use (AF)13,113 Total Supplies (AF)12,369 Surplus/Shortfall w/o WSCP Action (744) WSCP - supply augmentation benefit (AF) WSCP - use reduction savings benefit (AF)744 Revised Surplus/(shortfall) 0 NOTES: DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Submittal Table 7-5 Retail: Five-Year Drought Risk Assessment Water Code Section 10635(b)(3) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) OPTIONAL Planned WSCP Actions (use reduction and supply augmentation) Standard Shortage Levels Percent Shortage Range Suppliers Shortage Levels Percent Shortage Range 1 Up to 10% 1, 2 Up to 10% 2 Up to 20% 3, 4 Up to 20% 3 Up to 30% 5, 6 Up to 30% 4 Up to 40% 7 Up to 40% 5 Up to 50% 8 Up to 50% 6 >50% 8 50% Submittal Table 8-1: Cross-reference for Standard vs Supplier Shortage Levels Water Code Section 10632(a)(3)(B) Check the box if the Supplier uses the Standard six levels of water shortage. Proceed to the next table. NOTES: Yes Volume or Percentage Drop down Shortage Gap Reduction Value (May be a range) (AF) 1 Transfers Volume 0 Not applicable (see Notes) 2 Transfers Volume 0 Not applicable (see Notes) 3 Transfers Volume 0 Not applicable (see Notes) 4 Transfers Volume 0 Not applicable (see Notes) 5 Transfers Volume 0 Not applicable (see Notes) 6 Transfers Volume 0 Not applicable (see Notes) Submittal Table 8-2 Retail: Supply Augmentation and Other Actions Water Code Section 10632(a)(4)(A),(C) and (E) Add additional rows as needed NOTES: The City will consider increased production from the Main Basin using existing facilities to address increased demands. As noted on Table 8-3, the City plans to implement demand reduction measures in the event water supplies from existing sources are not sufficient to meet anticipated demands. Is the Supplier completing this table using the standard six levels? (yes/no) How much is this going to reduce the shortage gap? DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. Shortage Level Supply Augmentation Methods and Other Actions by Water Supplier Drop down list These are the only categories that will be accepted by the WUEdata online submittal tool Additional Explanation or Reference (OPTIONAL) Yes Volume or Percentage Drop down Shortage Gap Reduction Value (May be a range) (AF) 1 Landscape - Restrict or prohibit runoff from landscape irrigation Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Require automatic shut of hoses Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Landscape - Limit landscape irrigation to specific days Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Pursuant to Resolution No. 7430 adopted by City Council in May 2022, no lawn, landscape, or other turf areas shall be watered or irrigated more than two (2) days per week (on Tuesday and Saturday). Yes 1 Landscape - Limit landscape irrigation to specific times Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF No lawn, landscape, or other turf areas shall be watered or irrigated between the hours of 9:00 a.m. and 6:00 p.m. Pacific time. Yes 1 Landscape - Prohibit certain types of landscape irrigation Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Pursuant to Resolution No. 7430 adopted by City Council in May 2022, an owner of property used primarily for commercial, industrial, or institutional purposes may not irrigate non- functional turf areas. Yes 1 Landscape - Other landscape restriction or prohibition Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF No irrigation during and within 48 hrs of measurable rainfall Yes 1 CII - Lodging establishment must offer opt out of linen service Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 CII - Restaurants may only serve water upon request Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Water Features - Restrict water use for decorative water features, such as fountains Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Customers must repair leaks, breaks, and malfunctions in a timely manner Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 1 Other - Prohibit use of potable water for washing hard surfaces Volume Collective reduction from all Shortage Level 1 actions is up to 1,721 AF Yes 2Other Volume Collective reduction from all Shortage Level 2 actions is up to 3,442 AF All actions under Shortage Level 1 Yes 3Other Volume Collective reduction from all Shortage Level 3 actions is up to 5,163 AF All actions under Shortage Level 2 Yes 4Other Volume Collective reduction from all Shortage Level 4 actions is up to 6,884 AF All actions under Shortage Level 3 Yes 5Other Volume Collective reduction from all Shortage Level 5 actions is up to 8,605 AF All actions under Shortage Level 4 Yes 6Other Volume Collective reduction from all Shortage Level 6 actions is greater than 8,605 AF All actions under Shortage Level 5 Yes Is the Supplier completing this table using the standard six levels? (yes/no) Submittal Table 8-3 Retail: Demand Reduction Actions Water Code Section 10632(a)(4)(B),(D), and (E) Add additional rows as needed How much is this going to reduce the shortage gap? Shortage Level Demand Reduction Actions Drop down list These are the only categories that will be accepted by the WUEdata online submittal tool. Select those that apply. Additional Explanation or Reference (OPTIONAL) NOTES: Penalty, Charge, or Other Enforcement? For Retail Suppliers Only Drop Down List DWR NOTES: Units of measure (AF, CCF, MG) must remain consistent throughout the UWMP as reported in Submittal Table 2-3. City Name 60 Day Notice Drop Down (yes/no) Notice of Public Hearing Drop Down (yes/no) Arcadia Yes Yes Monrovia Yes Yes Sierra Madre Yes Yes Pasadena Yes Yes County Name Drop Down List 60 Day Notice Drop Down (yes/no) Notice of Public Hearing Drop Down (yes/no) Los Angeles County Yes Yes Submittal Table 10-1 Retail: Notification to Cities and Counties Water Code Section 10621(b) and 10642 Add additional rows as needed Add additional rows as needed NOTES: CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX B COMPLETED PLAN CHECKLIST Retail (x = required) Wholesale (x = required ) Order 2025 Guidebook Location Water Code Section Summary as Applies to UWMP Subject Relevant Submittal Table 2025 UWMP Location x x 1 Chapter 1 10615 A plan shall describe and evaluate sources of supply, reasonable and practical efficient uses, reclamation and demand management activities.Introduction and overview n/a Chapter 1 Lay Description x x 1 Chapter 1 10630.5 Each plan shall include a simple description of the Supplier’s plan including water availability, future requirements, a strategy for meeting needs, and other pertinent information. Additionally, a Supplier may also choose to include a simple description at the beginning of each chapter. Plan preparation n/a Beginning of each Chapter x x 2.1 Section 2.1 10620(b) Every person that becomes a Supplier shall adopt UWMP within one year after it has become a Supplier. Plan preparation n/a Section 2.1 x n/a 2.5 Section 2.5 10644 Supplier shall report the Public Water Systems number, volume of delivered water, and number of connections that are included in this UWMP.Plan preparation 2-1 Sections 2.1 and 2.5 x x 2.5 Section 2.5 10644 Supplier shall report if this UWMP is an individual UWMP and whether the Supplier belongs to a regional UWMP or regional alliance.Plan preparation 2-2 Sections 2.2 and 2.5 x x 2.5 Section 2.5 10644 Supplier shall report whether the data is in fiscal or calendar years and the units of measure used for reporting water volumes.Plan preparation 2-3 Sections 2.3 and 2.5 x x 2.4 Section 2.4 10642 Provide supporting documentation that the Supplier has encouraged active involvement of diverse social, cultural, and economic elements of the population within the service area prior to and during the preparation of the plan and contingency plan. Plan preparation n/a Section 2.4 x x 2.4 Section 2.4.2 10620(d)(3) Coordinate the preparation of its plan with other appropriate agencies in the area, including other Suppliers that share a common source, water management agencies, and relevant public agencies, to the extent practicable. Plan preparation n/a Section 2.4.2 x n/a 2.4 Section 2.4.1 10631(h) Retail Suppliers will include documentation that they have provided their Wholesale Supplier(s)—if any—with water use projections from that source.Plan preparation 2-4 R Sections 2.4.1 and 2.5 n/a x 2.4 Section 2.4.1 10631(h) Wholesale Suppliers will provide their Suppliers with identification and quantification of the existing and planned sources of water available from the Wholesale Supplier to the Supplier during various water year types. Plan preparation 2-4 W n/a x x 3 Chapter 3.0 10631(a) Describe the Supplier service area.System description n/a Section 3.1 and 3.2 x x 3.3 Section 3.3 10631(a) Describe the climate of the Supplier’s service area. System description n/a Section 3.3 x x 3.4 Section 3.4.1 10631(a) Provide the current and projected service area populations for 2030, 2035, 2040, 2045 and optionally 2050.System description 3-1 Sections 3.4 and 3.6 x x 3.4 Section 3.4.2 10631(a) Describe other social, economic, and demographic factors affecting the Supplier’s water management planning.System description n/a Section 3.4.2 x x 3.5 Section 3.5 10631(a) Describe the land uses within the service area… include the current and projected land uses within the existing or anticipated service area affecting the Supplier’s water management planning. Describe the land uses within the service area. System description and baselines n/a Section 3.5 x Optional 4.2 Sections 4.2.3 and 4.2.4 10631(d)(1) Quantify past, current, and projected water use, identifying the uses among water use sectors. System water use 4-1 and 4-2 Sections 4.2 and 4.4 x Optional 4.3 Section 4.3.1 10631(d)(3)(A) Report the distribution system water loss for each of the five years preceding the plan update. System water use 4-5 Sections 4.3 and 4.4 x n/a 4.3 Section 4.3.2 10631(d)(3)(C) Retail Suppliers shall provide data to show the distribution loss standards were met. System water use 4-6 Sections 4.3 and 4.4 x n/a 4.2 Section 4.2.5.4 10631.1(a) Include projected water use needed for lower income housing projected in the service area of the Supplier.System water use 4-3 Sections 4.2.5.5 and 4.4 x n/a 4.2 Section 4.2.5.3 10631(d)(4)(A) In projected water use, include estimates of water savings from adopted codes, plans, and other policies or laws.System water use 4-3 Section 4.2.5.3 x n/a 4.2 Section 4.2.5.3 10631(d)(4)(B) Provide citations of codes, standards, ordinances, or plans used to make water use projections. System water use 4-3 Sections 4.2.5.3 and 9.1 x n/a 4.2 Section 4.2.5.3 10631(d)(4)(B)(ii) To the extent that a Supplier reports the information described in subparagraph (A), an urban water Supplier shall… Indicate the extent that the water use projections consider savings from codes, standards, ordinances, or transportation and land use plans. Water use projections that do not account for these water savings shall be noted of that fact. System water use 4-3 Section 4.2.5.3 x x 4.2 Section 4.2.5.6 10635(b) Demands under climate change considerations must be included as part of the drought risk assessment. System water use n/a Section 4.2.5.6 n/a x 5.1 Section 5.1 10608.36 Wholesale Suppliers shall include an assessment of present and proposed future measures, programs, and policies to help their Retail Suppliers achieve targeted water use reductions.Baselines and targets n/a n/a x n/a 5.2 Section 5.2 10608.4 Retail Suppliers shall report on their compliance in meeting their water use targets. Reporting requirements will vary depending on whether the Supplier: - Was considered an urban retail water supplier in 2020, - Met its 2020 target in 2020, or - Was part of a merger or consolidation since 2020. Chapter 5 Subsections 5.2.1, 5.2.2, and 5.2.3 address each of these situations. Baselines and targets 5-1 Sections 5.2 and 5.3 x x 6.1 Section 6.1 10631(b)(2) When multiple sources of water supply are identified, describe the management of each supply in relationship to other identified supplies.System supplies n/a Sections 6.1 and 6.2 x x 6.1 Sections 6.1 and 6.2 10631(b)(1) Provide a discussion of anticipated supply availability under a normal, single dry year, and a drought lasting five years, as well as more frequent and severe periods of drought, including changes in supply due to climate change. System supplies n/a Sections 6.1, 6.2, 7.1, and 7.2 x x 6.2 Section 6.2.2 10631(b)(4)(C) Indicate whether groundwater is an existing or planned source of water available to the Supplier. If groundwater is identified as an existing or planned source of water… (include) a detailed description and analysis of the location, amount and sufficiency of groundwater pumped by the Supplier for the past five years. Water supplies and recycled water 6-1 Sections 6.2.2 and 6.4 x x 6.2 Section 6.2.2 10631(b)(4)(A) Indicate whether a groundwater sustainability plan or groundwater management plan has been adopted by the Supplier or if there is any other specific authorization for groundwater management. Include a copy of the plan or authorization. System supplies n/a Section 6.2.2 x x 6.2 Section 6.2.2 10631(b)(4)(B) Describe the groundwater basin.System supplies n/a Section 6.2.2 x x 6.2 Section 6.2.2 10631(b)(4)(B) Indicate if the basin has been adjudicated and include a copy of the court order or decree and a description of the amount of water the Supplier has the legal right to pump.System supplies n/a Section 6.2.2 x x 6.2 Section 6.2.2 10631(b)(4)(B) For unadjudicated basins… (include) information as to whether DWR has identified the basin as a high- or medium-priority basin in the most current official departmental bulletin… Water supplies and recycled water n/a Section 6.2.2 x x 6.2 Section 6.2.2 10631(b)(4)(B) For unadjudicated basins… describe efforts by the Supplier to coordinate with sustainability or groundwater agencies to achieve sustainable groundwater conditions. Water supplies and recycled water n/a Section 6.2.2 x x 6.2 Section 6.2.2. 10631(b)(4)(C) If groundwater is identified as an existing or planned source of water… (include) a detailed description and analysis of the location, amount and sufficiency of groundwater pumped by the Supplier for the past five years. System supplies n/a Section 6.2.2 x x 6.2 Section 6.2.2 10631(b)(4)(D) Provide a detailed description and analysis of the amount and location of groundwater that is projected to be pumped.System supplies 6-9 Section 6.2.2 x x 6.1 Section 6.1 10631(b) Identify and quantify the existing and planned sources of water available for 2025, 2030, 2035, 2040, 2045 and optionally 2050.System supplies 6-8 and 6-9 Section 6.4 x x 6.2 Section 6.2.7 10631(c) Describe the opportunities for exchanges or transfers of water on a short-term or long-term basis. System supplies n/a Section 6.2.7 x n/a 6.2 Section 6.2.5 10633(a) Describe the wastewater collection and treatment systems in the Supplier’s service area with quantified amount of collection and treatment and the disposal methods. System supplies (recycled water)6-2 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(b) Describe the quantity of treated wastewater that meets recycled water standards, is being discharged, and is otherwise available for use in a recycled water project. System supplies (recycled water)6-3 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(c) Describe the recycled water currently being used in the Supplier's service area. System supplies (recycled water)6-4 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(d) Describe and quantify the potential uses of recycled water and provide a determination of the technical and economic feasibility of those uses. System supplies (recycled water)6-4 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(e) Describe the projected use of recycled water within the Supplier's service area at the end of 5, 10, 15, and 20 years, and describe the actual use of recycled water in comparison to uses previously projected. System supplies (recycled water)6-4 and 6-5 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(f) Describe the actions that may be taken to encourage the use of recycled water and the projected results of these actions in terms of acre-feet of recycled water used per year. System supplies (recycled water)6-6 Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.5 10633(g) Provide a plan for optimizing the use of recycled water in the Supplier's service area. System supplies (recycled water)n/a Sections 6.2.5 and 6.4 x x 6.2 Section 6.2.6 10631(g) Describe desalinated water project opportunities for long-term supply. System supplies 6-7 Section 6.2.6 x x 6.2 Section 6.2.10 10631(f) Describe the expected future water supply projects and programs that may be undertaken by the water Supplier to address water supply reliability in average, single-dry, and for a period of drought lasting five consecutive water years. System supplies 6-7 Sections 6.2.10 and 6.4 x x 6.3 Section 6.3 and Appendix O 10631.2(a) The UWMP must include energy information, as stated in the code, that a Supplier can readily obtain.System suppliers, energy intensity O-1A, O-1B, O-1C, and O-2 Section 6.3 x 7.1 Section 7.1 10634 Provide information on the quality of existing sources of water available to the Supplier and the manner in which water quality affects water management strategies and supply reliability. Water supply reliability assessment n/a Section 7.2 x x 7.2 Section 7.2 10635(a) Service Reliability Assessment: Assess the water supply reliability during normal, dry, and a drought lasting five consecutive water years by comparing the total water supply sources available to the Supplier with the total projected water use over the next 20 years. Water supply reliability assessment 7-2, 7-3, and 7-4 Sections 7.3 and 7.4 x x 7.2 Section 7.2.3 10620(f) Describe water management tools and options to maximize resources and minimize the need to import water from other regions. Water supply reliability assessment n/a Section 7.2.3 x x 7.3 Section 7.3 10635(b) Provide a drought risk assessment as part of information considered in developing the demand management measures and water supply projects. Water supply reliability assessment n/a Section 7.3 x x 7.3 Section 7.3 10635(b)(1) Include a description of the data, methodology, and basis for one or more supply shortage conditions that are necessary to conduct a drought risk assessment for a drought period that lasts five consecutive years. Water supply reliability assessment n/a Section 7.3 x x 7.3 Section 7.3 10635(b)(2) Include a determination of the reliability of each source of supply under a variety of water shortage conditions. Water supply reliability assessment n/a Section 7.3 x x 7.3 Section 7.3 10635(b)(3) Include a comparison of the total water supply sources available to the Supplier with the total projected water use for the drought period. Water supply reliability assessment 7-5 Section 7.3 x x 7.3 Section 7.3 10635(b)(4) Include considerations of the historical drought hydrology, plausible changes on projected supplies and demands under climate change conditions, anticipated regulatory changes, and other locally applicable criteria. Water supply reliability assessment n/a Section 7.3 x x 8 Chapter 8 10632(a) Provide a water shortage contingency plan (WSCP) with specified elements below. Water shortage contingency planning n/a Chapter 8 x x 8 Chapter 8 10632(a)(1) Provide an analysis of water supply reliability (from Guidebook Chapter 7) in the WSCP. Water shortage contingency planning n/a Chapter 8 x x 8.2 Section 8.2 10632(a)(2)(A) Provide the written decision-making process and other methods that the Supplier will use each year to determine its water reliability. Water shortage contingency planning n/a Section 8.2 x x 8.2 Section 8.2 10632(a)(2)(B) Provide data and methodology to evaluate the Supplier’s water reliability for the current year and one dry year pursuant to factors in the code. Water shortage contingency planning n/a Section 8.2 x x 8.3 Section 8.3 10632(a)(3)(A) Define six standard water shortage levels of 10%, 20%, 30%, 40%, 50% shortage, and greater than 50% shortage. These levels shall be based on supply conditions, including percent reductions in supply, changes in groundwater levels, changes in surface elevation, or other conditions. The shortage levels shall also apply to a catastrophic interruption of supply. Water shortage contingency planning n/a Section 8.3 x x 8.3 Section 8.3 10632(a)(3)(B) Suppliers with an existing WSCP that uses different water shortage levels must cross reference their categories with the six standard categories. Water shortage contingency planning 8-1 Sections 8.3 and 8.14 x x 8.4 Section 8.4 10632(a)(4)(A) Suppliers with WSCPs that align with the defined shortage levels must specify locally appropriate supply augmentation actions. Water shortage contingency planning 8-2 Sections 8.4.1 and 8.14 x x 8.4 Section 8.4 10632(a)(4)(B) Specify locally appropriate demand reduction actions to adequately respond to shortages. Water shortage contingency planning 8-3 Sections 8.4.2 and 8.14 x x 8.4 Section 8.4 10632(a)(4)(C) Specify locally appropriate operational changes. Water shortage contingency planning 8-2 Section 8.4.3 x x 8.4 Section 8.4 10632(a)(4)(D) Specify additional mandatory prohibitions against specific water use practices that are in addition to State- mandated prohibitions are appropriate to local conditions. Water shortage contingency planning Table 8-3 Section 8.4.4 x x 8.4 Section 8.4 10632(a)(4)(E) Estimate the extent to which the gap between supplies and demand will be reduced by implementation of the action. Water shortage contingency planning 8-2 and 8-3 Sections 8.4.7 and 8.14 x x 8.4 Section 8.4.6 10632.5 The UWMP shall include a seismic risk assessment and mitigation plan. Water shortage contingency plan n/a Section 8.4.6 x x 8.5 Section 8.5 10632(a)(5)(A) Suppliers must describe that they will inform customers, the public and others regarding any current or predicted water shortages. Water shortage contingency planning n/a Section 8.5 x x 8.5 Section 8.5 10632(a)(5)(B), 10632(a)(5)(C) Suppliers must describe that they will inform customers, the public and others regarding any shortage response actions triggered or anticipated to be triggered and other relevant communications. Water shortage contingency planning n/a Section 8.5 x n/a 8.6 Section 8.6 10632(a)(6) Retail Supplier must describe how it will ensure compliance with and enforce provisions of the WSCP.Water shortage contingency planning n/a Section 8.6 x x 8.7 Section 8.7 10632(a)(7)(A) Describe the legal authority that empowers the Supplier to enforce shortage response actions. Water shortage contingency planning n/a Section 8.7 x x 8.7 Section 8.7 10632(a)(7)(B) Provide a statement that the Supplier will declare a water shortage emergency per Water Code Chapter 3. Water Shortage Emergencies . Water shortage contingency planning n/a Section 8.7 x x 8.7 Section 8.7 10632(a)(7)(C) Provide a statement that the Supplier will coordinate with any city or county within which it provides water for the possible proclamation of a local emergency. Water shortage contingency planning n/a Section 8.7 x x 8.8 Section 8.8 10632(a)(8)(A) Describe the potential revenue reductions and expense increases associated with activated shortage response actions. Water shortage contingency planning n/a Section 8.8 x x 8.8 Section 8.8 10632(a)(8)(B) Provide a description of mitigation actions needed to address revenue reductions and expense increases associated with activated shortage response actions. Water shortage contingency planning n/a Section 8.8 x n/a 8.8 Section 8.8 10632(a)(8)(C) Retail Suppliers must describe the cost of compliance with Water Code Chapter 3.3, Excessive Residential Water Use During Drought . Water shortage contingency planning n/a Section 8.8 x n/a 8.9 Section 8.9 10632(a)(9) Retail Suppliers must describe the monitoring and reporting requirements and procedures that ensure appropriate data are collected, tracked, and analyzed for purposes of monitoring customer compliance. Water shortage contingency planning n/a Section 8.9 x x 8.10 Section 8.10 10632(a)(10) Describe reevaluation and improvement procedures for monitoring and evaluation the WSCP to ensure risk tolerance is adequate and appropriate water shortage mitigation strategies are implemented. Water shortage contingency planning n/a Section 8.10 x n/a 8.11 Section 8.11 10632(b) Analyze and define water features that are artificially supplied with water, including ponds, lakes, waterfalls, and fountains, separately from swimming pools and spas. Water shortage contingency planning n/a Section 8.11 x x 8.12 Section 8.12 10632(c) Make available the WSCP to customers and any city or county where it provides water within 30 days after adoption of the plan. Water shortage contingency planning n/a Sections 8.12 and 10.6 x n/a 9.1 Sections 9.1 10631(e)(1) Retail Suppliers shall provide a description of the nature and extent of each demand management measure implemented over the past five years. The description will address specific measures listed in code. Demand management measures n/a Section 9.1.1 n/a x 9.2 Sections 9.2 10631(e)(2) Wholesale Suppliers shall describe specific demand management measures listed in code, their distribution system asset management program, and Supplier assistance program. Demand management measures n/a n/a x n/a 10 Chapter 10 10608.26(a) Retail Suppliers shall conduct a public hearing to discuss adoption, implementation, and economic impact of water use targets (recommended to discuss compliance). Plan adoption, submittal, and implementation n/a Sections 10.3 and 10.4 x x 10.2 Section 10.2.1 10621(b) Notify, at least 60 days prior to the public hearing, any city or county within which the Supplier provides water that the Supplier will be reviewing the UWMP and considering amendments or changes to the plan. Plan adoption, submittal, and implementation 10-1 Section 10.2 x x 10.4 Section 10.4 10621(f) Each urban water Supplier shall update and submit its 2025 plan to DWR by July 1, 202 6.Plan adoption, submittal, and implementation n/a Section 10.5 x x 10.2 Sections 10.2.2, 10.3, and 10.5 10642 Provide supporting documentation that the Supplier made the UWMP and WSCP available for public inspection, published notice of the public hearing, and held a public hearing about the UWMP and WSCP. Plan adoption, submittal, and implementation n/a Sections 10.2, 10.3, and 10.4 x x 10.2 Section 10.2.2 10642 The Supplier is to provide the time and place of the hearing to any city or county within which the Supplier provides water. Plan adoption, submittal, and implementation 10-1 Section 10.3 x x 10.3 Section 10.3.2 10642 Provide supporting documentation that the UWMP and WSCP has been adopted as prepared or modified. Plan adoption, submittal, and implementation n/a Sections 10.4 and 10.9 x x 10.4 Section 10.4 10644(a) Provide supporting documentation that the Supplier has submitted their UWMP to the California State Library. Plan adoption, submittal, and implementation n/a Section 10.5.3 x x 10.4 Section 10.4 10644(a)(1) Provide supporting documentation that the Supplier has submitted their UWMP to any city or county within which the Supplier provides water no later than 30 days after adoption. Plan adoption, submittal, and implementation n/a Section 10.5.4 x x 10.4 Sections 10.4.1 and 10.4.2 10644(a)(2) The UWMP, or amendments to the UWMP, submitted to DWR shall be submitted electronically.Plan adoption, submittal, and implementation n/a Sections 10.5 and 10.9 x x 10.7 Section 10.7.2 10644(b) If revised, submit a copy of the WSCP to DWR within 30 days of adoption. Plan adoption, submittal, and implementation n/a Section 10.9 x x 10.5 Section 10.5 10645(a) Provide supporting documentation that, not later than 30 days after filing a copy of its UWMP with DWR, the Supplier has or will make the plan available for public review during normal business hours. Plan adoption, submittal, and implementation n/a Section 10.6 x x 10.5 Section 10.5 10645(b) Provide supporting documentation that, not later than 30 days after filing a copy of its WSCP with DWR, the Supplier has or will make the plan available for public review during normal business hours. Plan adoption, submittal, and implementation n/a Section 10.6 x x 10.6 Section 10.6 10621(c) If Supplier is regulated by the Public Utilities Commission, include its plan and contingency plan as part of its general rate case filings. Plan adoption, submittal, and implementation n/a Section 10.7 CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX C DEMONSTRATION OF REDUCED IMPORTED WATER RELIANCE DEMONSTRATION OF CONSISTENCY WITH THE DELTA PLAN FOR PARTICIPANTS IN COVERED ACTIONS (2015 THROUGH 2050) CITY OF ARCADIA Introduction Pursuant to the California Department of Water Resources (DWR), an urban water supplier that anticipates participating in or receiving water from a proposed project (or “covered action”) such as a multi-year water transfer, conveyance facility, or new diversion that involves transferring water through, exporting water from, or using water in the Sacramento-San Joaquin Delta (Delta) should provide information in their 2015, 2020, 2025 Urban Water Management Plans (UWMPs) for use in demonstrating consistency with Delta Plan Policy WR P1, “Reduce Reliance on the Delta Through Improved Regional Water Self-Reliance”. In addition, pursuant to California Code of Regulations, Title 23, § 5003: (c)(1) Water suppliers that have done all of the following are contributing to reduced reliance on the Delta and improved regional self-reliance and are therefore consistent with this policy: (A) Completed a current Urban or Agricultural Water Management Plan (Plan) which has been reviewed by the California Department of Water Resources for compliance with the applicable requirements of Water Code Division 6, Parts 2.55, 2.6, and 2.8; (B) Identified, evaluated, and commenced implementation, consistent with the implementation schedule set forth in the Plan, of all programs and projects included in the Plan that are locally cost effective and technically feasible which reduce reliance on the Delta; and (C) Included in the Plan, commencing in 2015, the expected outcome for measurable reduction in Delta reliance and improvement in regional self-reliance. The expected outcome for measurable reduction in Delta reliance and improvement in regional self-reliance shall be reported in the Plan as the reduction in the amount of water used, or in the percentage of water used, from the Delta watershed. For the purposes of reporting, water efficiency is considered a new source of water supply, consistent with Water Code section 1011(a). The City is member agency of the Upper San Gabriel Valley Water District, which in turn is a member agency of the Metropolitan Water District of Southern California (MWD). As noted in MWD’s document entitled “Infeasibility of Accounting Supplies from the Delta Watershed for Metropolitan’s Member Agencies and their Customers” (which is included in MWD’s 2025 Regional UWMP, Appendix 10 (provided as Attachment 1 below), “... Metropolitan and its members as well as their customers are measurably reducing reliance on the Delta and improving regional self-reliance, both as an amount of water used and as a percentage of water used.” In addition, MWD’s 2025 Regional UWMP indicates “...in accordance with UMWP requirements, Metropolitan’s member agencies and their customers (many of them, retail agencies) also report demands and supplies for their service areas in their respective UWMPs. The data reported by those agencies are not additive to the regional totals shown in Metropolitan’s UWMP; rather, their reporting represents subtotals of the regional total and should be considered as such for the purposes of determining reduced reliance on the Delta…While the demands that Metropolitan’s member agencies and their customers report in their UWMPs are a good reflection of the demands in their respective service areas, they do not adequately represent each water supplier’s contributions to reduced reliance on the Delta. In order to calculate and report their reliance on water supplies from the Delta watershed, water suppliers that receive water from the Delta through other regional or wholesale water suppliers would need to determine the amount of Delta water that they receive from the regional or wholesale supplier. Two specific pieces of information are needed to accomplish this: first is the quantity of demands on the regional or wholesale water supplier that accurately reflect a supplier’s contributions to reduced reliance on the Delta, and second is the quantity of a supplier’s demands on the regional or wholesale water supplier that are met by supplies from the Delta watershed…For water suppliers that make investments in regional projects or programs it may be infeasible to quantify their demands on the regional or wholesale water supplier in a way that accurately reflects their individual contributions to reduced reliance on the Delta.” Nonetheless, the City has taken proactive measures to help reduce regional reliance on imported water supplies and is discussed in the following sections. Reduced Reliance Calculation Tables Pursuant to DWR guidance, Tables C-1 through C-4 were prepared to show the potential reduction of reliance on imported water supplies for the City. The City has used these tables to demonstrate its reduced regional reliance on imported water supplies, but not specifically Delta Watershed supplies. For each of the tables, a “Baseline year” was selected. Water demands during subsequent years (from 2015 through 2050 in five-year increments) were compared to water demands during the Baseline year. Table C-1 considers the population and service area water demands, and a demand in gallons per capita per day (GPCD) water use rate was calculated for each of the years following the Baseline year. The calculated reduction in GPCD from the Baseline year was then translated to an estimated amount of water saved as a result of water conservation measures. Table C-2 references the estimated amount of water saved from Table C-1 and shows the City’s water demand without water use efficiency in effect. A method of showing reduced regional reliance on imported water supplies is to show increased regional self-reliance. Table C-3 lists water supply sources that contribute to regional self-reliance, including water use efficiency (from Table C-1 and C-2) and groundwater recharge activities. Regional self-reliance is expressed both in terms of acre feet (AF) and as a percentage. The calculation of reduced regional reliance on imported water supplies is shown on Table C-4. Table C-4 also shows the percent change in imported water supplies relative to the City’s total supply. A negative percent change of imported water supplies indicates the City has reduced regional reliance on imported water supplies. Since the Baseline year, the City has decreased its reliance on imported water supplies in 2015, 2020, 2025, and anticipates doing so through 2050. The City has reduced regional reliance on imported water supplies through the following: x The demand in GPCD for the "Baseline year" was compared to the GPCDs in subsequent years (from 2015 through 2050, in five-year increments). The reduced GPCD multiplied by the population in these subsequent years is indicative of the potential reduced regional reliance on imported water supplies and is included in Table C-1. x To the extent the Main Basin Watermaster has, or plans to, use recycled water to replenish the Main Basin, the City’s proportional share (up to the total replenishment water obligation) will be included in Table C-1. These categories of reduced regional reliance on imported water supplies are discussed below. The sum of the increased regional self-reliance and the sum of the reduced regional reliance on imported water demand resulting from these categories is reflected on Table C-3 and Table C-4, respectively, and is reflective of the City’s overall reduced reliance. Reduced GPCD Section 6.2.2 of the City’s 2025 UWMP describes the management of the Main Basin. The City relies on groundwater produced from the Main Basin, which is adjudicated and managed by the Main Basin Watermaster. To the extent the City historically (baseline during 2011) has produced groundwater in excess of its water rights, it has paid assessments to the Main Basin Watermaster which are then used to purchase untreated imported water from the Upper San Gabriel Valley Municipal Water District (Upper Water), which is in turn purchased water from the Metropolitan Water District of Southern California. The untreated imported water subsequently is delivered to replenish the Main Basin and to supplement local storm water replenishment. In addition, the City can purchase treated imported water from Upper Water which is ultimately provided by the Metropolitan Water District of Southern California. Chapter 9 of this 2025 UWMP describes the Demand Management Measures which the City has implemented to reduce the amount water used by its customers. In addition, Chapter 6 of the 2025 UWMP describes the groundwater basin management measures implemented by the Main Basin Watermaster. Collectively these actions translate to a reduction in the GPCD usage rate which is described further in Chapter 5 of the 2025 UWMP. These actions directly impact total water demands, and consequently, the quantity of imported water which may be required. Absent the proactive measures taken by the City, it is anticipated there may have been a greater demand on imported water supplies. Pursuant to DWR guidance, reduced reliance on imported water supplies can be demonstrated by first selecting a “Baseline” water demand, represented by total potable water demands during 2011. Table C-1 summarizes the “Baseline” water usage by the City in 2011 (assuming demand reduction efforts had not been implemented); actual water usage in 2015, 2020, and 2025; and projected water usage through 2050 in five- year increments. Furthermore, it is assumed that as of 2011 the City was already exceeding its water rights and was required to fund the purchase of untreated imported water. Table C-2 demonstrates that, if water conservation measures had not been implemented by the City, there may have been a greater reliance on untreated imported water supplies during subsequent years as compared to the Baseline year. However, as discussed below and shown in Table C-1, the reduced water demands have resulted in reduced regional reliance on imported water supplies as compared to the Baseline year. The City’s potable water demand during 2011, along with the corresponding service area population, were used to determine the Baseline GPCD. Subsequently, the actual demands for 2015, 2020, and 2025 were compared to the calculated population to obtain the recent GPCD which includes the water conservations measures which have been implemented (those demand management measures are described in Chapter 9 of the 2025 UWMP). The “Water Supplies Contributing to Regional Self-Reliance" are also provided in Table C-3. The differences between the Baseline GPCD and the 2015, 2020, 2025 GPCDs are effectively considered a demonstration of the reduced regional reliance on imported water supplies with the understanding that any potential increased demand by the City resulting from increased population could have been required from imported water supplies, absent the City’s new water supplies which contribute to self-reliance. A similar methodology is used for the projected potable water demands (2025 UWMP Table 4-2) and populations (2025 UWMP Table 3-1). Recycled Water for Groundwater Replenishment In addition to the historical actions the City has taken in conjunction with groundwater management agencies, the City is involved in a regional program to deliver recycled water to the San Gabriel Valley to replenish the Main San Gabriel Basin. The Metropolitan Water District of Southern California is developing its “Regional Recycled Water Program” (RRWP). MWD is partnering with the Los Angeles County Sanitation Districts (LACSD) to investigate the viability of providing up to 150 million gallons per day (MGD) (approximately 168,000 AFY) of advanced treated wastewater from LACSD’s Joint Water Pollution Control Plant located in Carson, California (Carson Plant). The RRWP would deliver purified water from the Carson Plant through up to 60 miles of transmission pipelines to groundwater basins within MWD’s service area, including the Main Basin. The purified water would be used in various locations within MWD’s service area for groundwater recharge, groundwater storage, and industrial facilities. In addition, purified water could potentially be treated further at two of MWD’s existing water treatment plants for direct potable reuse. The locations of the proposed pipeline alignments are provided in the figure below. Regional Recycled Water Program Location Source: https://www.mwdh2o.com/building-local-supplies/pure-water-southern-california/ MWD began construction of a $17 million small-scale demonstration plant (0.5 MGD) in late 2017 which was completed in October 2019. The results of the demonstration plant will allow MWD and others to determine whether expansion to a full-scale plant is beneficial. Once approved the full-scale plant, associated pipelines and ancillary facilities would take approximately 11 years to construct at an estimated cost of over $3 billion. Pursuant to MWD’s “Regional Recycled Water Program Conceptual Planning Studies Report”, February 2019, the proposed Pure Water project would potentially provide 60,000 to 80,000 AFY to replenish the Main Basin. A portion of the replenished recycled water may be designated as Replacement Water (see Section 6.2.2 of the 2025 UWMP) and will offset all State Water Project water (on an AF for AF basis) which historically has been used to replenish the Main Basin groundwater supplies and is essential to sound basin management. Furthermore, some of the replenished recycled water may be used for general Basin benefit which will result in higher groundwater levels and potentially enable the Operating Safe Yield to be established at a higher amount than had no deliveries occurred. For the Main Basin, MWD has entered into a letter of intent with Upper Water for at least 35,000 AFY and with Three Valleys District for at least 6,500 AFY, and will potentially provide up to 60,000 to 80,000 AFY, collectively. For the purposes of this Plan and to illustrate the anticipated benefits the Pure Water project will have for reduced regional reliance on imported water supplies, it is assumed 20,000 AFY from the Pure Water project will be replenished in the Main Basin commencing in the year 2035 and up to 40,000 AFY will be replenished commencing in the year 2040 and thereafter. The recharged water hypothetically assigned to the City is based on projected groundwater use less the City’s share of the Main Basin's current Operating Safe Yield (150,000 AFY). The balance is production in excess of water rights and subject to replenishment; 50 percent of that amount is assumed to be delivered from the Pure Water project in 2035 and 100 percent in 2040 and thereafter. Because all SWP water deliveries will be offset through the Pure Water project, Table C-3 includes 50 percent of the City’s Replacement Water requirement in 2035 (under Advanced Water Technologies) and all of the Replacement Water requirement in 2040 and thereafter. The decrease in GPCD compared to the Baseline year has resulted in an overall decrease in reliance on water supplies from imported water supplies. As shown in Table C-4, the percentage of water supplies from imported water supplies relative to the City’s total supply has decreased, and is projected to decrease, from the percentage in the Baseline year. Metropolitan Water District of Southern California In addition, as the wholesale provider, the Metropolitan Water District of Southern California has included a detailed discussion regarding measurable reduction in Delta reliance in Appendix 10 of its 2025 Regional Urban Water Management Plan. That discussion is included by reference and also included in Attachment 1 of this Plan. Table C-1: Optional Calculation of Water Use Efficiency -To be completed if Water Supplier does not specifically estimate Water Use Efficiency as a supply Service Area Water Use Efficiency Demands (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Service Area Water Demands with Water Use Efficiency Accounted For 16,399 12,369 13,935 13,294 14,773 16,144 16,225 16,308 16,388 Non-Potable Water Demands Potable Service Area Demands with Water Use Efficiency Accounted For 16,399 12,369 13,935 13,294 14,773 16,144 16,225 16,308 16,388 Total Service Area Population Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Service Area Population 54,000 55,342 53,998 54,700 60,303 65,903 66,233 66,564 66,897 Water Use Efficiency Since Baseline (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Per Capita Water Use (GPCD)271 200 230 217 219 219 219 219 219 Change in Per Capita Water Use from Baseline (GPCD) (72) (41) (54) (52) (52) (52) (52) (52) Estimated Water Use Efficiency Since Baseline 4,438 2,463 3,318 3,540 3,870 3,889 3,906 3,927 Table C-2: Calculation of Service Area Water Demands Without Water Use Efficiency Total Service Area Water Demands (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Service Area Water Demands with Water Use Efficiency Accounted For 16,399 12,369 13,935 13,294 14,773 16,144 16,225 16,308 16,388 Reported Water Use Efficiency or Estimated Water Use Efficiency Since Baseline 4,438 2,463 3,318 3,540 3,870 3,889 3,906 3,927 Service Area Water Demands without Water Use Efficiency Accounted For 16,399 16,806 16,398 16,611 18,313 20,014 20,114 20,214 20,315 Table C-3: Calculation of Supplies Contributing to Regional Self-Reliance Water Supplies Contributing to Regional Self-Reliance (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Water Use Efficiency - 4,438 2,463 3,318 3,540 3,870 3,889 3,906 3,927 Water Recycling Stormwater Capture and Use Advanced Water Technologies (Pure Water - Main Basin)1 - - - - - 3,349 6,779 6,862 6,942 Conjunctive Use Projects Local and Regional Water Supply and Storage Projects Other Programs and Projects the Contribute to Regional Self-Reliance Water Supplies Contributing to Regional Self-Reliance - 4,438 2,463 3,318 3,540 7,218 10,667 10,768 10,869 Service Area Water Demands without Water Use Efficiency (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Service Area Water Demands without Water Use Efficiency Accounted For 16,399 16,806 16,398 16,611 18,313 20,014 20,114 20,214 20,315 Change in Regional Self Reliance (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Water Supplies Contributing to Regional Self-Reliance - 4,438 2,463 3,318 3,540 7,218 10,667 10,768 10,869 Change in Water Supplies Contributing to Regional Self-Reliance 4,438 2,463 3,318 3,540 7,218 10,667 10,768 10,869 Percent Change in Regional Self Reliance (As Percent of Demand w/out WUE) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Percent of Water Supplies Contributing to Regional Self-Reliance 0.0% 26.4% 15.0% 20.0% 19.3% 36.1% 53.0% 53.3% 53.5% Change in Percent of Water Supplies Contributing to Regional Self-Reliance 26.4% 15.0% 20.0% 19.3% 36.1% 53.0% 53.3% 53.5% Table C-4: Calculation of Reliance on Water Supplies from the Delta Watershed Water Supplies from the Delta Watershed (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) CVP/SWP Contract Supplies Delta/Delta Tributary Diversions Transfers and Exchanges Other Water Supplies from the Delta Watershed (Untreated)2 5,369 3,114 5,216 4,008 5,327 3,349 - - - Total Water Supplies from the Delta Watershed 5,369 3,114 5,216 4,008 5,327 3,349 - - - Service Area Water Demands without Water Use Efficiency (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Service Area Water Demands without Water Use Efficiency Accounted For 16,399 16,806 16,398 16,611 18,313 20,014 20,114 20,214 20,315 Change in Supplies from the Delta Watershed (Acre-Feet) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Water Supplies from the Delta Watershed 5,369 3,114 5,216 4,008 5,327 3,349 - - - Change in Water Supplies from the Delta Watershed (2,255) (153) (1,361) (43) (2,020) (5,369) (5,369) (5,369) Percent Change in Supplies from the Delta Watershed (As a Percent of Demand w/out WUE) Baseline (2011)2015 2020 2025 2030 2035 2040 2045 2050 (Optional) Percent of Water Supplies from the Delta Watershed 32.7% 18.5% 31.8% 24.1% 29.1% 16.7% 0.0% 0.0% 0.0% Change in Percent of Water Supplies from the Delta Watershed -14.2% -0.9% -8.6% -3.7% -16.0% -32.7% -32.7% -32.7% 1 2 The Pure Water Southern California Project is anticipated to meet all of the City's water replenishment obligations in the Main Basin. Based on the City's production less the City's share (4.23099%) of the Main Basin's Operating Safe Yield (150,000 AFY). It is assumed that 50% of the recharged water will be available in 2035 before Pure Water is fully operational in 2040. Represents imported untreated water to satisfy replenishment obligations due to Main Basin overproduction. Based on the City's production less water available to the City from Pure Water and less the City's share (4.23099%) of the Operating Safe Yield (150,000 AFY). Appendix 10 QUANTIFYING REGIONAL SELF-RELIANCE AND REDUCED RELIANCE ON WATER SUPPLIES FROM THE DELTA WATERSHED $WWDFKPHQW Metropolitan’s Reduced Delta Reliance Reporting A.10-1 Appendix 10 METROPOLITAN’S REDUCED DELTA RELIANCE REPORTING A.10.1 Background Under the Sacramento-San Joaquin Delta Reform Act of 2009, state and local public agencies proposing a covered action in the Delta,1 prior to initiating the implementation of that action, must prepare a written certification of consistency with detailed findings as to whether the covered action is consistent with applicable Delta Plan policies and submit that certification to the Delta Stewardship Council.2 Anyone may appeal a certification of consistency, and if the Delta Stewardship Council grants the appeal, the covered action may not be implemented until the agency proposing the covered action submits a revised certification of consistency, and either no appeal is filed, or the Delta Stewardship Council denies the subsequent appeal.3 An urban water supplier that anticipates participating in or receiving water from a proposed covered action such as a multi-year water transfer, conveyance facility, or new diversion that involves transferring water through, exporting water from, or using water in the Delta should provide information in their 2015 and subsequent Urban Water Management Plans (UWMPs) that can then be used in the covered action process to demonstrate consistency with Delta Plan Policy WR P1, Reduce Reliance on the Delta Through Improved Regional Water Self-Reliance (WR P1).4 WR P1 details what is needed for a covered action to demonstrate consistency with reduced reliance on the Delta and improved regional self-reliance. WR P1 subsection (a) states that: (a) Water shall not be exported from, transferred through, or used in the Delta if all of the following apply: (1) One or more water suppliers that would receive water as a result of the export, transfer, or use have failed to adequately contribute to reduced reliance on the Delta and improved regional self-reliance consistent with all of the requirements listed in paragraph (1) of subsection (c); (2) That failure has significantly caused the need for the export, transfer, or use; and (3) The export, transfer, or use would have a significant adverse environmental impact in the Delta. WR P1 subsection (c)(1) further defines what adequately contributing to reduced reliance on the Delta means in terms of (a)(1) above. 1 Water Code, § 85057.5; Cal. Code Regs. tit. 23, § 5001. 2 Water Code, § 85225; Delta Plan, App. D. 3 Water Code, §§ 85225.10-85225.25; Delta Plan, App. D. 4 Cal. Code Regs., tit. 23, § 5003. A.10-2 Metropolitan’s Reduced Delta Reliance Reporting (c)(1) Water suppliers that have done all the following are contributing to reduced reliance on the Delta and improved regional self-reliance and are therefore consistent with this policy: (A) Completed a current Urban or Agricultural Water Management Plan (Plan) which has been reviewed by the California Department of Water Resources for compliance with the applicable requirements of Water Code Division 6, Parts 2.55, 2.6, and 2.8; (B) Identified, evaluated, and commenced implementation, consistent with the implementation schedule set forth in the Plan, of all programs and projects included in the Plan that are locally cost effective and technically feasible which reduce reliance on the Delta; and (C) Included in the Plan, commencing in 2015, the expected outcome for measurable reduction in Delta reliance and improvement in regional self- reliance. The expected outcome for measurable reduction in Delta reliance and improvement in regional self-reliance shall be reported in the Plan as the reduction in the amount of water used, or in the percentage of water used, from the Delta watershed. For the purposes of reporting, water efficiency is considered a new source of water supply, consistent with Water Code section 1011(a). The analysis and documentation provided below include all of the elements described in WR P1(c)(1) that need to be included in a water supplier’s UWMP to support a certification of consistency for a future covered action. A.10.2 Summary of Expected Outcomes for Reduced Reliance on the Delta As stated in WR P1(c)(1)(C), the policy requires that, commencing in 2015, UWMPs include expected outcomes for measurable reduction in Delta reliance and improved regional self-reliance. WR P1 further states that those outcomes shall be reported in the UWMP as the reduction in the amount of water used, or in the percentage of water used, from the Delta. The expected outcomes for Metropolitan’s Delta reliance and regional self-reliance were developed using the approach and guidance described in Appendix C of DWR’s Urban Water Management Plan Guidebook 2025 (Guidebook Appendix C) issued in 2025. The data used in this analysis represent the total regional efforts of Metropolitan and its member agencies and their customers (many of them, retail agencies) and were developed in conjunction with Metropolitan’s member agencies as part of the UWMP coordination process as described in Chapter 5 of Metropolitan’s UWMP. In accordance with UWMP requirements, Metropolitan’s member agencies and their customers (many of them, retail agencies) also report demands and supplies for their service areas in their respective UWMPs. The data reported by those agencies are not additive to the regional totals shown in Metropolitan’s UWMP; rather, their reporting represents subtotals of the regional total and should be considered as such for the purposes of determining reduced reliance on the Delta. Metropolitan’s Reduced Delta Reliance Reporting A.10-3 While the demands that Metropolitan’s member agencies and their customers report in their UWMPs are a good reflection of the demands in their respective service areas, they do not adequately represent each water supplier’s contributions to reduced reliance on the Delta. In order to calculate and report their reliance on water supplies from the Delta watershed, water suppliers that receive water from the Delta through other regional or wholesale water suppliers would need to determine the amount of Delta water that they receive from the regional or wholesale supplier. Two specific pieces of information are needed to accomplish this: first is the quantity of demands on the regional or wholesale water supplier that accurately reflect a supplier’s contributions to reduced reliance on the Delta, and second is the quantity of a supplier’s demands on the regional or wholesale water supplier that are met by supplies from the Delta watershed. For water suppliers that make investments in regional projects or programs it may be infeasible to quantify their demands on the regional or wholesale water supplier in a way that accurately reflects their individual contributions to reduced reliance on the Delta. Due to the extensive, long-standing and successful implementation of regional demand management and local resource incentive programs in Metropolitan’s service area, this infeasibility holds true for Metropolitan’s members as well as their customers. For Metropolitan’s service area, reduced reliance on supplies from the Delta watershed can only be accurately accounted at the regional level, as is demonstrated in this analysis. The following provides a summary of the near-term (2030) and long-term (2050) expected outcomes for Metropolitan’s Delta reliance and regional self-reliance. The results show that as a region, Metropolitan and its members as well as their customers are measurably reducing reliance on the Delta and improving regional self-reliance, both as an amount of water used and as a percentage of water used. Expected Outcomes for Regional Self-Reliance x Near-term (2030) – Normal water year regional self-reliance is expected to increase by 601 TAF from the 2010 baseline; this represents an increase of almost 20 percent of 2030 normal water year retail demands (Table A.10-2). x Long-term (2050) – Normal water year regional self-reliance is expected to increase by more than 1.02 MAF from the 2010 baseline, this represents an increase of more than 20 percent of 2050 normal water year retail demands (Table A.10-2). Expected Outcomes for Reduced Reliance on Supplies from the Delta Watershed x Near-term (2030) – Normal water year reliance on supplies from the Delta watershed decreased by 466 TAF from the 2010 baseline, this represents a decrease of more than 6 percent of 2030 normal water year retail demands (Table A.10-3). x Long-term (2050) – Normal water year reliance on supplies from the Delta watershed decreased by 537 TAF from the 2010 baseline, this represents a decrease of just over 9 percent of 2050 normal water year retail demands (Table A.10-3). A10.3 Demonstration of Reduced Reliance on the Delta The methodology used to determine Metropolitan’s reduced Delta reliance and improved regional self-reliance is consistent with the approach detailed in DWR’s UWMP Guidebook Appendix C, including the use of narrative justifications for the accounting of supplies and A.10-4 Metropolitan’s Reduced Delta Reliance Reporting the documentation of specific data sources. Some of the key assumptions underlying Metropolitan’s demonstration of reduced reliance include: x All data were obtained from the current 2025 UWMP or previously adopted UWMPs and represent average or normal water year conditions. x All analyses were conducted at the service area level, and all data reflect the total contributions of Metropolitan and its members as well as their customers. x No projects or programs that are described in the UWMPs as “Projects Under Development” were included in the accounting of supplies. Baseline and Expected Outcomes In order to calculate the expected outcomes for measurable reduction in Delta reliance and improved regional self-reliance, a baseline is needed to compare against. This analysis uses a normal water year representation of 2010 as the baseline, which is consistent with the approach described in the Guidebook Appendix C. Data for the 2010 baseline were taken from Metropolitan’s 2005 UWMP as the UWMPs generally do not provide normal water year data for the year that they are adopted (i.e., 2005 UWMP forecasts begin in 2010, 2010 UWMP forecasts begin in 2015, and so on). Consistent with the 2010 baseline data approach, the expected outcomes for reduced Delta reliance and improved regional self-reliance for 2015, 2020, and 2025 were taken from Metropolitan’s 2010, 2015, and 2020 UWMPs respectively. Expected outcomes for 2030- 2050 are from the current 2025 UWMP. Documentation of the specific data sources and assumptions are included in the discussions below. Service Area Demands Without Water Use Efficiency In alignment with the Guidebook Appendix C, this analysis uses normal water year demands, rather than normal water year supplies to calculate expected outcomes in terms of the percentage of water used. Using normal water year demands serves as a proxy for the amount of supplies that would be used in a normal water year, which helps alleviate issues associated with how supply capability is presented to fulfill requirements of the Act versus how supplies might be accounted for to demonstrate consistency with WR P1. Because WR P1 considers water use efficiency savings a source of water supply, water suppliers such as Metropolitan that explicitly calculate and report water use efficiency savings in their UWMP will need to make an adjustment to properly reflect normal water year demands in the calculation of reduced reliance. As explained in the Guidebook Appendix C, water use efficiency savings must be added back to the normal year demands to represent demands without water use efficiency savings accounted for; otherwise the effect of water use efficiency savings on regional self-reliance would be overestimated. Table A.10-1 shows the results of this adjustment for Metropolitan. Supporting narratives and documentation for all of the data shown in Table A.10-1 are provided below. Metropolitan’s Reduced Delta Reliance Reporting A.10-5 Table A.10-1 Demands without Water Use Efficiency Accounted For Total Service Area Water Demands (Acre-Feet) Baseline (2010) 2015 2020 2025 2030 2035 2040 2045 2050 Service Area Demands with Water Use Efficiency Accounted For 4,628,000 4,563,000 4,163,000 3,763,000 3,798,000 3,879,000 3,920,000 3,945,000 3,972,000 Reported Water Use Efficiency 865,000 936,000 1,056,000 1,162,000 1,171,000 1,223,000 1,289,000 1,357,000 1,419,000 Service Area Demands without Water Use Efficiency Accounted For 5,493,000 5,499,000 5,219,000 4,925,000 4,969,000 5,102,000 5,209,000 5,302,000 5,391,000 Service Area Demands without Water Use Efficiency The service area demands shown in Table A.10-1 represent the total retail water demands for Metropolitan’s service area and include municipal and industrial demands, agricultural demands, seawater barrier demands, and storage replenishment demands. These demand types and the modeling methodologies used to calculate them are described in Chapter 2.2 and Appendix 1 of Metropolitan’s UWMP. Water Use Efficiency The water use efficiency numbers shown in Table A.10-1 represent the total water use efficiency savings (conservation) for Metropolitan’s region, including savings from active, code-based, price-effect and pre-1990 sources. These sources of water use efficiency and the methodologies used to calculate them are described in Chapter 2.2, Chapter 3.4, Chapter 3.7 and Appendix 1 of Metropolitan’s UWMP. The demand and water use efficiency data shown in Table A.10-1 were collected from the following sources: x Baseline (2010) values – Metropolitan’s 2005 UWMP, Table 2-6: Metropolitan Regional Water Demand Average Year x 2015 values – Metropolitan’s 2010 UWMP, Table 2-8: Metropolitan Regional Water Demands Average Year x 2020 values – Metropolitan’s 2015 UWMP, Table 2-3: Metropolitan Regional Water Demands Average Year x 2025 values – Metropolitan’s 2020 UWMP, Table 2-3: Metropolitan Regional Water Demands Normal Water Year x 2030-2050 values – Metropolitan’s 2025 UWMP, Table 2-1: Metropolitan Regional Water Demands Normal Water Year Supplies Contributing to Regional Self-Reliance For a covered action to demonstrate consistency with the Delta Plan, WR P1 subsection (c)(1)(C) states that water suppliers must report the expected outcomes for measurable improvement in regional self-reliance. Table A.10-2 shows expected outcomes for supplies contributing to regional self-reliance both in amount and as a percentage. The numbers shown in Table A.10-2 represent efforts to improve regional self-reliance for Metropolitan’s entire service area and include the total contributions of Metropolitan and its members as A.10-6 Metropolitan’s Reduced Delta Reliance Reporting well as their customers. Supporting narratives and documentation for the all of the data shown in Table A.10-2 are provided below. The results shown in Table A.10-2 demonstrate that Metropolitan’s service area is measurably improving its regional self-reliance. In the near-term (2030), the expected outcome for normal water year regional self-reliance increases by 601 TAF from the 2010 baseline; this represents an increase of almost 20 percent of 2030 normal water year retail demands. In the long-term (2050), normal water year regional self-reliance is expected to increase by more than 1.0 MAF from the 2010 baseline; this represents an increase of 20 percent of 2050 normal water year retail demands. Table A.10-2 Supplies Contributing to Regional Self-Reliance Water Supplies Contributing to Regional Self-Reliance (Acre-Feet) Baseline (2010) 2015 2020 2025 2030 2035 2040 2045 2050 Water Use Efficiency 865,000 936,000 1,056,000 1,162,000 1,171,000 1,223,000 1,289,000 1,357,000 1,419,000 Water Recycling 316,000 348,000 436,000 550,000 520,000 608,000 641,000 648,000 656,000 Stormwater Capture and Use 100,000 103,000 110,000 80,000 76,000 73,000 70,000 71,000 72,000 Advanced Water Technologies 111,000 101,000 194,000 194,000 200,000 215,000 218,000 220,000 222,000 Conjunctive Use Projects 1,416,000 1,429,000 1,303,000 1,255,000 1,222,000 1,239,000 1,244,000 1,243,000 1,242,000 Local and Regional Water Supply and Storage Projects 252,000 224,000 261,000 257,000 97,000 96,000 96,000 95,000 94,000 Other Programs and Projects that Contribute to Regional Self-Reliance 875,000 1,250,000 1,200,000 1,250,000 1,250,000 1,250,000 1,250,000 1,250,000 1,250,000 Water Supplies Contributing to Regional Self-Reliance 3,935,000 4,391,000 4,560,000 4,748,000 4,536,000 4,704,000 4,808,000 4,884,000 4,955,000 Service Area Demands without Water Use Efficiency (Acre-Feet) Baseline (2010) 2015 2020 2025 2030 2035 2040 2045 2050 Service Area Demands without Water Use Efficiency Accounted For 5,493,000 5,499,000 5,219,000 4,925,000 4,969,000 5,102,000 5,209,000 5,302,000 5,391,000 Change in Regional Self Reliance (Acre-Feet) Baseline (2010) 2015 2020 2025 2030 2035 2040 2045 2050 Water Supplies Contributing to Regional Self-Reliance 3,935,000 4,391,000 4,560,000 4,748,000 4,536,000 4,704,000 4,808,000 4,884,000 4,955,000 Change in Supplies Contributing to Regional Self-Reliance NA 456,000 625,000 813,000 601,000 769,000 873,000 949,000 1,020,000 Percent Change in Regional Self Reliance (As Percent of Demand w/out WUE) Baseline (2010) 2015 2020 2025 2030 2035 2040 2045 2050 Percent of Supplies Contributing to Regional Self-Reliance 71.6% 79.9% 87.4% 96.4% 91.3% 92.2% 92.3% 92.1% 91.9% Change in Percent of Supplies Contributing to Regional Self-Reliance NA 8.2% 15.7% 24.8% 0 20.6% 20.7% 20.5% 0 Water Use Efficiency The water use efficiency information shown in Table A.10-2 is taken directly from Table A.10-1 above. Water Recycling The water recycling values shown in Table A.10-2 reflect the total recycled water production in Metropolitan’s service area as described in Chapter 3.5 and Appendix 2 of Metropolitan’s UWMP. Stormwater Capture and Use The stormwater capture and use data shown in Table A.10-2 include supplies from local surface water production as described in Chapter 1.4 and Appendix 2 of Metropolitan’s UWMP. These values do not include production from regional storage reservoirs; storage in these reservoirs is comprised of previously stored water from sources already reflected in Metropolitan’s Reduced Delta Reliance Reporting A.10-7 Tables A.10-2 and A.10-3. These regional storage resources are generally used to provide additional regional self-reliance in dry years, which is not reflected in this normal water year analysis. The regional storage reservoirs and their yields are described in Chapter 3.6, Appendix 2 and Appendix 3 of Metropolitan’s UWMP. The stormwater capture and use values shown in Table A.10-2 also do not include stormwater capture that is used to recharge local groundwater basins. Stormwater capture for groundwater recharge supports production of groundwater in the region, and for the purposes of this analysis that production is already captured in Table A.10-2 under conjunctive use projects. Advanced Water Technologies The advanced water technologies data shown in Table A.10-2 include total groundwater recovery and seawater desalination production in Metropolitan’s service area as described in Chapter 3.5 and Appendix 2 of Metropolitan’s UWMP. Conjunctive Use Projects The values for conjunctive use projects shown in Table A.10-2 represent total groundwater production in the region as described in Chapter 1.4 and Appendix 2 of Metropolitan’s UWMP. The conjunctive use projects numbers shown in Table A.10-2 do not include production from regional groundwater conjunctive use programs. As described in the stormwater capture and use discussion above, these regional storage programs rely on previously stored water from sources already reflected in Tables A.10-2 and A.10-3 and are generally used to provide additional regional self-reliance in dry years. The regional groundwater conjunctive use programs and their yields are described in Chapter 3.6 and Appendix 3. Local and Regional Water Supply and Storage Programs The data for local and regional water supply and storage programs shown in Table A.10-2 include supplies from the Los Angeles Aqueduct. This supply is described in Chapter 1.4 and Appendix 2 of Metropolitan’s UWMP. The local and regional supply numbers shown in Table A.10-2, except for “Other Programs and Projects that Contribute to Regional Self-Reliance” which is discussed below, were obtained from the following sources: x Baseline (2010) values – Metropolitan’s 2005 UWMP, Table 2-6: Metropolitan Regional Water Demand Average Year x 2015 values – Metropolitan’s 2010 UWMP, Table 2-8: Metropolitan Regional Water Demands Average Year x 2020 values – Metropolitan’s 2015 UWMP, Table 2-3: Metropolitan Regional Water Demands Average Year x 2025 values – Metropolitan’s 2020 UWMP, Table 2-3: Metropolitan Regional Water Demands Normal Water Year x 2030-2050 values – Metropolitan’s 2025 UWMP, Table 2-1: Metropolitan Regional Water Demands Normal Water Year A.10-8 Metropolitan’s Reduced Delta Reliance Reporting Other Programs and Projects that Contribute to Regional Self-Reliance Other programs and projects that contribute to regional self-reliance shown in Table A.10-2 include current programs from the Colorado River Aqueduct. Colorado River supplies include Metropolitan’s basic Colorado River apportionment, as well as supplies that result from existing and committed programs, including those from the IID-MWD Conservation Program, the implementation of the Quantification Settlement Agreement (QSA), related agreements, and the exchange agreement with SDCWA. Colorado River Aqueduct supplies and programs are described in Chapter 3.1 and Appendix 3 of Metropolitan’s UWMP. The values shown in Table A.10-2 for other programs and projects that contribute to regional self-reliance come from the following sources: x Baseline (2010) values – Metropolitan’s 2005 UWMP, Table A.3-7: Maximum Expected Colorado River Aqueduct Deliveries Year 2010 (Average Year) x 2015 values – Metropolitan’s 2010 UWMP, Table A.3-7: Maximum Expected Colorado River Aqueduct Deliveries Year 2015 (Average Year) x 2020 values – Metropolitan's 2015 UWMP, Table A.3-7: Maximum Expected Colorado River Aqueduct Deliveries Year 2020 (Average Year) x 2025 values – Metropolitan’s 2020 UWMP, Table A.3-7: Maximum Expected Colorado River Aqueduct Deliveries Year 2025 (Normal Water Year) x 2030-2050 values – Metropolitan’s 2025 UWMP, Table A.3-7: Maximum Expected Colorado River Aqueduct Deliveries Years 2030, 2035, 2040, 2045, 2050 (Normal Water Year) Reliance on Water Supplies from the Delta Watershed In order for a covered action to demonstrate consistency with the Delta Plan, WR P1 subsection (c)(1)(C) requires that water suppliers report the expected outcomes for measurable reductions in supplies from the Delta watershed either as an amount or as a percentage. This analysis provides both calculations. Based on the methodology described in Guidebook Appendix C, and consistent with the approach of this analysis in not including projects under development, this accounting does not include any supplies from potential future covered actions. Table A.10-3 shows the expected outcomes for reliance on supplies from the Delta watershed for Metropolitan’s service area. Supporting narratives and documentation for the all of the data shown in Table A.10-3 are provided below. The results shown in Table A.10-3 demonstrate that Metropolitan’s service area is measurably reducing its Delta reliance. In the near-term (2030), the expected outcome for normal water year reliance on supplies from the Delta watershed decreased by 466 TAF from the 2010 baseline; this represents a decrease of 6 percent of 2030 normal water year retail demands. In the long-term (2050), normal water year reliance on supplies from the Delta watershed decreased by 537 TAF from the 2010 baseline; this represents a decrease of just over 9 percent of 2050 normal water year retail demands. Metropolitan’s Reduced Delta Reliance Reporting A.10-9 Table A.10-3 Reliance on Water Supplies from the Delta Watershed CVP/SWP Contract Supplies The CVP/SWP contract supplies shown in Table A.10-3 include Metropolitan’s SWP Table A and Article 21 supplies. These supplies are described in Chapter 3.2 and Appendix 3 of Metropolitan’s UWMP. The values shown in Table A.10-3 do not include Desert Water Agency/Coachella Valley Water District SWP contract supplies. These supplies are exchanged with Desert Water Agency and Coachella Valley Water District for an equal amount of Colorado River water, which is reflected in the Colorado River Aqueduct supplies shown in Table A.10-2. In addition, Desert Water Agency and Coachella Valley Water District should include their SWP contract supplies in their own accountings of reduced reliance. Additional information on these exchange agreements can be found in Chapter 3.2 and Appendix 3 of Metropolitan’s UWMP. These values also do not include supplies from San Luis Carryover storage or Central Valley storage programs because storage in these programs comprises previously stored water from sources already reflected in Table A.10-3. These storage programs are generally used to provide additional regional self-reliance in dry years, which is not reflected in this normal water year analysis. The Central Valley storage projects and their yields are described in Chapter 3.3, and Appendix 3. San Luis Carryover storage is described in Chapter 3.2 and Appendix 3. Transfers and Exchanges of Supplies from the Delta Watershed The transfers and exchanges of supplies from the Delta watershed shown in Table A.10-3 include supplies from the San Bernardino Valley MWD Program, Yuba River Accord Purchase Program, the San Gabriel Valley MWD Program, Irvine Ranch Water District Storage and Exchange Program, and other generic SWP and Central Valley transfers and exchanges. These programs are described in Chapter 3.2 and Appendix 3 of Metropolitan’s UWMP. Water Supplies from the Delta Watershed (Acre-Feet) Baseline (2010)2015 2020 2025 2030 2035 2040 2045 2050 CVP/SWP Contract Supplies 1,472,000 1,029,000 984,000 1,133,000 949,000 924,000 901,000 877,000 877,000 Delta/Delta Tributary Diversions - - - - - - - - - Transfers and Exchanges of Supplies from the Delta Watershed 20,000 44,000 91,000 58,000 77,000 77,000 78,000 78,000 78,000 Other Water Supplies from the Delta Watershed - - - - - - - - - Total Water Supplies from the Delta Watershed 1,492,000 1,073,000 1,075,000 1,191,000 1,026,000 1,001,000 979,000 955,000 955,000 Service Area Demands without Water Use Efficiency (Acre-Feet) Baseline (2010)2015 2020 2025 2030 2035 2040 2045 2050 Service Area Demands without Water Use Efficiency Accounted For 5,493,000 5,499,000 5,219,000 4,925,000 4,969,000 5,102,000 5,209,000 5,302,000 5,391,000 Change in Supplies from the Delta Watershed (Acre-Feet) Baseline (2010)2015 2020 2025 2030 2035 2040 2045 2050 Water Supplies from the Delta Watershed 1,492,000 1,073,000 1,075,000 1,191,000 1,026,000 1,001,000 979,000 955,000 955,000 Change in Supplies from the Delta Watershed NA (419,000) (417,000) (301,000) (466,000) (491,000) (513,000) (537,000) (537,000) Percent Change in Supplies from the Delta Watershed (As a Percent of Demand w/out WUE) Baseline (2010)2015 2020 2025 2030 2035 2040 2045 2050 Percent of Supplies from the Delta Watershed 27.2% 19.5% 20.6% 24.2% 20.6% 19.6% 18.8% 18.0% 17.7% Change in Percent of Supplies from the Delta Watershed NA -7.6% -6.6% -3.0% -6.5% -7.5% -8.4% -9.1% -9.4% A.10-10 Metropolitan’s Reduced Delta Reliance Reporting Supplies from the Delta Watershed shown in Table A.10-3 are from the following sources: x Baseline (2010) values – Metropolitan’s 2005 UWMP, Table A.3-7: California Aqueduct Program Capabilities Year 2010 (Average Year) x 2015 values – Metropolitan’s 2010 UWMP, Table A.3-7: California Aqueduct Program Capabilities Year 2015 (Average Year) x 2020 values – Metropolitan’s 2015 UWMP, Table A.3-7: California Aqueduct Program Capabilities Year 2020 (Average Year) x 2025 values – Metropolitan’s 2020 UWMP, Table A.3-7: California Aqueduct Program Capabilities Year 2025 (Normal Water Year) x 2030-2050 values – Metropolitan’s 2025 UWMP, Table A.3-7: California Aqueduct Program Capabilities Years 2030, 2035, 2040, 2045, 2050 (Normal Water Year) A.10.4 UWMP Implementation In addition to the analysis and documentation described above, WR P1 subsection (c)(1)(B) requires that all programs and projects included in the UWMP that are locally cost-effective and technically feasible, which reduce reliance on the Delta, are identified, evaluated, and implemented consistent with the implementation schedule. WR P1 (c)(1)(B) states that: (B) Identified, evaluated, and commenced implementation, consistent with the implementation schedule set forth in the Plan, of all programs and projects included in the Plan that are locally cost effective and technically feasible which reduce reliance on the Delta[.] In accordance with Water Code Chapter 10631(f), water suppliers must already include in their UWMP a detailed description of expected future projects and programs that they may implement to increase the amount of water supply available to them in normal and single- dry water years and for a period of drought lasting five consecutive years. The UWMP description must also identify specific projects, include a description of the increase in water supply that is expected to be available from each project, and include an estimate regarding the implementation timeline for each project or program. Chapter 3 of Metropolitan’s UWMP summarizes the implementation plan and continued progress in developing a diversified water portfolio to meet the region’s water needs. Water Use Efficiency The water use efficiency numbers used in this analysis include the total water use efficiency savings (conservation) for the service area, including savings from active, code- based, price-effect and pre-1990 savings. The specific water use efficiency programs and their implementation are described in Chapter 3.4 of Metropolitan’s UWMP. Water Recycling The water recycling values used in this analysis reflect the total recycled water production in Metropolitan’s service area. Water recycling programs and implementation are discussed in Chapter 3.5 of Metropolitan’s UWMP. In addition, individual project-level details are provided in Appendix 5. Metropolitan’s Reduced Delta Reliance Reporting A.10-11 Stormwater Capture and Use The stormwater capture and use data used in this analysis include supplies from local surface water production. Local surface water production and its implementation are discussed in Appendix 2 of Metropolitan’s UWMP. Advanced Water Technologies The advanced water technologies data used in this analysis include total groundwater recovery and seawater desalination production in Metropolitan’s service. Groundwater recovery and seawater desalination programs and implementation are described in Chapter 3.5 of Metropolitan’s UWMP. In addition, individual project-level details are provided in Appendix 5. Conjunctive Use Projects The values for conjunctive use projects used in this analysis represent total groundwater production in the region. Groundwater production and its implementation are discussed in Appendix 2 of Metropolitan’s UWMP. Local and Regional Water Supply and Storage Programs The data for local and regional water supply and storage programs shown in this analysis include supplies from the Los Angeles Aqueduct. This program and its implementation are described in Appendix 2 of Metropolitan’s UWMP. Other Programs and Projects that Contribute to Regional Self-Reliance Other programs and projects that contribute to regional self-reliance used in this analysis include current programs from the Colorado River Aqueduct. Colorado River supplies include Metropolitan’s basic Colorado River apportionment, as well as supplies that result from existing and committed programs, including those from the IID-MWD Conservation Program, the implementation of the Quantification Settlement Agreement (QSA), related agreements, and the exchange agreement with SDCWA. Colorado River Aqueduct programs and their implementation are described in Chapter 3.1 and Appendix 3 of Metropolitan’s UWMP. CVP/SWP Contract Supplies The CVP/SWP contract supplies shown in this analysis include Metropolitan’s SWP Table A and Article 21 supplies. These supplies and their implementation are described in Chapter 3.2 and Appendix 3 of Metropolitan’s UWMP. Transfers and Exchanges of Supplies from the Delta Watershed The transfers and exchanges of supplies from the Delta watershed shown in this analysis include supplies from the San Bernardino Valley MWD Program, Yuba River Accord Purchase Program, the San Gabriel Valley MWD Program, Irvine Ranch Water District Storage and Exchange Program, and other generic SWP and Central Valley transfers and exchanges. These programs and their implementation are described in Chapter 3.2 and Appendix 3 of Metropolitan’s UWMP. CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX D NOTIFICATION LETTERS AND NOTICES OF PUBLIC HEARING CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX E CLIMATE CHANGE CONSIDERATIONS (CAL- ADAPT DATA) CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX F LONG BEACH JUDGMENT CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX G MAIN BASIN JUDGMENT CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX H RAYMOND BASIN ADJUDICATION CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX I DRAFT RECYCLED WATER FEASIBILITY STUDY DRAFT City of Arcadia Recycled Water Feasibility Study November 2006 November 29, 2004 Prepared for: City of Arcadia Stetson Engineers Inc. 861 Village Oaks Drive, Covina, California 91724 Phone:(626) 967-6202, Fax: (626) 331-7065 Covina, CA San Rafael, CA Mesa, AZ Recycled Water Deamnd /2 Demand No. Customer Name Address 1 Arcadia High 180 Campus Dr. 46 27 0.025 0.061 0.184 128 2 Baldwin Stocker Elementary 422 W Lemon Ave. 5 3 0.003 0.007 0.020 14 3 Camino Grove School 700 Camino Grove 6 3 0.003 0.008 0.023 16 4 Dana Middle School 1401 S. First Ave. 9 6 0.005 0.012 0.037 26 5 First Ave Middle School 301 S. First Ave. 12 7 0.006 0.015 0.046 32 6 Foothills Middle School 171 E. Sycamore Ave. 5 3 0.003 0.007 0.020 14 7 Highland Oaks Elementary 10 Virginia Dr. 3 2 0.002 0.005 0.014 10 8 Holly Ave Elementary 360 W. Duarte Rd. 14 8 0.008 0.019 0.057 39 9 Hugo Reid Elementary 1000 Hugo Reid Dr. 1 1 0.001 0.001 0.004 3 10 Hugo Reid Primary 1000 Hugo Reid Dr. 4 2 0.002 0.005 0.015 10 11 Longley Way Elementary 2601 S. Longley Wy. 7 4 0.004 0.010 0.029 20 12 Rancho High/Serendipity School 120 - 150 S. Third Ave. 5 3 0.002 0.006 0.018 13 13 Holly Angels School Campus Dr. & Holly Ave. 2 1 0.001 0.002 0.007 5 14 Serendipity School (Part of No. 12) 120 - 150 S. Third Ave. 0 0 0.000 0.000 0.000 0 15 Santa Anita Golf Course 405 S. Santa Anita Ave. 156 109 0.097 0.243 0.730 507 16 Santa Anita Park (Race Track) 285 W. Huntington Dr. 162 121 0.108 0.271 0.812 564 17 LA County & State Arboretum S. Baldwin Ave. 93 79 0.070 0.176 0.528 367 18 Arcadia County Park 78 W Huntington Dr. 125 106 0.095 0.237 0.712 495 19 Baldwin Stocker Park 422 W. Lemon Ave. 5 5 0.004 0.010 0.031 22 20 Bicentennial Park 526 E. Longden Ave. 1 1 0.001 0.003 0.008 6 21 Bonita Park 207 Bonita St. 0 0 0.000 0.000 0.001 0 22 Camino Grove Park 1420 S. Sixth Ave. 2 2 0.002 0.004 0.012 8 23 Civic Center Athletic Field 240 W. Huntington Dr. 8 7 0.006 0.016 0.048 33 24 Eisenhower Memorial Park 601 N. Second Ave. 20 17 0.015 0.037 0.112 78 25 Fairview Avenue Park 542 Fairview Ave. 3 3 0.002 0.006 0.018 12 26 Forest Avenue Park 132 W. Forest Ave. 1 1 0.001 0.003 0.008 6 27 Highland Oaks Park 10 W. Virginia Rd. 6 5 0.004 0.011 0.032 22 28 Hugo Reid Park 1153 De Anza Pl. 10 9 0.008 0.019 0.057 40 29 Longden Avenue Park 1179 E. Longden Ave. 0 0 0.000 0.000 0.000 0 30 Newcastle Park 143 W. Colorado Blvd. 8 7 0.006 0.016 0.047 33 31 Orange Grove Park 670 W. Orange Grove Ave. 0 0 0.000 0.001 0.002 1 32 Par-3 Golf Course 620 E. Live Oak Ave. 44 31 0.028 0.069 0.207 144 33 Tierra Verde Park 200 E. Camino Real Ave. 7 6 0.006 0.014 0.042 29 34 Tripolis Friendship Park 1003 S. Golden West Ave. 3 2 0.002 0.005 0.015 11 35 Wilderness Park 2240 N. Highland Oaks Dr. 8 7 0.006 0.016 0.047 33 36 Santa Anita Median 105 N Santa Anita Ave. 47 47 0.042 0.104 0.313 218 37 Baldwin Median 460 N Baldwin Ave. 15 15 0.013 0.033 0.098 68 38 Hungtington Median 32 E Huntington Dr. 17 17 0.015 0.038 0.115 80 39 Live Oak Median 43 E Live Oak Ave. 5 5 0.005 0.011 0.034 24 40 Fashing Car Wash 425 N Santa Anita Ave. 37 24 0.021 0.053 0.160 111 41 Calco Farms 11921 Goldring Rd. 15 12 0.011 0.028 0.084 58 42 Caltrans 223 N Fifth Avenue 4 4 0.003 0.009 0.026 18 43 Caltrans 4 E Forest Ave 12 12 0.011 0.027 0.082 57 44 Caltrans 170 W Forest Ave 7 7 0.007 0.017 0.050 35 45 Caltrans 900 N Michillinda Ave 1 1 0.001 0.001 0.004 3 46 Caltrans 1015 N Old Ranch Road 1 1 0.001 0.003 0.010 7 47 Caltrans 1009 San Carlos Road 5 5 0.005 0.012 0.036 25 Total 948 740 0.661 1.652 4.956 3,442 Hi-Lited Totals (Customers Along Proposed Recycled Water Pipeline Route)644 0.575 1.438 4.315 2,996 /1 Values shown are actual metered usage Jan. 1999 and Jan. 2004. Supplied by City Of Arcadia staff. /2 Demand Reduction Factors: Schools 40%, Golf Courses 30%, Parks 15%, Arboretum 15%, Race Track 25%, Car Wash 35%, and Calco Farms 15%. Medians and Caltrans not reduced. Maximum Day Demand = 2.5 X Average Day Demand. Maximum Peak Hour Demand = 3 X Maximum Day Demand Water Demand /1 (AFY)Annual Average (AFY) Proposed Recycled Water Users Within City Of Arcadia Average Day (MGD) Max Day Demand (MGD) Max Peak Hour Demand (MGD) Max Peak Hour Demand (GPM) CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX J WATER CONSERVATION PLAN Footnotes: --- (1) --- (Division 3 added by Ord. 1930 adopted 2-5-91) Arcadia, CA Code of Ordinances about:blank 1 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 2 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 3 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 4 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 5 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 6 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 7 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 8 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 9 of 10 4/14/2026, 4:39 PM Arcadia, CA Code of Ordinances about:blank 10 of 10 4/14/2026, 4:39 PM CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX K CITY OF ARCADIA LOCAL HAZARD MITIGATION PLAN City of Arcadia Local Hazard Mitigation Plan May 11, 2022 City of Arcadia Local Hazard Mitigation Plan 2022 Table of Contents Introduction Section 1 - Executive Summary 1-1 Section 2 - Resolution adoption by Council 2-1 Section 3 - FEMA Crosswalk & Approval Letter 3-1 Section 4 - Community Profile 4-1 Section 5 - Planning Process 5-1 Section 6 - Risk Assessment 6-1 Section 7 Natural Hazards 7 Section 7.1 - Earthquake 7.1 Section 7.2 - Flood 7.2 Section 7.3 Slope Failure Debris/Mud Flow 7.3 Section 7.4 - Windstorm 7.4 Section 7.5 - Wildfire 7.5 Section 7.6 - Drought 7.6 Section 8 - Human Caused Hazards 8 Section 8.1 - Hazardous Materials 8.1 Section 8.2 - Terrorism 8.2 Section 8.3 Train Accident 8.3 Section 9 - Mitigation Strategy 9-1 Section 10 - Plan Maintenance 10-1 Appendix Appendix A - Economic Analysis A-1 Appendix B - Acronyms B-1 Local Hazard Mitigation Plan 2022 Section 1 Executive Summary 1-1 Five -Year Action Plan Matrix The City of Arcadia Local Hazards Mitigation Action Plan includes resources and information to assist City residents, public and private sector organizations, and others interested in participating in planning for local hazards. The mitigation plan provides a list of activities that may assist City of Arcadia in reducing risk and preventing loss from future hazardous events. The action items address multi-hazard issues, as well as activities for earthquakes, flooding, debris flow / Slope Failures, windstorms, wildfires, drought, hazardous materials, transportation emergencies and terrorism How is the Plan Organized? The Mitigation Plan contains a five-year action plan matrix, background on the purpose and methodology used to develop the mitigation plan, a profile of City of Arcadia, sections on hazards that occur within the City, and a number of appendices. Who Participated in Developing the Plan? The City of Arcadia Local Hazard Mitigation Action Plan is the result of a collaborative , public agencies, non-profit organizations, the private sector, and regional and state organizations. Public participation played a key role in development of goals and action items. A meeting was held with stakeholders in the City, and two public meetings development. A Hazard Mitigation Committee guided the process of developing the plan. What is the Plan Mission? The mission of the City of Arcadia Local Hazard Mitigation Plan is to promote sound public policy designed to protect citizens, critical facilities, infrastructure, private property, and the environment from potential hazards. This can be achieved by increasing public awareness, documenting the resources for risk reduction and loss- prevention, and identifying activities to guide the City towards building a safer, more sustainable community. What are the Plan Goals? organizations, and citizens can take to work toward mitigating risk from hazards. The goals are stepping-stones between the broad direction of the mission statement and the specific recommendations outlined in the action items. Protect Life and Property Implement activities that assist in protecting lives by making homes, businesses, infrastructure, critical facilities, and other property more resistant to losses from natural hazards. Reduce losses and repetitive damages for chronic hazard events while promoting insurance coverage for catastrophic hazards. Improve hazard assessment information to make recommendations for discouraging new development in high hazard areas and encouraging preventative measures for existing development in areas vulnerable to hazards. Local Hazard Mitigation Plan 2022 Section 1 Executive Summary 1-2 Public Awareness Develop and implement education and outreach programs to increase public awareness of the risks associated with natural hazards. Provide information on tools; partnership opportunities, and funding resources to assist in implementing mitigation activities. Natural Systems Balance natural resource management, and land use planning with local hazard mitigation to protect life, property, and the environment. Preserve, rehabilitate, and enhance natural systems to serve local hazard mitigation functions. Partnerships and Implementation Strengthen communication and coordinate participation among and within public agencies, citizens, non-profit organizations, business, and industry to gain a vested interest in implementation. Encourage leadership within public and private sector organizations to prioritize and implement local and regional hazard mitigation activities. Emergency Services Establish policy to ensure mitigation projects for critical facilities, services, and infrastructure. Strengthen emergency operations by increasing collaboration and coordination among public agencies, non-profit organizations, business, and industry. Coordinate and integrate hazard mitigation activities, where appropriate, with emergency operations plans and procedures. How are the Action Items Organized? The action items are a listing of activities in which City agencies and citizens can be engaged in to reduce risk. The action items are organized within the following matrix, which lists all of the multi-hazard and hazard-specific action items included in the mitigation plan. Data collection, research, and the public participation process resulted in the development of these action items (see Section 9). The matrix includes the following information for each action item: Coordinating Organization The coordinating organization is the public agency with regulatory responsibility to address hazards, or that is willing and able to organize resources, find appropriate funding, or oversee activity implementation, monitoring, and evaluation. Coordinating organizations may include local, county, or regional agencies that are capable of or responsible for implementing activities and programs. Time line Action items include both short and long-term activities. Each action item Local Hazard Mitigation Plan 2022 Section 1 Executive Summary 1-3 includes an estimate of the time line for implementation. Short-term action items are activities which City agencies are capable of implementing with existing resources and authorities within one to two years. Long-term action items may require new or additional resources or authorities, and may take between one and five years (or more) to implement. Ideas for Implementation Each action item includes ideas for implementation and potential resources, which may include grant programs or human resources. Plan Goals Addressed The plan goals addressed by each action item are included as a way to monitor and evaluate how well the mitigation plan is achieving its goals once implementation begins. The plan goals are organized into the following five areas: 1. Protect Life and Property 2. Public Awareness 3. Natural Systems 4. Partnerships and Implementation 5. Emergency Services Constraints Constraints may apply to some of the action items. These constraints may be a lack of city staff, lack of funds, or vested property rights, which might expose the City to legal action as a result of adverse impacts on private property. How Will the Plan be Implemented, Monitored, and Evaluated? The Plan Maintenance Section of this document details the formal process that will Local Hazards Mitigation Plan remains an active and relevant document. The plan maintenance process includes a schedule for monitoring and evaluating the Plan annually and producing a plan revision every five years. This section describes how the City will integrate public participation throughout the plan maintenance process. Finally, this section includes an explanation of how the City of Improvement Plans, and Building & Safety Codes. Plan Adoption Adopti body is one of the prime requirements for approval of the plan. Once the plan is reviewed Local Hazard Mitigation Plan. The local agency governing body has the responsibility and authority to promote sound public policy regarding hazards. The City Council will periodically need to re-adopt the plan as it is revised to meet changes in the hazard risks and exposures in the community. The approved Local Hazard Mitigation Plan will be significant in the future growth and development of the community. Local Hazard Mitigation Plan 2022 Section 1 Executive Summary 1-4 Coordinating Body The coordinating implementation of Plan action items and undertaking the formal review process. The City Manager will assign representatives to the Hazard Mitigation Committee and assign a Project Manager. Convener Local Hazard Mitigation Plan, and the Hazard Mitigation Committee will take responsibility for plan implementation. The Project Manager will serve as a convener to facilitate the Hazard Mitigation Committee meetings, and will assign tasks such as updating and presenting the Plan to the members of the committee. Plan implementation and evaluation will be a shared responsibility among all of the Local Hazard Committee Members. Implementation through Existing Programs The City of Arcadia addresses statewide planning goals and legislative requirements through its General Plan, Capital Improvement Plans, Fire Codes, City Building & Safety Codes and other related documents. The Local Hazard Mitigation Plan provides a series of recommendations that are closely related to the goals and objectives of these existing planning programs. City of Arcadia will have the opportunity to implement recommended mitigation action items through existing programs and procedures. Economic Analysis of Mitigation Projects The Federal Emergency Management Agency's approaches to identify costs and benefits associated with hazard mitigation strategies or projects fall into two general categories: benefit/cost analysis and cost-effectiveness analysis. Conducting benefit/cost analysis for a mitigation activity can assist communities in determining whether a project is worth undertaking now, in order to avoid disaster-related damages later. Cost-effectiveness analysis evaluates how best to spend a given amount of money to achieve a specific goal. Determining the economic feasibility of mitigating hazards can provide decision makers with an understanding of the potential benefits and costs of an activity, as well as a basis upon which to compare alternative projects. Formal Review Process Local Hazard Mitigation Plan will be evaluated on an annual basis to determine the effectiveness of programs, and to reflect changes in land development or programs that may affect mitigation priorities. The evaluation process includes a firm schedule and time line, and identifies the local agencies and organizations participating in plan evaluation. The Project Manager or designee will be responsible for contacting the Hazard Mitigation Committee members and organizing the annual meeting. Committee members will be responsible for monitoring and evaluating the progress of the mitigation strategies in the Plan. Local Hazard Mitigation Plan 2022 Section 1 Executive Summary 1-5 Continued Public Involvement The City of Arcadia is dedicated to involving the public directly in the continual review and updates of the Hazard Mitigation Plan. Copies of the plan will be catalogued and . The existence and location of these copies will be publicized in City newsletters. In addition, locations of the Plan and any proposed changes will be posted on the City website. This site will also contain an email address and phone number to which people can direct their comments and concerns. Changes to Priorities The City of Arcadia updated its Local Hazard Mitigation Plan in 2012. There have been no changes in priorities since the adoption of the plan. Local Hazard Mitigation Plan 2022 Section 2 Resolution Adoption by Council 2-1 On May 3, 2022 this plan was adopted by the Arcadia City Council. The staff report and Resolution are included in this section. DATE: May 3, 2022 TO:Honorable Mayor and City Council FROM:Barry R. Spriggs, Fire Chief By: Chen Suen, Deputy Fire Chief Maria Lourdes A. Taylor, Sr. Management Analyst SUBJECT:RESOLUTION NO. 7429 APPROVING THE CITY OF ARCADIA LOCAL HAZARD MITIGATION PLAN Recommendation: Adopt SUMMARY Local governments are required to have an approved Local Hazard Mitigation Plan in place to receive pre-disaster and post-disaster mitigation federal funding. The City has updated its Plan to address modern threats to the community and to adhere to federal standards and guidelines. Therefore, it is recommended that the City Council adopt Resolution No. 7429, approving the City of Arcadia’s Local Hazard Mitigation Plan, prior to its submittal to the Federal Emergency Management Agency (“FEMA”) for final approval. BACKGROUND The Disaster Mitigation Act of 2000 was a law enacted by the federal government that places emphasis on hazard mitigation planning for local municipalities. The law requires local governments to develop and adopt a Local Hazard Mitigation Plan (“LHMP”) with final approval given by FEMA. An LHMP is a document that identifies potential natural and human-caused disasters specific to a community and contains information to assist the community, its residents, and other interested parties to plan for local hazards. Essentially, FEMA requires a local government to update their LHMP every five years. The City of Arcadia’s previous LHMP was adopted in 2013. For this most recent LHMP update, City staff began working with FEMA in 2017 with the final draft subsequently approved by FEMA in April 2022. On April 5, 2022, after completing its review of the LHMP, FEMA advised staff that the plan was eligible for final approval pending its adoption by the City. Upon City Council’s approval of the LHMP, formal adoption documentation will be forwarded to FEMA to satisfy the final requirement of the review process. Adopt Resolution 7429 Arcadia Local Hazard Mitigation Plan 2022 May 3, 2022 Page 2 of 4 DISCUSSION After a disaster strikes, repair and construction efforts are often undertaken to restore infrastructure to pre-disaster conditions. Although such efforts expedite a return to normal functioning, the replications of pre-disaster conditions could result in a cycle of damage, reconstruction, and repeated damage. Hazard mitigation planning ensures such cycles are broken and that post-disaster repairs and reconstruction result in vulnerability reduction. While disasters may be unpreventable, the devasting effects may be reduced or eliminated through well-organized public education and awareness efforts, preparedness, and mitigation. For those hazards that cannot be fully mitigated, the community must be prepared to provide efficient and effective response and recovery services. The mission of the LHMP is to promote sound public policy designed to protect residents, critical facilities, infrastructure, private property, and the environment from natural and human caused hazards. This mission will be achieved by increasing public awareness, documenting resources for risk reduction and loss prevention, and identifying activities that will guide the City toward building a safer, more sustainable community. The document was prepared through a concerted and collaborative effort of City departments, citizens in the community, and major stakeholders in the region. All City departments met regularly, coordinated resources, and compiled information required for the document. Public workshops were held to gather ideas and opinions on community mitigation goals and activities. In addition, a stakeholder meeting was conducted, which was attended by emergency service coordinators within the region, representatives from the Arcadia Unified School District, American Red Cross, Santa Anita Racetrack, civic groups, and the Arcadia Chamber of Commerce. The end-product is a comprehensive City of Arcadia Local Hazard Mitigation Plan. Over 100 pages in length, excluding appendices and maps, the document reviews action items from the previous LHMP and evaluates if those goals have been met. It also discusses in detail nine (9) possible natural and human-caused hazards that could impact the City, which include the following: 1) Earthquake 2) Flood 3) Slope Failure Debris/Mud Flow 4) Windstorm 5) Wildfire 6) Drought 7) Hazardous Materials 8) Terrorism Adopt Resolution 7429 Arcadia Local Hazard Mitigation Plan 2022 May 3, 2022 Page 3 of 4 9) Train Accident The LHMP includes a description, risk analysis, and mitigation strategies for each hazard. For example, the earthquake section of the document discusses: the definition of an earthquake; earthquakes in Southern California and in Arcadia; earthquake hazard assessment and a list of the nearby fault lines that affect Arcadia; risk analysis of the probability of an earthquake with a magnitude of 5.0 or greater occurring in the next five (5), 10, 20, and 50 years; the City’s current mitigation of earthquake hazards; and a resource directory pertaining to earthquake preparedness and mitigation. Other sections follow similar patterns. The adoption of Resolution No. 7429 by the City Council is the final requirement in the plan approval process. The document has already been approved by the California Office of Emergency Services (“Cal-OES”). Additionally, the document has been approved by FEMA, pending the formal adoption by the City Council. Upon City Council’s adoption, the document will be available for public review in the City Manager’s Office, City Clerk’s Office, and the Arcadia Public Library. A copy will also reside on the City’s website. ENVIRONMENTAL IMPACT The LHMP is subject to a statutory exemption pursuant to Section 15252 of the California Environmental Quality Act guidelines because it is a feasibility and planning study. Additionally, the document is consistent with the City’s General Plan in implementing certain Public Safety Element goals, objectives, and policies outlined in Resolution No. 7429. FISCAL IMPACT Adoption of Resolution No. 7429 has no direct fiscal impact to the City. Arcadia will have the opportunity to implement recommended mitigation action items through existing programs and procedures. Failure to adopt an LHMP will forfeit the City’s eligibility to receive federal funding for both pre-disaster and post-disaster mitigation projects. RECOMMENDATION It is recommended that the City Council adopt Resolution No. 7429 approving the City of Arcadia’s Local Hazard Mitigation Plan. Adopt Resolution 7429 Arcadia Local Hazard Mitigation Plan 2022 May 3, 2022 Page 4 of 4 Attachments: Resolution 7429 City of Arcadia Local Hazard Mitigation Plan 3 STATE OF CALIFORNIA ) COUNTY OF LOS ANGELES ) SS: CITY OF ARCADIA ) I, GENE GLASCO, City Clerk of the City of Arcadia, hereby certifies that the foregoing Resolution No. 742 was passed and adopted by the City Council of the City of Arcadia, signed by the Mayor and attested to by the City Clerk at a regular meeting of said Council held on the 3rd of May, 2022 and that said Resolution was adopted by the following vote, to wit: AYES: Danielson, Tay, Verlato, Cheng, and Beck NOES: None ABSENT: None _________________________ City Clerk of the City of Arcadia Local Hazard Mitigation Plan 2022 Section 3 FEMA Crosswalk and Approval Letter 3-1 On May 11, 2022, this plan was approved by FEMA. The approval letter and crosswalk are included in this section. U.S. Department of Homeland Security FEMA Region 9 1111 Broadway, Suite 1200 Oakland, CA 94607 www.fema.gov May , 2022 Barry Spriggs Fire Chief Arcadia Fire Department 710 S. Santa Anita Ave. Arcadia, CA 91006 Dear Chief Spriggs: The City of Arcadia Local Hazard Mitigation Plan 2022 was officially adopted by the City of Arcadia on May 3, 2022 and submitted for review and approval to the Federal Emergency Management Agency (FEMA). The review is complete, and FEMA finds the plan to be in conformance with the Code of Federal Regulations, Title 44, Part 201, Section 6 (44 C.F.R. 201.6). This plan approval ensures the City of Arcadia’s continued eligibility for funding under FEMA’s Hazard Mitigation Assistance programs, including the Hazard Mitigation Grant Program (HMGP), the Building Resilient Infrastructure and Communities program (BRIC), and the Flood Mitigation Assistance (FMA) program. All requests for funding are evaluated individually according to eligibility and other program requirements. Approved hazard mitigation plans may also be eligible for points under the National Flood Insurance Program’s Community Rating System (CRS). FEMA’s approval is for a period of five years, effective starting the date of this letter. Prior to May , 2027, the City of Arcadia must review, revise, and submit their plan to FEMA for approval to maintain eligibility for grant funding. The enclosed plan review tool provides additional recommendations to incorporate into future plan updates. If you have any questions regarding the planning or review processes, please contact the FEMA Region 9 Hazard Mitigation Planning Team at fema-r9-mitigation-planning@fema.dhs.gov. Sincerely, Kathryn Lipiecki Director, Mitigation Division FEMA Region 9 Enclosure (1) City of Arcadia Plan Review Tool, dated May , 2022 www.fema.gov City of Arcadia Hazard Mitigation Plan Approval Notice May , 2022 Page 2 of 2 cc: Alison Kearns, Planning and Implementation Branch Chief, FEMA Region 9 Jennifer Hogan, State Hazard Mitigation Officer, California Governor’s Office of Emergency Services Victoria LaMar-Haas, Hazard Mitigation Planning Chief, California Governor’s Office of Emergency Services FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 1 REGION IX LOCAL HAZARD MITIGATION PLAN REVIEW TOOL Last Updated: April 12, 2021 The Local Hazard Mitigation Plan Review Tool demonstrates how the Local Hazard Mitigation Plan meets the regulation in 44 CFR §201.6 and offers State and FEMA Mitigation Planners an opportunity to provide feedback to the community. • The Regulation Checklist provides a summary of FEMA’s evaluation of whether the plan has addressed all requirements. • The Plan Assessment identifies the plan’s strengths as well as documents areas for future improvement. This section also includes a list of resources for implementation of the plan. • The Multi-Jurisdiction Summary Sheet is a mandatory worksheet for multi-jurisdictional plans that is used to document which jurisdictions are eligible to adopt the plan. • The Hazard Identification and Risk Assessment Matrix is a tool for plan reviewers to identify if all components of Element B are met. Jurisdiction: City of Arcadia, California Title of Plan: City of Arcadia Local Hazard Mitigation Plan Date of Plan: December 31, 2019 Local Point of Contact: Barry Spriggs Address: 710 S. Santa Anita Ave. Arcadia, CA 91006 Title: Fire Chief Agency: Arcadia Fire Department Phone Number: 626 574 5107 E-Mail: bspriggs@ArcadiaCA.gov State Reviewer(s): Karen McCready-Hoover (916) 845-8177 karen.mccready-hoover@caloes.ca.gov Title: Emergency Services Coordinator Date: April 13, 2021 Date Received at State Agency 1/9/20, 6/24/20, 3/12/21, 3/17/21, 4/7/21 Date Sent to FEMA 4/13/21 FEMA Reviewer(s): Emily Breen Title: Community Planner Date: May 3, 2021 Date Received in FEMA Region IX April 13, 2021 Date(s) Revisions Requested May 24, 2021, April 1, 2022 Date Approvable Pending Adoption (APA)April 5, 2022 Date Approved May 11, 2022 2 FEMA Region IX Local Mitigation Plan Review Tool SECTION 1: REGULATION CHECKLIST INSTRUCTIONS:The Regulation Checklist must be completed by FEMA. The purpose of the Checklist is to identify the location of relevant or applicable content in the plan by element/sub- element and to determine if each requirement has been ‘Met’ or ‘Not Met.’ The ‘Required Revisions’ summary at the bottom of each element must be completed by FEMA to provide a clear explanation of the revisions that are required for plan approval. Required revisions must be explained for each plan sub-element that is ‘Not Met.’ Sub-elements should be referenced in each summary by using the appropriate numbers (A1, B3, etc.), where applicable. Requirements for each Element and sub-element are described in detail in the Local Plan Review Guide in Section 4, Regulation Checklist. 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met ELEMENT A. PLANNING PROCESS A1. Does the plan document the planning process, including how it was prepared and who was involved in the process for each jurisdiction? (Requirement §201.6(c)(1)) a. Does the plan provide documentation of how the plan was prepared? This documentation must include the schedule or timeframe and activities that made up the plan’s development as well as the planning team members who were involved. P 5-1 & 5-2 X b. Does the plan list the jurisdiction(s) participating in the plan that are seeking approval? P 1-3 X c. Does the plan identify who represented each jurisdiction on the planning team? At a minimum, it must identify the jurisdiction represented and the person’s position or title and agency within the jurisdiction.) P 5-1 & 5-2 X A2. Does the plan document an opportunity for neighboring communities, local and regional agencies involved in hazard mitigation activities, agencies that have the authority to regulate development as well as other interests to be involved in the planning process? (Requirement §201.6(b)(2)) a. Does the plan document an opportunity for stakeholders from neighboring communities, local, and regional agencies involved in hazard mitigation activities, agencies that have the authority to regulate development, as well as other interested parties to be involved in the planning process? P 5-3 X b. Does the plan identify how the stakeholders were invited to participate in the process? P 5-3 X FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 3 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met A3. Does the plan document how the public was involved in the planning process during the drafting stage? (Requirement §201.6(b)(1)) a. Does the plan document how the public was given the opportunity to be involved in the planning process? P 5-3, 6-1 X b. Does the plan document how the public’s feedback was incorporated into the plan? P 1-1, 5-3, 6-1 X A4. Does the plan describe the review and incorporation of existing plans, studies, reports, and technical information? (Requirement §201.6(b)(3)) P 5-3 to 5-4, P 7.1-10, 7.2-7, 7.3-8, 7.4-9, 7.5- 10 X A5. Is there discussion of how the community(ies) will continue public participation in the plan maintenance process? (Requirement §201.6(c)(4)(iii)) P 1-5, 10-3 X A6. Is there a description of the method and schedule for keeping the plan current (monitoring, evaluating and updating the mitigation plan within a 5-year cycle)? (Requirement §201.6(c)(4)(i)) a. Does the plan identify how, when, and by whom the plan will be monitored (how will implementation be tracked) over time? P 1-3 to 1- 4, 10-1 to 10-2 X b. Does the plan identify how, when, and by whom the plan will be evaluated (assessing the effectiveness of the plan at achieving stated purpose and goals) over time? P 1-3 to 1-4, 10-1 to 10-2 X c. Does the plan identify how, when, and by whom the plan will be updated during the 5-year cycle? P 1-3 to 1-4, 10-2 to 10-3 X ELEMENT A: REQUIRED REVISIONS ELEMENT B. HAZARD IDENTIFICATION AND RISK ASSESSMENT (Reviewer: See Section 4 for assistance with Element B) B1. Does the plan include a description of the type, location, and extent of all natural hazards that can affect each jurisdiction(s)? (Requirement §201.6(c)(2)(i)) a. Does the plan include a general description of all natural hazards that can affect each jurisdiction? P 6-1 X b. Does the plan provide rationale for the omission of any natural hazards that are commonly recognized to affect the jurisdiction(s) in the planning area? P 6-1 X c. Does the plan include a description of the type of all natural hazards that can affect each jurisdiction? P 7.1-1, 7.2-1 to 7.2- 2, 7.3-1, 7.4-1, 7.5-1, 7.6-1 X 4 FEMA Region IX Local Mitigation Plan Review Tool 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met d. Does the plan include a description of the location for all natural hazards that can affect each jurisdiction? P 7.1-10, 7.1-4, 7.2- 4, 7.2-8, 7.2-9, 7.3- 6, 7.3-9, 7.4-5, 7.5- 11, 7.6-1 X e. Does the plan include a description of the extent for all natural hazards that can affect each jurisdiction? P 7.1-1 to 7.1-4, 7.2- 3, 7.3-1, 7.4-1 to 7.4-4, 7.5- 3 to 7.5-6, 7.6-1 to 7.6-3, 7.6- 8 X B2. Does the plan include information on previous occurrences of hazard events and on the probability of future hazard events for each jurisdiction? (Requirement §201.6(c)(2)(i)) a. Does the plan include information on previous occurrences of hazard events for each jurisdiction? P 7.1-1 to 7.1-3, 7.2-2 to 7.2-4, 7.3-2 to 7.3- 4, 7.4-3 to 7.4-4, 7.5-2 to 7.5-4, 7.5-6, 7.6-2 to 7.6-6 X b. Does the plan include information on the probability of future hazard events for each jurisdiction? P 7.1-5, 7.2- 4, 7.2-8, 7.2-9, 7.3-5 to 7.3-6, 7.4-4, 7.5-6, 7.6-8 X B3. Is there a description of each identified hazard’s impact on the community as well as an overall summary of the community’s vulnerability for each jurisdiction? (Requirement §201.6(c)(2)(ii)) a. Is there a description of each hazard’s impacts on each jurisdiction (what happens to structures, infrastructure, people, environment, etc.)? P 7.1-1 to 7.1.-3, 7.1-5 to 7.1-9, 7.2-3, 7.2-5 to 7.2-6, 7.3-2 to 7.3- 4, 7.3-6 to 7.3-7, 7.4-3 to 7.4.9, 7.5-1, 7.5-4, 7.6-6 to 7.6- 7 X FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 5 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met b. Is there a description of each identified hazard’s overall vulnerability (structures, systems, populations, or other community assets defined by the community that are identified as being susceptible to damage and loss from hazard events) for each jurisdiction? P 7.1-5 to 7.1-9, 7.2- 5 to 7.2-7, 7.3.4, 7.3- 6 to 7.3-8, 7.4.3- 7.4.9, 7.5- 1, 7.5-5, 7.5-7, 7.5- 10 to 7.5- 11, 7.6-10 X B4. Does the plan address NFIP insured structures within the jurisdiction that have been repetitively damaged by floods? (Requirement §201.6(c)(2)(ii)) 7.2-4 X ELEMENT B: REQUIRED REVISIONS ELEMENT C. MITIGATION STRATEGY C1. Does the plan document each jurisdiction’s existing authorities, policies, programs and resources and its ability to expand on and improve these existing policies and programs? (Requirement §201.6(c)(3)) a. Does the plan document each jurisdiction’s existing authorities, policies, programs and resources? P 9-6 to 9-9 X b. Does the plan document each jurisdiction’s ability to expand on and improve these existing policies and programs? P 9-7 to 9-9 X C2. Does the plan address each jurisdiction’s participation in the NFIP and continued compliance with NFIP requirements, as appropriate? (Requirement §201.6(c)(3)(ii)) P 7.2-4 X C3. Does the plan include goals to reduce/avoid long-term vulnerabilities to the identified hazards? (Requirement §201.6(c)(3)(i)) P 1-1 to 1-3 X C4. Does the plan identify and analyze a comprehensive range of specific mitigation actions and projects for each jurisdiction being considered to reduce the effects of hazards, with emphasis on new and existing buildings and infrastructure? (Requirement §201.6(c)(3)(ii)) a. Does the plan identify and analyze a comprehensive range of specific mitigation actions and projects to reduce the impacts from hazards? 9-1 to 9-6 X b. Does the plan identify mitigation actions for every hazard posing a threat to each participating jurisdiction? 9-1 to 9-6 X c. Do the identified mitigation actions and projects have an emphasis on new and existing buildings and infrastructure? P 9-1, 9-2, 9-4, 9-6 X 6 FEMA Region IX Local Mitigation Plan Review Tool 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met C5. Does the plan contain an action plan that describes how the actions identified will be prioritized (including cost benefit review), implemented, and administered by each jurisdiction? (Requirement §201.6(c)(3)(iv)); (Requirement §201.6(c)(3)(iii)) a. Does the plan explain how the mitigation actions will be prioritized (including cost benefit review)? P 9-1, 10-2 X b. Does the plan identify the position, office, department, or agency responsible for implementing and administering the action, potential funding sources and expected timeframes for completion? P 9-1 to 9-4, 9-6 X C6. Does the plan describe a process by which local governments will integrate the requirements of the mitigation plan into other planning mechanisms, such as comprehensive or capital improvement plans, when appropriate? (Requirement §201.6(c)(4)(ii)) a. Does the plan identify the local planning mechanisms where hazard mitigation information and/or actions may be incorporated? P1-4,9-6 to 9-7, 10-1 to 10-2 X b. Does the plan describe each community’s process to integrate the data, information, and hazard mitigation goals and actions into other planning mechanisms? P 9-6 to 9-7, 10-1 to 10-2 X c. The updated plan must explain how the jurisdiction(s) incorporated the mitigation plan, when appropriate, into other planning mechanisms as a demonstration of progress in local hazard mitigation efforts. P 9-6 to 9-7, 10-1 to 10-2 X ELEMENT C: REQUIRED REVISIONS ELEMENT D. PLAN REVIEW, EVALUATION, AND IMPLEMENTATION (Applicable to plan updates only) D1. Was the plan revised to reflect changes in development? (Requirement §201.6(d)(3)) P 4-1, 4-4 X D2. Was the plan revised to reflect progress in local mitigation efforts? (Requirement §201.6(d)(3)) P 5-4 to 5-9 X D3. Was the plan revised to reflect changes in priorities? (Requirement §201.6(d)(3)) P 1-5 X ELEMENT D: REQUIRED REVISIONS ELEMENT E. PLAN ADOPTION E1. Does the plan include documentation that the plan has been formally adopted by the governing body of the jurisdiction requesting approval? (Requirement §201.6(c)(5)) P 2-1 X FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 7 1. REGULATION CHECKLIST Regulation (44 CFR 201.6 Local Mitigation Plans) Location in Plan (section and/or page number) Met Not Met E2. For multi-jurisdictional plans, has each jurisdiction requesting approval of the plan documented formal plan adoption? (Requirement §201.6(c)(5)) NA ELEMENT E: REQUIRED REVISIONS OPTIONAL: HIGH HAZARD POTENTIAL DAM RISKS (Applicable to jurisdictions interested in becoming sub applicants to FEMA’s Rehabilitation of High Hazard Potential Dams (HHPD) Grant Program only) HHPD1. Did Element A4 (planning process) describe the incorporation of existing plans, studies, reports, and technical information for high hazard potential dams? HHPD2. Did Element B3 (risk assessment) address HHPDs? HHPD3. Did Element C3 (mitigation goals) include mitigation goals to reduce long- term vulnerabilities from high hazard potential dams that pose an unacceptable risk to the public? HHPD4. Did Element C4-C5 (mitigation actions) address HHPDs prioritize mitigation actions to reduce vulnerabilities from high hazard potential dams that pose an unacceptable risk to the public? REQUIRED REVISIONS ELEMENT F. ADDITIONAL STATE REQUIREMENTS (Optional for State Reviewers only; not to be completed by FEMA) F1. F2. ELEMENT F: REQUIRED REVISIONS 8 FEMA Region IX Local Mitigation Plan Review Tool SECTION 2: PLAN ASSESSMENT A. Plan Strengths and Opportunities for Improvement This section provides a discussion of the strengths of the plan document and identifies areas where these could be improved beyond minimum requirements. Element A: Planning Process Strengths: 1) The City did a nice job of involving the public through both a public meeting and surveys. 2) The City clearly incorporates the review of existing studies, reports, and technical information into the plan. Opportunities for Improvement: 1) In future plans, please provide documentation such as sign-in sheets or # of surveys received that evidence how the public was given the opportunity to be involved in the HMP development process. 2) With respect to monitoring plan implementation, in future plans, consider describing the system by which the status of actions will be tracked – this could be as simple as a spreadsheet or a more complex web-based tool. 3) In addition to the avenues for public involvement listed in the plan, consider celebrating successes with the community, such as sharing with the public when the plan is approved, or when a mitigation action is successfully completed, through avenues such as websites, newsletters, or social media. Element B: Hazard Identification and Risk Assessment Strengths: 1) The plan contains succinct and clear descriptions of the hazards that can affect the City, and comprehensive descriptions of potential impacts and previous occurrences. Opportunities for Improvement: 1) The plan includes a well-developed community profile section. In future plans, consider weaving these community aspects in with the discussion of vulnerabilities for each hazard. This was done nicely with wildfire hazard – connecting development growth into Wildland Urban Interface areas and the vulnerabilities associated with wildfire. Are there other unique sectors of communities within Arcadia that are particularly vulnerable to the other hazards potentially impacting the city? 2) In some cases, only certain areas of a community may be at risk to an identified hazard, while in other cases, the whole community may be equally at risk to a particular hazard. In future plans, if the whole city is at equal risk to a hazard, please note this explicitly in the plan. FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 9 Element C: Mitigation Strategy Strengths: 1) The plan does an excellent job listing existing authorities, policies, programs and resources and directly addresses how the jurisdiction could expand and improve. Opportunities for Improvement: 1) It is important that mitigation actions and strategies be clear and actionable. While the mitigation strategies included in the current plan are adequate, they are somewhat broad which could make implementation challenging. In future plans, consider crafting strategies that are more detailed and actionable, such as the items listed under the ‘ideas for implementation’. Element D: Plan Update, Evaluation, and Implementation (Plan Updates Only) Strengths: 1) The plan comprehensively and clearly addresses changes in development and how these changes increase vulnerabilities, particularly in the Wildland Urban Interface. Opportunities for Improvement: 1) None at this time. 10 FEMA Region IX Local Mitigation Plan Review Tool B. Resources for Implementing and Updating Your Approved Plan This resource section is organized into three categories: 1) Guidance and Resources 2) Training Topics and Courses 3) Funding Sources Guidance and Resources Local Mitigation Planning Handbook https://www.fema.gov/media-library/assets/documents/31598 Level Up! Podcast Series on Hazard Mitigation https://www.georgetownclimate.org/articles/level-up-audio-project.html Beyond the Basics http://mitigationguide.org/ Mitigation Ideas https://www.fema.gov/media-library/assets/documents/30627 Plan Integration: Linking Local Planning Efforts https://www.fema.gov/media-library/assets/documents/108893 Coastal Plan Alignment Compass https://resilientca.org/topics/plan-alignment/ Integrating Disaster Data into Hazard Mitigation Planning https://www.fema.gov/media-library/assets/documents/103486 Integrating Historic Property and Cultural Resource Considerations into Hazard Mitigation Planning https://www.fema.gov/ar/media-library/assets/documents/4317 Guides to Expanding Mitigation https://www.fema.gov/about/organization/region-2/guides-expanding-mitigation Community Rating System User Manual https://www.fema.gov/media-library/assets/documents/8768 U.S. Climate Resilient Toolkit https://toolkit.climate.gov/ 2018 National Climate Assessment https://nca2018.globalchange.gov/ Managing the Risks of Extreme Events and Disasters to Advance Climate Change Adaptation http://ipcc-wg2.gov/SREX/images/uploads/SREX-All_FINAL.pdf FY15 Hazard Mitigation Assistance Unified Guidance https://www.fema.gov/media-library/assets/documents/103279 A Guide to Supporting Engagement and Resiliency in Rural Communities https://www.fema.gov/sites/default/files/documents/fema_rural-guide_jan-2021.pdf Guide to Virtual Hazard Mitigation Planning Meetings https://www.mass.gov/doc/guide-to-virtual-hazard-mitigation-planning- meetings/download#:%7E:text=Guide%20to%20Virtual%20Hazard%20Mitigation%20Planning%20Meetings.% 20This,valuable%20input%20into%20the%20mitigation%20planning%20process,%20from FEMA Region IX Local Hazard Mitigation Plan Review Tool (Version 4/12/2021) 11 Training More information at https://training.fema.gov/emi.aspx or through your State Training Officer Mitigation Planning IS-318 Mitigation Planning for Local and Tribal Communities https://training.fema.gov/is/courseoverview.aspx?code=is-318 IS-393 Introduction to Hazard Mitigation https://training.fema.gov/is/courseoverview.aspx?code=is-393.a G-318 Preparing and Reviewing Local Plans G-393 Mitigation for Emergency Managers Hazard Mitigation Assistance (HMA) Grant Programs IS-212.b Introduction to Unified HMA http://www.training.fema.gov/is/courseoverview.aspx?code=IS-212.b IS-277 Benefit Cost Analysis Entry Level http://www.training.fema.gov/is/courseoverview.aspx?code=IS-277 E-212 HMA: Developing Quality Application Elements E-213 HMA: Application Review and Evaluation E-214 HMA: Project Implementation and Programmatic Closeout E-276 Benefit-Cost Analysis Entry Level GIS and Hazus-MH IS-922 Application of GIS for Emergency Management http://www.training.fema.gov/is/courseoverview.aspx?code=IS-922 E-190 ArcGIS for Emergency Managers E-296 Application of Hazus-MH for Risk Assessment E-313 Basic Hazus-MH Floodplain Management E-273 Managing Floodplain Development through the NFIP E-278 National Flood Insurance Program/ Community Rating System Potential Funding Sources Hazard Mitigation Grant Program POC: FEMA Region IX and State Hazard Mitigation Officer Website: https://www.fema.gov/hazard-mitigation-grant-program Building Resilient Infrastructure and Communities Grant Program POC: FEMA Region IX and State Hazard Mitigation Officer Website: https://www.fema.gov/grants/mitigation/building-resilient-infrastructure-communities Flood Mitigation Assistance Grant Program POC: FEMA Region IX and State Hazard Mitigation Officer Website: https://www.fema.gov/flood-mitigation-assistance-grant-program Emergency Management Performance Grant Program POC: FEMA Region IX Website: https://www.fema.gov/emergency-management-performance-grant-program 12 FE M A R I X L o c a l M i t i g a t i o n P l a n R e v i e w T o o l SE C T I O N 3 : MU L T I - J U R I S D I C T I O N A L S U M M A R Y S H E E T IN S T R U C T I O N S : F o r m u l t i - j u r i s d i c t i o n a l p l a n s , t h i s s u m m a r y s h e e t m u s t be c o m p l e t e d b y l i s t i n g e a c h p a r t i c i p a t i n g j u r i s d i c t i o n t h a t i s el i g i b l e t o a d o p t t h e p l a n . MU L T I -JU R I S D I C T I O N SU M M A R Y SH E E T # Ju r i s d i c t i o n N a m e Ju r i s d i c t i o n T y p e El i g i b l e t o Ad o p t t h e Pl a n ? Pl a n P O C Em a i l 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 13 FE M A R I X L o c a l M i t i g a t i o n P l a n R e v i e w T o o l SE C T I O N 4 : HA Z A R D I D E N T I F I C A T I O N A N D R I S K A S S E S S M E N T M A T R I X ( O P T I O N A L ) IN S T R U C T I O N S : T h i s m a t r i x c a n b e u s e d b y t h e p l a n r e v i e w e r t o h e l p i d en t i f y i f a l l o f t h e c o m p o n e n t s o f E l e m e n t B h a v e b e e n m e t . Li s t o u t n a t u r a l h a z a r d n a m e s t h a t a r e i d e n t i f i e d i n t h e p l a n i n t h e c o l u m n l a b e l e d “ H a z a r d s ” a n d p u t a “ Y ” o r “ N ” f o r e a c h co m p o n e n t o f E l e m e n t B . HA Z A R D I D E N T I F I C A T I O N A N D R I S K A S S E S S M E N T M A T R I X Ha z a r d Re q u i r e m e n t M e t ? ( Y / N ) Ty p e Lo c a t i o n Ex t e n t Pr e v i o u s Oc c u r r e n c e s Pr o b a b i l i t y Im p a c t s Vu l n e r a b i l i t y Mi t i g a t i o n Ac t i o n Ea r t h q u a k e P 7 . 1 - 1 P 7 . 1 - 1 0 , 7 . 1 - 4 P 7 . 1 - 1 t o 7. 1 - 4 P 7 . 1 - 1 t o 7 . 1 - 3 P 7 . 1 - 5 P 7 . 1 - 1 t o 7. 1 . - 3 ; P 7 . 1 - 5 to 7 . 1 -9 P 7 . 1 - 5 t o 7 . 1 - 9 9- 2 Fl o o d P 7 . 2 -1 to 7. 2 -2 P 7 . 2 -4, 7 . 2 -8, 7. 2 -9 P 7. 2 -3 P 7 . 2 -2 t o 7 . 2 - 4 P 7. 2 -4, 7 . 2 -8, 7. 2 -9 P 7 . 2 -3, 7 . 2 -5 to 7 . 2 -6 P 7 . 2 -5 to 7 . 2 - 7 Sl o p e F a i l u r e - De b r i s / M u d F l o w P 7. 3 -1 P 7 . 3 -6, 7 . 3 -9 P 7. 3 -1 P 7. 3 -2 to 7 . 3 - 4 7. 3 -5 t o 7 . 3 -6 P 7. 3 -2 to 7. 3 - 4 , 7 . 3 - 6 to 7 . 3 -7 P 7 . 3 . 4 , 7. 3 -6 to 7 . 3 - 8 9-3 Wi n d s t o r m P 7. 4 -1 P 7 . 4 -5 7. 4 -1 t o 7 . 4 -4 P 7. 4 -3 t o 7 . 4 - 4 7. 4 -4 7. 4 -3 t o 7 . 4 . 9 P 7. 4 . 3 -7. 4 . 9 9-4 Wi l d f i r e P 7. 5 -1 7. 5 -11 7. 5 -3 t o 7 . 5 -6 P 7. 5 -2 t o 7 . 5 - 4, 7 . 5 - 6 7. 5 -6 7. 5 -1, 7. 5 -4 P 7. 5 -1, 7 . 5 -5, 7. 5 - 7 , 7 . 5 - 1 0 to 7 . 5 -11 9-1 Dr o u g h t P 7. 6 -1 7. 6 -1 7. 6 -1 t o 7 . 6 - 3, 7 . 6 -8 P 7. 6 -2 t o 7 . 6 - 6 7. 6 -8 7. 6 -6 to 7 . 6 -7 7. 6 -10 9-6 Local Hazard Mitigation Plan 2022 Section 4 Community Profile 4-1 Why Plan for Hazards in City of Arcadia? Hazards can impact citizens, property, environment, and the economy of City of Arcadia. Earthquakes, flood, Slope Failures, windstorms, wildfires, drought, hazardous materials, transportation emergencies and terrorism have exposed City of Arcadia residents and businesses to the financial and emotional costs of recovering after disasters. The risk associated with hazards increases as more people move to areas affected by those hazards. - land remaining for development; population density continues to increase when low- density housing is replaced with medium and high-density development projects. The inevitability of hazards, and the growing population and activity within the City create an urgent need to develop strategies, coordinate resources, and increase public awareness to reduce risk and prevent loss from future hazardous events. Identifying the risks posed by hazards, and developing strategies to reduce the impact of a hazardous event can assist in protecting the life and property of communities. Local residents and businesses can work together with the City to create a Local Hazard Mitigation Plan that addresses the potential impacts of hazard events. Geography and the Environment City of Arcadia has an area of 11.3 square miles and is located in Greater Los Angeles County area. Elevations in the City range from a high of 1,200 feet to a low of 300 feet. The terrain of the city is from the valley floor sweeping to the foothills. Community Profile The 11.3 square mile City of Arcadia Located in the western San Gabriel Valley south of the San Gabriel Mountains, Arcadia, also known as the "Community of Homes", is a picturesque, affluent, largely built out community, with an outstanding public school system. The Los Angeles County Arboretum, Westfield Mall at Santa Anita, Santa Anita Race Track, Arcadia County Park, and the Santa Anita Golf Course annually attract a substantial number of visitors into Arcadia from Southern California. With its rich history and quality of development, Arcadia will remain a premier community. Transportation The 210 freeway serves the City, and the major arterial highways are Santa Anita Avenue and Baldwin Avenue, which run north to south and Huntington Drive (Route 66), Live Oak Avenue, Duarte Road, Foothill Boulevard and Longden Avenue, which run east to west. The City also has a light rail transportation system running through the center of town. Los Angeles County Metropolitan Transportation Authority operates the Metro Gold Line light rail system. The Gold Line operates a 31 mile light rail between Azusa and East Los Angeles. There is a station in the center of town with parking for 300 vehicles. The estimated weekday ridership of the Gold Line is 49,500 riders. The MTA also operates various bus lines within the City of Arcadia. Local Hazard Mitigation Plan 2022 Section 4 Community Profile 4-2 Major Rivers The nearest major river is the Los Angeles River (or San Gabriel River). This River does not have any potential impact on the City of Arcadia. Normally this river channel is dry and only carries a significant water flow during a major rainstorm. The river channel is a concrete channel and part of the Los Angeles County Flood Control District. Climate Temperatures in the City of Arcadia range from 40 degrees in the winter months to 100 degrees in the summer months. However the temperatures can vary over a wide range, particularly when the Santa Ana winds blow, bringing higher temperatures and very low humidity. Temperatures rarely exceed 110 degrees F in the summer months (June - September), and rarely drop below 30 F in the winter months (November-March). The City of Arcadia over the last seventy years of recorded rainfall has had a low of 5.27 inches of rainfall in 1947 to a high of 41.23 in 1969. Rainfall in the city averages eighteen inches of rain per year. Furthermore, actual rainfall in Southern California tends to fall in large amounts during sporadic and often heavy storms rather than consistent storms at somewhat regular intervals. In short, rainfall in Southern California might be characterized as feast or famine within a single year. Because the metropolitan basin is largely built out, water originating in higher elevation communities can have a sudden impact on adjoining communities that have a lower elevation. Minerals and Soils The characteristics of the minerals and soils present in City of Arcadia indicate the potential types of hazards that may occur. Rock hardness and soil characteristics can determine whether or not an area will be prone to geologic hazards such as earthquakes, liquefaction and Slope Failures. Arcadia is located at the foothills of the San Gabriel Mountains in the Transverse Ranges Geomorphic province of Southern California. The City overlays two groundwater basins: The Raymond Water Basin on the north and the San Gabriel Water Basin on the south. The basins are separated by the northeast trending Raymond Fault, which acts as a hydrological barrier, and defines the boundary between the two. The Raymond Basin is an alluvial valley covering approximately 40 square miles and is bordered by the San Gabriel Mountains on the north, San Rafael Hills on the west, and the Raymond Fault on the south and east. The general east-west trend of the San Gabriel Mountains, the north-south trend of the San Rafael Hills, and northeast trend of the Raymond Fault result in the basin having a triangular form. The limits of the San Gabriel Valley are generally defined on the north by the San Gabriel Mountains and the Raymond Fault, on the west by the Repetto and Merced Hills, on the south by the Puente Hills, and on the east by the San Jose Hills. The total area of Local Hazard Mitigation Plan 2022 Section 4 Community Profile 4-3 the alluvial valley is approximately 167 square miles. Arcadia is located at the extreme northwest portion of the San Gabriel Valley. Bedrock: The bedrock geology of the Raymond Basin and vicinity consists of a complex array of granitic and metagranitic rocks of pre-Cretaceous age. Although outcrops are typically fractured, the granitic bedrock underlying the alluvial sediment at the base of the basin is not considered water bearing. Older and Younger Alluvium: Total alluvial thickness is as much as 1,100 feet in the Raymond Basin and as much as 1,900 feet in the San Gabriel Basin. The older alluvium is distributed throughout the entire basin and its water transmitting properties vary depending upon the degree to which it has been weathered and/or cemented. Older alluvium consists primarily of sand, gravel and boulders with minor interbedded clay layers. Younger alluvium consists predominantly of sand, gravel and boulders, is less consolidated than the older alluvium and yields water more readily and consistently. Faulting and Ground Water Barriers: Major faults in the vicinity of Arcadia include the Sierra Madre Fault Zone and the Raymond Fault. The Raymond Fault is the most geohydrologically significant fault in Arcadia. The fault acts as a barrier impeding ground water movement from the Raymond Basin into the Main San Gabriel Basin to the south. The barrier effect is reflected by significant differences in ground water level across the fault. In addition, artesian conditions and ponded surface water have been observed north of the fault during periods Concerns: Based on the Raymond Fault creating a ground water barrier the area located to the north of the fault can be prone to the occurrence of liquefaction or has the potential for permanent ground displacement. The steep foothills of the San Gabriel Mountains have a potential of the earthquake-induced Slope Failures or the permanent ground displacement in the north part of Arcadia. Other Significant Geologic Features The City of Arcadia, like most of the Los Angeles Basin, lies over the area of one or more known earthquake faults, and potentially many more unknown faults, particularly so-called lateral or blind thrust faults. The major faults that have the potential to affect the greater Los Angeles Basin, and therefore the City of Arcadia are: San Andreas, Newport Inglewood, Palos Verdes, Whittier, Santa Monica, Raymond, and Sierra Madre. In addition, many areas in the Los Angeles Basin have sandy soils that are subject to liquefaction and land movement. Local Hazard Mitigation Plan 2022 Section 4 Community Profile 4-4 Population and Demographics City of Arcadia has an estimated population of about 59,000 in an area of 11.3 square miles. has increased annually at a rate of 4.3% since 2010. The increase of people living in City of Arcadia creates more community exposure, and changes how agencies prepare for and respond to hazards. For example, more people living on the urban fringe increase the risk of wildfire. Wildfire has an increased chance of starting due to human activities in the urban/rural interface, and has the potential to injure more people and cause more property damage. Furthermore, increased density can affect risk. For example, narrower streets are more difficult for emergency service vehicles to navigate, the higher ratio of residents to emergency responders affects response times, and homes located closer together increase the chances of fires spreading. The ethnic and cultural diversity suggests a need to address multi-cultural needs and services. Vulnerable populations, including seniors, disabled citizens, women, and children, those people may be disproportionately impacted by disasters. Land and Development including residential, commercial and industrial areas. This plan is one of the City's most important tools in addressing environmental challenges including transportation, air quality, growth management, conservation of natural resources, clean water, and open spaces. The environment of most Los Angeles County cities is nearly identical with that of their immediate neighbors and the transition from one incorporated municipality to another is seamless to most people. Seamless too are the exposures to the hazards that affect all of Southern California. Housing and Community Development In the City of Arcadia, the demand for housing outstrips the available supply, and the recent low interest rates have further fueled a pent up demand. There are more single family homes in the City in comparison to the number of apartments and condominiums. The development of condominiums has increased significantly along with the development of mixed-use properties. Employment and Industry Employment and Industry - The City of Arcadia has a very broad employment base. There are major retail, industrial, office, and specialty employers throughout the City. Local Hazard Mitigation Plan 2022 Section 4 Community Profile 4-5 The major employers in the City include the Santa Anita Race Track, Methodist Hospital of Southern California, and the Westfield at Santa Anita. The City of Arcadia also lies within a "Sixty Mile Circle" centered on Los Angeles, a dynamic concentration of population, employment, business, industry and finance. Two- thirds of the State's 100 largest corporations are headquartered within the circle. Additionally, several federal and state highways, two nearby rail lines, and three international airports, as well as the 210 Freeway passing through Arcadia, provide ready access to regional, national and international markets. Mitigation activities are needed at the business level to ensure the safety and welfare of workers and limit damage to industrial infrastructure. Employees are highly mobile, commuting from surrounding areas to industrial and business centers. This creates a greater dependency on roads, communications, accessibility and emergency plans to reunite people with their families. Before a disastrous event occurs large and small businesses can develop strategies to prepare, respond efficiently, and prevent loss of life and property. Transportation and Commuting Patterns The City of Arcadia is located in the Los Angeles Metropolitan Statistical Area (LAMSA) The I-210 Foothill Freeway traverses the City of Arcadia, connecting the city to east and north valleys of Los Angeles County, and the I-605 San Gabriel Freeway is located four -mile road system includes 37 miles of arterial highways, 113 miles of local roads, and 37 bridges. Private automobiles are the dominant means of transportation in Southern California and in the City of Arcadia. However, the City of Arcadia meets its public transportation needs utilizing the numerous local public transportation options available in the region. The Los Angeles County Metropolitan Transportation Authority (LACMTA) and Foothill Transit operate a total of 11 bus routes and one light rail line through the city. Additionally, the Arcadia Transit offers Arcadia residents convenient, affordable transit within the city limits and to five (5) designated medical facilities located beyond the city limits. The City participates in regional efforts to improve air quality by promoting rideshare alternatives to its employees. DRR DCANYON SUNSET MICHILLINDA ORANGE GROVE ELKINS AV HI G H L A N D VIS TA LAS TUNAS DR C EN TE N NIAL REAL GOLDRING CLARK A Z U S A R D L O W E R PECK RD L I V E OA K A V RD CAMINO SIERRA MADRE BL AV AV GRAND VIEW DR OAKS HIGHLAND ST JOSEPH ST DR CAMPUS DR D U A R TE AV W AY H U NTIN GTO N BALDWIN AV HUNTINGTON AV 6TH AV 10TH 1STAV AV ANITA SANTA EL MONTE REALCAMINO HOLLY R D AV AV AV LONGDEN AV 2ND GOLDEN WEST BALDWI N BL BLADWIN AV COLORADO BL D R HUNTINGTON BLFOOTHILL COLORADO ST SANTA CLARA ST ARCADIA H S HUGO REID PRIMARY SERENDIPITY SCHOOL CONTINUATION SCHOOL HUGO REID ELEM. BALDWIN STOCKER ELEM. LONGLEY WAY ELEM. CAMINO GROVE ELEM. RICHARD H DANA JR H S 1ST AVENUE JR H S FOOTHILLS JR H S HIGHLAND OAKS ELEM HOLLY AVENUE ELEM TIERRA VERDE PARK WINNIE WAY PARK BICENTENNIAL PARK LONGDEN AVENUE PARK BALDWIN STOCKER PARK HOLLY AVENUE PARK FAIRVIEW AVENUE PARK WILDERNESS PARK TRIPOLIS FRIENDSHIP PARK HUGO REID PARK CIVIC CENTE R ATHLETIC FIELD HIGHLAND OAKS PARK PARK BONITA EISENHOWER PARK FOREST PARK PARK GROVE CAMINO ORANGE GROVE PARK NEWCASTLE PARK FYFOOTHILLRTE 210 RTE 210 LI M A PUBLIC WORKS SERVICES DEPARTMENT CHAMBER OF COMMERCE RECREATION & COMMUNITY SERVICES DEPARTMENT M ETH O DIST HO SPITAL WESTFIELDSHOPPING TOWNATSANTA ANITA PD ARCADIA P E C K R O A D W A T E R & C O N S E R V A TIO N P A R K GOLF ARCADIA S A N T A A N I T A W A SH FIRESTATION ANITA SA N T A WA S H LIBRARY STATION FI R E W A S H S I E R R A M A D R E D E B R I S D I S P O S A L SAWPIT GOLF COURSE SANTA ANITA P A R K A R C A D I A C O U N T YC I T Y STATION FI R E A R B O R E T U M S T A T E A N D C O U N T Y L O S A N G E L E S RACE TRACK P A R K ANITA SANTA WASH A R C A DIA ARCADIA EA S T BRANCH LATER A L A R E A WASH H A L L COURSE GROVE PLANT ORANGE ST JOSEPHPLANT PECK ROADPLANT SANTA ANITA PLANT LIVE OAKPLANT LOWERCANYON PLANT UPPER CANYON PLANT LONGLEY WELL LONGDENPLANT BALDWIN PUMP PLANT RANCHO WELL NO. 6 HUGO REID WELL BALDWIN WELL NO. 2 CHAPMAN PLANT ANOKIA WELL CAMINO REAL PLANT TORREY PINE RESERVOIRS 3 8 1 2 9 6 5 10 4 HIGH PRESS URE GAS PIPELINE HIGH PRESSURE HIGH PRESSURE GAS PIPELINE HIGH PRE SSURE GAS PIPELINE HIGH PRESSURE GAS PIPELINE GAS PIPELINE 7 11 ARCADIA GOLDLINE STATION RESERVOIRS CRITICAL BUILDINGS HIGH PRESSURE GAS PIPELINE Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-1 The City of Arcadia Local Hazard Mitigation Plan integrates a cross-section of citizen input throughout the planning process. To accomplish this goal, the City of Arcadia Hazard Mitigation Advisory Committee developed a public participation process through three components: (1) developing a planning committee; (2) conducting stakeholder interviews to target the specialized knowledge of individuals working with populations or areas at risk from natural hazards; and (3) conducting one public workshops to identify common concerns and ideas regarding hazard mitigation and to discuss specific goals and actions of the mitigation plan. Integrating public participation during the development of the City of Arcadia Local Hazards Mitigation Plan has ultimately resulted in increased public awareness. Through citizen involvement, the mitigation plan reflects community issues, concerns, and new ideas and perspectives on mitigation opportunities and plan action items. Local Hazard Mitigation Plan Committee The first step in reviewing and updating the Local Hazard Mitigation Plan was to develop a committee comprised of at least one member of each department within the City. Table B.1 lists the committee members and their department at the beginning of the review. Table B.2 lists the current committee members and their department. Initial Local Hazard Mitigation Planning Committee Table B.1 Name Title Department Barry Spriggs Battalion Chief - Project Manager Fire Todd Morehead Fire Captain Fire Paul Foley Police Captain Police Jackie Mercado Management Analyst Public Works Ryan Wright Assistant Recreation Director Recreation and Community Services Roger Hiles Library Services Manager Library and Museum Services Vanina Rynkiewicz Purchasing Officer Administrative Services Jim Kasama Planning and Community Development Director Development Services Laena Shakarian Management Analyst City Manager's Office Current Local Hazard Mitigation Planning Committee Table B.2 Name Title Department Barry Spriggs Fire Chief - Project Manager Fire Tom Devlin Battalion Chief Fire Charlie Tuggle Fire Captain Fire Tom Cullen Lieutenant Police Carmen Masud Senior Management Analyst Public Works Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-2 Candice Cheung Assistant Recreation Director Recreation and Community Services Roger Hiles Library Services Manager Library and Museum Services Vanina Rynkiewicz Purchasing Officer Administrative Services Lisa Flores Planning and Community Development Director Development Services Jennifer Brutus Senior Management Analyst City Manager's Office Meetings Members of the Committee had several meetings amongst themselves, with employees with special areas of expertise, and with outside representatives. Though not every meeting was logged the following list gives a brief synopsis of the meetings and their content. January 18, 2017 to February 25, 2017 There were many meetings amongst only two individuals that did not get logged. The meetings were often between the project leader and another committee member to ensure the timely completion of a specific task. They also entailed preparation for upcoming stakeholder, committee, and community meetings. January 11, 2017 The City of Arcadia Local Hazard Mitigation Plan Committee assembled and provided an overview to the committee about the current Natural Hazard Mitigation Plan and the review process that was about to be undertaken. The project Manager introduced the planning committee. Each committee member described the department they represented. The goals from the current NHMP were reviewed and assessed as to their completion. Various tasks were assigned to each member of the committee. The committee agreed on the need to add drought, hazardous materials, and terrorism to the new LHMP. February 8, 2017 The Committee met and the project manager discussed the following: Committee Members completed Worksheet #1 Identifying the hazards and Worksheet #2 Asset Identification Checklist. Committee members reviewed the base map from the previous plan and added an additional 12 critical facilities to the base map including the Gold Line Light Rail. Methods to gain community input were discussed including a community meeting, stakeholder meeting and advertising the process through the City Hot Sheet and Quarterly Newsletter. Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-3 March 17, 2017 The Committee met and the project manager discussed the following: LHMP hazards were discussed in the February meeting. The committee decided to group the hazards into two large categories, natural and human caused. The natural hazards addressed by the plan are: Wildfire, Earthquake, Flood, Windstorm, Debris Flow/Landslide, Drought. The human caused hazards will be Hazardous Materials, Transportation and Terrorism Dates were set for the public meeting and the stakeholder meeting. The public meeting will be April 10, 2017 and the Stakeholder Meeting will be April 12, 2017. Mitigation items for the hazards were also discussed at this meeting. October 2018 Project manager met with Arcadia Public Works Services Division and updated base maps and hazard maps for the community. February 12, 2019 The LHMP Committee met and were asked to provide feedback to develop mitigation goals for the new plan. Feedback from the committee was obtained the following week and the mitigation goals for the plan were finalized. Community Meeting Community members were invited to a meeting to review the current and new hazards the City is including in the mitigation plans. This was an opportunity for the community to learn what the City is doing and also for members of the community to provide their input on the hazards that they felt necessary to plan for. The committee also provided a questionnaire to the attendees in order to gain further input. The meeting was announced to the public following the Cities regular announcement procedures. The meeting information was published in the newspaper and on the City website Meeting was conducted on: April 10, 2017 at 1900hrs in the Council Chambers Conference Room Stakeholders Meeting Stakeholders were invited to a meeting on April 12, 2017 at Fire Station 106 to review the current and new hazards the City is including in the mitigation plans. This was an opportunity for the organizations to learn what the City is doing and also to provide their input on the hazards that they felt necessary to plan for. The committee also provided a questionnaire to the stakeholders in order to gain further input. Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-4 The following stakeholders were all contacted about the meeting via phone and or email. Mitigation Plan Stakeholders Table B.3 Arcadia Methodist Hospital American Red Cross Sierra Madre Fire Department Monrovia Fire and Rescue Arcadia Unified School District Chamber of Commerce Santa Anita Racetrack Westfield Shopping Towne SoCal Edison SoCal Gas Company CalTrans Office of Civil Defense Disaster Management Metro Goldline Review of the 2012 Local Hazard Mitigation Plan An important part of the planning process is to evaluate the plan that was approved by the City Council and FEMA in 2012. During its meetings the Local Hazard Mitigation Plan Committee reviewed the sections of the plan. Both the multi hazard goals and the specific hazard goals were reviewed to see if they had been achieved during the five-year period or if the goals were still a work in progress. The hazards that were addressed in the 2012 plan were also looked at. The eight hazards: Earthquake, Landslide/Debris Flow, Flood, Wildfire, Windstorm, Drought, Terrorism, Hazardous Materials were considered to still be hazards to the community. Action Items from the 2012 Natural Hazard Mitigation Plan The following action items were placed into three categories based on the 2012 Local Hazard Mitigation Plan Committee s recommendations. The LHMP Committee considered ease, cost, and importance of completion. The following three categories rank the achievability of each action item; category one action items being the action items to be completed first, and respectively category three being the last. Category One Flood A Enhance the City of Arcadia s dam failure preparedness. Ideas for Implementation: Incorporate dam inundation maps into the EOP. - Completed Coordinating Organization: Fire Department Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-5 Funding Source: Fire Department Timeline: Within the next six months Constraints: Limited staff time Wildfire A Enhance emergency services to increase the efficiency of wildfire response. Ideas for Implementation: Continue to update the City of Arcadia Brush Plan. Updated Summer 2021 Develop, approve, and promote fire protection agreements and partnerships. Updated June 2021 Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Ongoing Constraints: none Wildfire B Continue to educate the public on wildfire safety. Ideas for Implementation Continue to utilize the Arcadia Fire Department Brush Clearance Inspection Program. - Completed Continue to utilize the Arcadia Fire Prevention Bureau public service announcements. Completed and Ongoing Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Ongoing Constraints: Funding Multi Hazard A & B Multi Hazard A Continue to develop and implement programs that encourage Arcadia residents and business owners to prepare for an emergency or disaster situation. Multi Hazard B Create and maintain communication vehicles through which the City can communicate with the public on both an outgoing and incoming basis. Implementation Ideas: Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-6 Work with City departments to develop and distribute informational pamphlets concerning specific areas of emergency and disaster preparedness. - Ongoing Work with City departments and the School District to provide age-appropriate emergency preparedness information to students. - Ongoing Promote emergency/disaster preparedness to the local business community by reaching out to local merchants and to the Chamber of Commerce. Conducted safety presentations As appropriate, work with the Fire and Police Departments to update the preparedness information contained on the City website. In the event of a significant local disaster use the website to inform the public on a timely basis of the status of the emergency, evacuation plans and any other information that is pertinent to their well-being. On an ongoing basis advise the public that the website will be used to relay important information in the event of an emergency. used to relay information to residents and businesses by way of telephone in the event of a significant disaster. Entered into contract in 2016 Be prepared to implement in a timely fashion, a telephone hotline that residents can call for information and a distribution system that can be used in coordination with other methods to relay critical information. Changed from hotline to links to information on city website. Keep City employees informed about the need to be prepared for an emergency both at home and at work and recall policy. Completed and ongoing Coordinating Organization: City Manager s Office Funding: Office, Fire Department, Police Department, Public Works Services Department Timeline: Ongoing Constraints: Staff time Multi Hazard C Develop an evacuation plan for future disastrous events. Ideas for implementation: Establish procedures for notifying residents in the event that a mandatory evacuation is necessary. - Completed Determine primary and alternate routes for the safe evacuation of residents. Integrate the evacuation routes data into the Ci Operations Plan. Completed and Evacuation annex was evaluated after being put into use during 2020 Bobcat Fire. Develop a plan to coordinate the restriction of inbound traffic into the hazard area. - Completed Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-7 Coordinating Organization: City of Arcadia Development Services, Fire and Police Departments Funding Source: General Fund Timeline: Within the next one year Constraints: Limited staff time, cost Category Two Landslide A Improve the capabilities of managing debris from Landslide events by developing a debris management strategy for the City of Arcadia. Ideas for implementation: Determine the necessary equipment and personnel needed to develop a coordinated response to managing debris. Completed debris management plan annex in City Emergency Operations Plan Identify local debris removal sites and routes to expedite the process of debris removal. - Ongoing Coordinating Organization: City of Arcadia Public Works Services Funding Source: Public Works Timeline: Within the next three years Constraints: Limited staff time, lack of equipment needed to manage debris, cost associated with purchasing equipment. Windstorm A Identify and implement projects to reduce the damage caused by trees during a windstorm. Ideas for Implementation: Continue regular tree trimming procedures: o Continue four-year tree trimming grid for optimum effectiveness to maintain healthy trees. o Ensure trees in the public right-of-way are trimmed to maintain a clearance from all electric power lines as specified in the California Code of Regulations and the California Public Utilities Commission o Continue to remove trees that are dead, diseased, or dying. o Continue the Crown Restoration Program to preserve the health of large aging trees o Ensure proper tree trimming techniques as approved by the Professional Arborist Association o Provide public education materials to residents to make them aware of the need to regularly maintain and trim their own trees Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-8 o Update Urban Forest Master Plan to include type of trees to plant, when to plan, where easement trees will be placed, and how and when they will be maintained. o Completed and updated regularly Create and include a coordination plan with Southern California Edison to determine power line maintenance program and emergency procedures for fallen power lines. - Completed and updated regularly Create an emergency contact list for mutual aid or other responsible agencies to be added to the EOP. Completed and updated regularly Coordinating Organization: Public Works Services Department Funding Source: General Fund and Gas Tax Timeline: Ongoing Constraints: Limited staff time and capital resources to fund Tree Trimming Contractors Status Ongoing Hazardous Materials A Ideas for Implementation: -Mat policy and incorporate it into the EOP. - Completed and ongoing Update known hazardous material storage locations. - Completed and ongoing Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Annually Constraints: Staff time for updating policies Terrorism A Create a Standing Operating Guideline for City personnel responding to a terrorist incident. Implementation Ideas: Meet with representation from the appropriate City departments to develop a SOG that will outline the guidelines for the safest and most efficient way to respond and operate during a terrorist incident. Completed and Ongoing.Terrorism annex added to Emergency Operations Plan. Coordinating Organization: Police Department Funding Source: General Fund, Police, Fire, and Public Works budgets Timeline: One year Constraints: Limited staff time Local Hazard Mitigation Plan 2022 Section 5 Planning Process 5-9 Category Three Multi Hazard D Integrate new earthquake, wildfire, Landslide, and flood hazard mapping data for the City of Arcadia and improve technical analysis of earthquake hazards. Ideas for Implementation: Develop the City of Arcadia earthquake HAZUS data using more localized data including the building inventory to improve accuracy of the vulnerability assessment for the City Arcadia. Not completed Conduct risk analysis incorporating HAZUS data and hazard maps using GIS technology to identify risk sites and further assist in prioritizing mitigation activities and assessing the adequacy of current land use requirements. Not completed Coordinating Organization: Development Services Funding: Unfunded; possibly EOC Timeline: Within the next three years Constraints: Funding for a HAZUS computer; staff time Drought Identify and implement projects to reduce the impact of drought. Ideas for Implementation: Conserve water resources by: o Improving leak detection capability of the Public Works Services Staff o Continuing to provide water audits for indoor/outdoor uses o ater Management Plan to ensure water supply in the future o Funding Capital Improvement Projects to improve the reliability and o Develop and implement a Tiered Water Rate Pricing Structure o Completed - City Public Works developed Drought Master Plan Coordinating Organization: Public Works Services Department Funding Source: Water Fund (revenue generated from billing for water service) Timeline: Short Term (within the next five years) Constraints: Limited staff time, resistance from public and lack of public participation. Local Hazard Mitigation Plan 2022 Section 6 Risk Assessment 6-1 What is a Risk Assessment? Conducting a risk assessment can provide information on the location of hazards, the value of existing land and property in hazard locations, and an analysis of the risk to life, property, and the environment that may result from hazardous events. The following steps were taken into consideration during the risk assessment. Hazard Identification This is the description of the geographic extent, potential intensity, and the probability of occurrence of a given hazard. In the plan approved in 2012, the hazards that were identified were earthquake, landslide, windstorm, wildfire, flooding, drought, terrorism, and hazardous materials. Part of the planning process was to survey residents and stakeholders to see what they felt to be hazards that could affect the City of Arcadia. In addition to the above eight hazards, the surveys indicated that one additional hazard could adversely affect the City of Arcadia. The one additional hazard is transportation. The main reason to add transportation is that since the adoption of the previous plan, a countywide light rail mass transportation system has been extended to and through Arcadia. There are many possible hazards listed by FEMA in Guide 386-2, Understanding Your Risks. This Local Hazard Mitigation Plan will only address those hazards listed above. All of the hazards were considered but many were ruled out based on the survey completed by stakeholders and looking back through historical data for this community. Profiling Hazard Events This process describes the causes and characteristics of each hazard, how it has affected the City of Arcadia in the past, and what part of the City's population, infrastructure, and environment has historically been vulnerable to each specific hazard. The hazards impacting the City of Arcadia can be divided into two broad categories. The categories are natural caused hazards and human caused hazards. A profile of each hazard is provided in each hazard specific section. For a full description of the history of hazard specific events, please see the appropriate hazard chapter. Vulnerability Assessment/Inventorying Assets This is a combination of hazard identification with an inventory of the existing (or planned) property development(s) and population(s) exposed to a hazard. Critical facilities are of particular concern because these entities provide essential products and services to the general public that are necessary to preserve the welfare and quality of life in the City and fulfill important public safety, emergency response, and/or disaster recovery functions. The critical facilities have been identified, mapped, and are illustrated in the City base map. In addition, this plan includes a community issues summary in each hazard section to identify the most vulnerable and problematic areas in the City, including critical facilities, and other public and private property. Local Hazard Mitigation Plan 2022 Section 6 Risk Assessment 6-2 Risk Analysis Estimating potential losses involves assessing the damage, injuries, and financial costs likely to be sustained in a geographic area over a given period of time. Risk Analysis discusses the possible effect of hazards on parts of the City including but not limited to: bridges, critical infrastructure, dams, businesses, and residential areas. Assessing Vulnerability/ Analyzing Development Trends This step provides a general description of land uses and development trends within the community so that mitigation options can be considered in land use planning and future land use decisions. This plan provides comprehensive description of the character of the City of Arcadia in the Community Profile. This description includes the geography and environment, population and demographics, land use and development, housing and community development, employment and industry, and transportation and commuting patterns. Analyzing these components of City of Arcadia can help in identifying potential problem areas and can serve as a guide for incorporating the goals and ideas contained in this mitigation plan into other community development plans. Maps can be found at the back of each hazard specific section for which they are appropriate. *Infrastructure and critical facilities maps have been withheld due to security concerns post 9-11. Note: The information on the maps in this plan was derived from City of Arcadia's GIS. Care was taken in the creation of these maps, but is provided "as is" City of Arcadia cannot accept any responsibility for any errors, omissions or positional accuracy, and therefore, there are no warranties that accompany these products (the maps). Although information from land surveys may have been used in the creation of these products, in no way does this product represent or constitute a land survey. Users are cautioned to field verify information on this product before making any decisions. Hazard assessments are subject to the availability of hazard-specific data. Gathering data for a hazard assessment requires a commitment of resources on the part of participating organizations and agencies. Each hazard-specific section of the plan includes a section on hazard identification using data and information from City, County or State agency sources. Regardless of the data available for hazard assessments, there are numerous strategies the City can take to reduce risk. These strategies are described in the action items detailed in the Mitigation Strategy section of this Plan. Mitigation strategies can further reduce disruption to critical services, reduce the risk to human life, and alleviate damage to personal and public property and infrastructure. Action items throughout the hazard sections provide recommendations to collect further data to map hazard locations and conduct hazard assessments. Local Hazard Mitigation Plan 2022 Section 6 Risk Assessment 6-3 Federal Requirements for Risk Assessment Recent federal regulations for hazard mitigation plans outlined in 44 CFR Part 201 include a requirement for risk assessment. This risk assessment requirement is intended to provide information that will help communities to identify and prioritize mitigation activities that will reduce losses from the identified hazards. There are nine hazards profiled in the mitigation plan, including earthquakes, earth movements, flooding, wildfires, windstorms, drought, terrorism, transportation and hazardous materials. The Local Hazard Mitigation Plan meets those criteria is outlined in Table 3-2 below. Table 3-2. Federal Criteria for Risk Assessment Section 322 Plan Requirement How is this addressed? Identifying Hazards Each hazard section includes an inventory of the best available data sources that identify hazard areas. To the extent GIS data are available, the City developed maps identifying the location of the hazard in the City. The Executive Summary and the Risk Assessment sections of the plan include a list of the hazard maps. Profiling Hazard Events Each hazard section includes documentation of the history, and causes and characteristics of the hazard in the City. Assessing Vulnerability: Identifying Assets Where data is available, the vulnerability assessment for each hazard addressed in the mitigation plan includes an inventory of all publicly owned land within hazardous areas. Each hazard section provides information on vulnerable areas in the City in the Community Issues section. Assessing Vulnerability: Estimating Potential Losses: The Risk Assessment Section of this mitigation plan identifies key critical facilities and lifelines in the City and includes a map of these facilities. Vulnerability assessments have been completed for the hazards addressed in the plan, and quantitative estimates were made for each hazard where data was available. Assessing Vulnerability: Analyzing Development Trends The City of Arcadia Profile Section of this plan provides a description of the development trends in the City, including the geography and environment, population and demographics, land use and development, housing and community development, employment and industry, and transportation and commuting patterns. Critical Facilities and Infrastructure Facilities critical to government response and recovery activities (i.e., life safety and property and environmental protection) include: 911 centers, emergency operations centers, police and fire stations, public works facilities, communications centers, sewer Local Hazard Mitigation Plan 2022 Section 6 Risk Assessment 6-4 and water facilities, hospitals, light rail lines, bridges and roads, shelters, and facilities that, if damaged, could cause serious secondary impacts may also be considered "critical." A hazardous material facility is one example of this type of critical facility. Critical and essential facilities are those facilities that are vital to the continued delivery recover from the emergency. These facilities may include: buildings such as the jail, law enforcement center, public services building, community corrections center, the courthouse, and juvenile services building and other public facilities such as schools. The attached charts/maps illustrate the critical facilities, essential facilities, public infrastructure, and emergency transportation routes within the City of Arcadia. Summary Hazard mitigation strategies can reduce the impacts concentrated at large employment and industrial centers, public infrastructure, and critical facilities. Hazard mitigation for industries and employers may include developing relationships with emergency management services and their employees before disaster strikes, and establishing mitigation strategies together. Collaboration among the public and private sector to create mitigation plans and actions can reduce the impacts of disasters. Local Hazard Mitigation Plan 2022 Section 7 Natural Hazards 7 When developing the Local Hazard Mitigation Plan for the City of Arcadia, the committee decided to place the hazards into two broad categories. The categories are Natural Hazards and Human Caused Hazards. Section 7 of the plan covers Natural Hazards. The hazards are: Section 7.1 Earthquake Section 7.2 Flood Section 7.3 Slope Failure - Debris/Mud Flow Section 7.4 Windstorm Section 7.5 Wildfire Section 7.6 Drought. All data tables and maps included in this section were updated during the revision of this plan. Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-1 Definition of an Earthquake A shaking or trembling of the earth that is volcanic or tectonic in origin.1 Earthquake Related Hazards Ground shaking, slope failures, liquefaction, and amplification are the specific hazards associated with earthquakes. The severity of these hazards depends on several factors, including soil and slope conditions, proximity to the fault, earthquake magnitude, and the type of earthquake. Ground Shaking Ground shaking is the motion felt on the earth's surface caused by seismic waves generated by the earthquake. It is the primary cause of earthquake damage. The strength of ground shaking depends on the magnitude of the earthquake, the type of fault, and the distance from the epicenter. Buildings on poorly consolidated and thick soils will typically see more damage than buildings on consolidated soils and bedrock. Earthquake Induced Slope failures Earthquake induced slope failures are secondary earthquake hazards that occur from ground shaking. Many communities in Southern California have a high likelihood of encountering such risks, especially in areas with steep slopes. Map 7-3 identifies the areas vulnerable to slope failures within the city of Arcadia. Liquefaction Liquefaction occurs when ground shaking causes wet granular soils to change from a solid state to a liquid state. This results in the loss of soil strength and the soil's ability to support weight. Buildings and their occupants are at risk when the ground can no longer support these buildings and structures. Many communities in Southern California are built on ancient river bottoms and have sandy soil. In some cases, this ground may be subject to liquefaction, depending on the depth of the water table. Map 7-3 also identifies areas vulnerable to liquefaction within the city of Arcadia. Amplification Soils and soft sedimentary rocks near the earth's surface can modify ground shaking caused by earthquakes. One of these modifications is amplification. Amplification increases the magnitude of the seismic waves generated by the earthquake. The amount of amplification is influenced by the thickness of geologic materials and their physical properties. Buildings and structures built on soft and unconsolidated soils can face greater risk. Amplification can also occur in areas with deep sediment filled basins and on ridge tops. History of Earthquakes in Southern California The most recent significant earthquake event affecting Southern California was the 2019 Ridgecrest Earthquake. The Ridgecrest earthquake sequence included a magnitude-6.4 foreshock on July 4, followed by a magnitude-7.1 mainshock nearly 34 hours later. The earthquakes resulted in one death, 25 people injured and approximately 5.3 billion dollars in damages.ii Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-2 The most impactful to the L.A. Basin was the 6.7 magnitude Northridge Earthquake that occurred on January 24, 1994. 57 people were killed, and more than 1,500 people seriously injured. For days afterward, thousands of homes and businesses were without electricity, tens of thousands had no gas, and nearly 50,000 had little or no water. Approximately 15,000 structures were moderately to severely damaged, which left thousands of people temporarily homeless. About 66,500 buildings were inspected. Nearly 4,000 were severely damaged and over 11,000 were moderately damaged. Several collapsed bridges and overpasses created commuter havoc on the freeway system. Ground shaking caused extensive damage, but earthquake triggered liquefaction and dozens of fires also caused additional severe damage. This extremely strong ground motion in large portions of Los Angeles County resulted in record economic losses. The earthquake occurred early in the morning on a holiday. This circumstance considerably reduced the potential effects. Many collapsed buildings were unoccupied, and most businesses were not yet open. The direct and indirect economic losses ran into the tens of billions of dollars. Historical and geological records show that California has a long history of seismic events. Southern California is probably best known for the San Andreas Fault, a 400- mile-long fault running from the Mexican border to a point offshore, west of San Geologic studies show that over the past 1,400 to 1,500 years large earthquakes have occurred at about 130-year intervals on the southern San Andreas Fault. As the last large earthquake on the southern San Andreas occurred in 1857, that section of the fault is considered a likely location for an earthquake within the next few decades.iii San Andreas is only one of dozens of known earthquake faults that crisscross Southern California. Some of the better-known faults include the Newport-Inglewood, Whittier, Chatsworth, Elsinore, Hollywood, Los Alamitos, and Palos Verdes faults. Beyond the surface of Southern California. One such blind fault was involved in the Whittier Narrows earthquake in October 1987. Although the most famous of the faults, the San Andreas, is capable of producing an earthquake with a magnitude of 8+ the potential to inflict greater damage on the urban core of the Los Angeles Basin. Seismologists believe that a 6.0 earthquake on the Newport-Inglewood would result in far Andreas is relatively remote from the urban centers of Southern California. Refer to the following table 7.1-1 of Earthquake Events in the Southern California Region. Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-3 Table: 7.1-1 Southern California Earthquakes with a Magnitude 5.0 or Greater since 1960 1971 San Fernando 1992 Landers 2001 Anza 1973 Point Mugu 1992 Big Bear 2003 Big Bear 1986 North Palm Springs 1994 Northridge 2004 Parkfield 1987 Whittier Narrows 1999 Hector Mine 2008 Chino Hills 2010 Baja California 2014 La Habra 2019 Ridgecrest History of Earthquakes in the City of Arcadia The most recent large-scale destruction to strike Arcadia was during the 1994 earthquake. it is estimated that the event directly or indirectly affected about 3% of the City's 53,000 residents. The City sought and received a County, State, and Presidential Disaster Declaration to obtain assistance for its recovery effort. Even though the earthquake was respond and repair large-scale damage without the assistance of the county, state, and federal government. Even though a lesser known fault line, the Raymond Fault, is only predicted to have a major rupture about once every 4500 years it still crosses right through the City of Arcadia, and there are even a couple of schools sitting directly on the Fault itself. The last major rupture of the Raymond Fault occurred sometime in the last 2000 years. However, the most recent notable seismic activity of the Fault occurred in the southern area of Pasadena with a magnitude of 5.0. Even though there were only a few minor injuries and slight damage reported, the Raymond Fault still has the potential to cause severe damage to the City of Arcadia and its residents. A more well know fault that crosses through the north end of Arcadia is the Sierra Madre Fault Line. Though its last major rupture occurred in the Holocene era and it is predicted to have major seismic activity about once every several thousand years it could still cause great damage to the City of Arcadia and its neighboring communities. Although the Clamshell-Sawpit Canyon Fault does not cross directly through Arcadia it should still be considered a great threat to the community. On June 28, 1991 seismic activity of about a 5.8 magnitude occurred on the Clamshell-Sawpit Canyon Fault, an offshoot of the Sierra Madre fault zone in the San Gabriel Mountains. ivBecause of its depth and moderate size, it caused no surface rupture, but it did trigger rockslides that blocked some of the local mountain roads. Roughly $40 million in property damage occurred in the San Gabriel Valley; unreinforced masonry buildings were hardest hit, and many brick chimneys collapsed. Two deaths resulted from this earthquake -- one person was killed in Arcadia, and one person in Glendale died from a heart attack. In all, at least 100 others were injured, though the injuries were mostly minor. v Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-4 Earthquake Hazard Assessment The San Gabriel Valley is littered with both surface and blind fault lines. Though the Raymond and Sierra Madre Fault Lines cross directly through the City of Arcadia there are many other faults that pose a great risk to the community including but not limited to the Clamshell-Sawpit, San Gabriel, and San Andreas Faults. Many organizations, in partnership with other state and federal agencies, have undertaken a rigorous program in California to identify seismic hazards and risks including active fault identification, bedrock shaking, tsunami inundation zones, ground motion amplification, liquefaction, and earthquake induced slope failures. Seismic hazard maps have been published and are available for many communities in California through the State Division of Mines and Geology. Map 7-1 illustrate the known earthquake faults in the San Gabriel Valley, and Arcadia. The City of Arcadia is at risk from many fault lines throughout California. The following Table 7.1-2 shows the distance between the fault line and the City of Arcadia. Table 7.1-2 Distances and Estimated Earthquake Strengths for Regional Faults Fault Name Approximate Distance from Arcadia Maximum Credible Earthquake (MCE) Sierra Madre 0 miles 6.7 MCE Raymond 0 miles 6.5 MCE Clamshell-Sawpit 1 mile 6.5 MCE San Gabriel 4 miles 7.0 MCE Verdugo 8 miles 6.7 MCE Whittier-North Elsinore 10 miles 7.0 MCE Elysian Park 11 miles 6.7 MCE Santa Monica-Hollywood 13 miles 6.6 MCE San Jose 14 miles 6.5 MCE Chino 18 miles 6.7 MCE San Andreas (Mojave section) 21 miles 7.1 MCE Cucamonga 22 miles 7.0 MCE Newport-Inglewood 23 miles 6.9 MCE Oak Ridge 24 miles 6.9 MCE Newport-Inglewood (offshore) 26 miles 6.9 MCE Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-5 Probability The U.S.G.S. in March 2015 published Version 3 of the Uniform California Earthquake Rupture Forecast (UCERF).vi This document lists the probability and magnitude of an earthquake occurring in many regions of California including the Los Angeles Region. Below is the table for the Los Angeles Region: Magnitude Greater or Equal Than To Average Repeat Time 30 Year Likelihood or one or more events 5 1.4 100% 6 10 96% 6.7 40 60% 7 61 46% 7.5 109 31% 8 532 7% Risk Analysis Risk analysis involves estimating the damage and costs likely to be experienced in a geographic area over a period of time. Factors included in assessing earthquake risk include population and property distribution in the hazard area, the frequency of earthquake events, slope failure susceptibility, buildings, infrastructure, and disaster preparedness of the region. This type of analysis can generate estimates of the damages to the region due to an earthquake event in a specific location. Damages from a large earthquake almost anywhere in Southern California are likely to run into the billions of dollars. Although building codes are some of the most stringent in the world, tens of thousands of older existing buildings were built under less rigid codes. many building owners have retrofitted their buildings, hundreds of pre-1933 buildings still have not been brought up to current standards. All existing uncensored masonry buildings in the City of Arcadia have been seismically retrofitted to comply with the "1990 Revised Model Ordinance for the Seismic Retrofit of Hazardous unreinforced Masonry Buildings" as developed by the State of California Seismic Safety Commission. Economic Impact The City of Arcadia has a total assessed valuation of $15,676,471,562. This can be further broken into: Residential properties valued at $12,959,501,963 Commercial properties valued at $ 1,524,210,934 Other properties valued at $ 1,192,758,665 Arcadia s Current Mitigation of Earthquake Hazards Earthquake damage occurs because humans have built structures that cannot withstand severe shaking. Buildings, airports, schools, and lifelines (highways and utility lines) Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-6 suffer damage in earthquakes and can cause death or injury to humans. The welfare of homes, major businesses, and public infrastructure is very important. Addressing the reliability of buildings, critical facilities, and infrastructure, and understanding the potential costs to government, businesses, and individuals as a result of an earthquake, are challenges faced by the city. Dams There is a total of 103 dams in Los Angeles County, owned by 23 agencies or organizations, ranging from the Federal government to Homeowner Associations.vii These dams hold billions of gallons of water in reservoirs. There are portions of the City that are located within the flood hazard areas (or inundation areas) of three (3) dams, including the Eaton Wash Dam in East Pasadena, the Santa Anita Dam, which is located in the Angeles National Forest above Arcadia, and the Sawpit Dam, which is located in Monrovia. A portion of the Sierra Madre Dam hazard area is also located within the City boundary but the dam was recently modified and no longer poses a potential threat to the City. For further information on dams and flood waters please see Section 7.2 Flooding Hazards. Infrastructure and Communication Residents in the City of Arcadia commute frequently by automobiles and public transportation such as buses and light rail. An earthquake can greatly damage bridges and roads, hampering emergency response efforts and the normal movement of people and goods. Damaged infrastructure strongly affects the economy of the community because it disconnects people from work, school, food, and leisure, and separates businesses from their customers and suppliers. Bridge Damage Even modern bridges can sustain damage during earthquakes, leaving them unsafe for use. Some bridges have failed completely due to strong ground motion. Bridges are a vital transportation link - with even minor damages making some areas inaccessible. Because bridges vary in size, materials, location and design, any given earthquake will affect them differently. Bridges built before the mid-1970' s have a significantly higher risk of suffering structural damage during a moderate to large earthquake compared with those built after 1980 when design improvements were made. The FHWA requires that bridges on the National Bridge Inventory be inspected every 2 years. CalTrans checks when the bridges are inspected because they administer the Federal funds for bridge projects. Even though the bridges in the City of Arcadia are state, county, or privately owned (including railroad bridges) all of the inspected bridges earned a Satisfactory rating or better. Prior to the opening of the Goldline Light Rail Extension through Arcadia in 2016 way were rebuilt to current building code standards. Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-7 Damage to Lifelines Lifelines are the connections between communities and outside services. They include water and gas lines, transportation systems, electricity, and communication networks. Ground shaking and amplification can cause pipes to break open, power lines to fall, roads and railways to crack or move, and radio and telephone communication to cease. Disruption to transportation makes it especially difficult to bring in supplies or services. Lifelines need to be usable after an earthquake to allow for rescue, recovery, and rebuilding efforts and to relay important information to the public. Disruption of Critical Services Critical facilities include police stations, fire stations, hospitals, shelters, and other facilities that provide important services to the community. These facilities and their services need to be functional after an earthquake event. Many critical facilities are housed in older buildings that are not up to current seismic codes. However, all critical public buildings in Arcadia have been built to code and are considered seismically sound. Individual Preparedness Because the potential for earthquake occurrences and earthquake related property damage is relatively high in the City of Arcadia, increasing individual preparedness is a significant need. Strapping down heavy furniture, water heaters, and expensive personal property, as well as being earthquake insured, and anchoring buildings to foundations are just a few steps individuals can take to prepare for an earthquake. The residents and business owners of Arcadia can visit any fire station to obtain literature on earthquake preparedness and survival. Fire Downed power lines or broken gas mains can trigger fires. Major incidents will demand a larger share of resources, and initially smaller fires and problems will receive little or insufficient resources in the initial hours after a major earthquake event. Loss of electricity may cause a loss of water pressure in some communities, further hampering firefighting ability. In the event of an earthquake the Arcadia Fire Department has an Earthquake Policy. The policy states: when and where off-duty personnel should report, initial tasks of on duty personnel, and provides initial assignments for determining the amount of damage the City and its occupants suffered. The City of Arcadia also has a Disaster Recall Policy encompassing all departments which details when and where City Employees are to report and the responsibilities of each person. Debris After damage to a variety of structures, much time is spent cleaning up brick, glass, wood, steel or concrete building elements, office and home contents, and other materials. The City of Arcadia has a debris management annex in its Emergency Operations Plan. City staff is also working with Los Angeles County Public Works on a Debris Management Plan for the entire county of Los Angeles. Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-8 Buildings The built environment is susceptible to damage from earthquakes. Buildings that collapse can trap and bury people. Lives are at risk and the cost to clean up the damages is great. In most California communities, including the city of Arcadia, many buildings were built before 1993 when building codes were not as strict. In addition, retrofitting is not required except under certain conditions and can be expensive. Therefore, the number of buildings at risk remains high. The California Seismic Safety Commission makes annual reports on the progress of the retrofitting of unreinforced masonry buildings. All unreinforced masonry buildings both publicly and privately owned in are Arcadia have been retrofitted to meet current standards. City of Arcadia Codes Implementation of earthquake mitigation policy most often takes place at the local government level. The City of Arcadia Development Services Department enforces building codes pertaining to earthquake hazards. The City of Arcadia has adopted the 2019 California Building Code. Therefore, all earthquake hazard mitigation measures specified in the Code are enforced by the City of Arcadia for new and remodeled buildings and structures. This ensures that all buildings be built and remodeled at the most current seismic standards. Generally, these codes seek to discourage development in areas that could be prone to flooding, slope failure, wildfire and / or seismic hazards; and where development is permitted, that the applicable construction standards are met. Developers in hazard-prone areas may be required to retain a qualified professional engineer to evaluate level of risk on the site and recommend appropriate mitigation measures. The City of Arcadia also requires that site-specific seismic hazard investigations be performed for new essential facilities, major structures, hazardous facilities, and special occupancy structures such as schools, hospitals, and emergency response facilities. Businesses/Private Sector Seismic activity can create economic loss that presents a burden to large and small shop owners who may have difficulty recovering from their losses. When a company is forced to stop production for just a day, the economic loss can be tremendous. In fact, of all businesses which close following a disaster, more than forty-three percent never reopen, and an additional twenty-nine percent close for good within the next two years.viii The disaster planning toolkit to help guide businesses in preparing for and dealing with the adverse effects of natural hazards. The kit integrates protection from natural disasters into the company's risk reduction measures to safeguard employees, customers, and the investment itself. The guide helps businesses secure human and physical resources during disasters and helps to develop strategies to maintain business continuity before, during, and after a disaster occurs. Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-9 Hospitals in response to the moderate Magnitude 6.6 Sylmar Earthquake in 1971 when four major hospital campuses were severely damaged and evacuated. Two hospital buildings collapsed killing forty-seven people. Three others were killed in another hospital that nearly collapsed. In approving the Act, the Legislature noted that: Hospitals, that house patients who have less than the capacity of normally healthy persons to protect themselves, and that must be reasonably capable of providing services to the public after a disaster, shall be designed and constructed to resist, insofar as practical, the forces generated by earthquakes, gravity and winds. (Health and Safety Code Section 129680) When the Hospital Act was passed in 1973, the State anticipated that, based on the regular and timely replacement of aging hospital facilities, the majority of hospital years. However, hospital buildings were not, and are not, being replaced at that anticipated rate. In fact, orthridge Earthquake, expanded the scope of the 1973 Hospital Act. Under SB 1953, all hospitals are required, as of January 1, 2008, to survive earthquakes without collapsing or posing the threat of significant loss of life. The 1994 Act further mandates that all existing hospitals be seismically evaluated, and retrofitted, if needed, by 2030, so that they are in substantial compliance with the Act (which requires that the hospital buildings be reasonably capable of providing services to the public after disasters). SB 1953 applies to all urgent care facilities (including those built prior to the 1973 Hospital Act) and affects approximately 2,500 buildings on 475 campuses. Community Issues Summary One fault line runs diagonally through Arcadia. A large earthquake on that fault would impact: City owned roadways, water infrastructure and radio repeater site. Interstate 210 Metro Gold Line Light Rail One middle school Two elementary schools A Regional Mall A horse racing track with a capacity for over 50,000 patrons A major natural gas distribution line feeding the San Gabriel Valley runs through Arcadia and crosses the fault line Local Hazard Mitigation Plan 2022 Section 7.1 Earthquake 7.1-10 Works Cited 1 http://pubs.usgs.gov/gip/earthq3/when.html iiAnalysis of recent Ridgecrest, California earthquake sequence reveals complex, damaging fault systems, California Institute of Technology (October 17, 2019) iii http://pubs.usgs.gov/gip/earthq3/when.html iv (Haukson, 1994 v http://www.data.scec.org/chrono_index/sierrama.html vi March 2015 viiSource: Los Angeles County Public Works Department, March 2004 viiiInstitute for Business and Home Safety Resources (April 2001), Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-1 Definition of Flooding A rising and overflowing of a body of water especially onto normally dry land.i Flood Related Hazards Flooding occurs when climate, geology, and hydrology combine to create conditions where water flows outside of its usual course. While the City of Arcadia has some of these conditions, it has been fortunate enough to have no experience of flooding in the City. Winter Rainfall Over the last 125 years, the average annual rainfall in Los Angeles has been 14.9 inches. But the only 4.35 inches in 2001-2002 to 38.2 inches in 1883-1884. In fact, in only fifteen of the past 125 years, has the annual rainfall been within plus or minus 10% of the 14.9 inch average. And in only 38 years has the annual rainfall been within plus or minus 20% of the 14.9 inch average. This makes the Los Angeles basin a land of extremes in terms of annual precipitation. The City of Arcadia is centrally located in the San Gabriel Valley. It is up against the San Gabriel Mountains or hills, which could increase the collection of rainwater. Monsoons Another relatively regular source for heavy rainfall, particularly in the mountains and adjoining cities is from summer tropical storms. Riverine Flooding Riverine flooding is the overbank flooding of rivers and streams. The natural processes of riverine flooding add sediment and nutrients to fertile floodplain areas. Flooding in large river systems typically results from large-scale weather systems that generate prolonged rainfall over a wide geographic area, causing flooding in hundreds of smaller streams, which then drain into the major rivers. Shallow Area Flooding Shallow area flooding is a special type of riverine flooding. FEMA defines shallow flood hazards as areas that are inundated by the 100-year flood with flood depths of only one to three feet. These areas are generally flooded by low velocity sheet flows of water. 100-Year Flood The 100-year flooding event is the flood having a one percent chance of being equaled or exceeded in magnitude in any given year. Contrary to popular belief, it is not a flood occurring once every 100 years. The 100-year floodplain is the area adjoining a river, stream, or watercourse covered by water in the event of a 100-year flood. Urban Flooding As land is converted from fields or woodlands to roads and parking lots, it loses its ability to absorb rainfall. Urbanization of a watershed changes the hydrologic systems of the basin. Heavy rainfall collects and flows faster on impervious concrete and asphalt surfaces. The water moves from the clouds, to the ground, and into streams at a much faster rate in urban areas. Adding these elements to the hydrological systems can result in flood waters that rise very Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-2 rapidly and peak with violent force. Dam Failure Flooding Loss of life and damage to structures, roads, and utilities may result from a dam failure. Economic losses can also result from a lowered tax base and lack of utility profits. These effects could certainly accompany the failure of one of the major dams surrounding the City of Arcadia. There are no located within the flood hazard areas (or inundation areas) of three (3) dams, including the Eaton Wash Dam in East Pasadena, the Santa Anita Dam, which is located in the Angeles National Forest above Arcadia, and the Sawpit Dam, which is located in Monrovia. History of Flooding in Southern California There are a number of rivers in the Southern California region, but the river with the best recorded history is the Los Angeles River. The flood history of the Los Angeles River is generally indicative of the flood history of much of Southern California. Records show that since 1811, the Los Angeles River has flooded 30 times, on average once every 6.1 years. But averages are deceiving, for the Los Angeles basin goes through periods of drought and then periods of above average rainfall. Between 1889 and 1891 the river flooded every year, and from 1941 to 1945, the river flooded 5 times. Conversely, from 1896 to 1914, a period of 18 years, and again from 1944 to 1969, a period of 25 years, the river did not have serious floods.ii A Sample of Major Floods of the Los Angeles River Table 7.2 1825 L.A. River changed its course back from the Ballona wetlands to San Pedro 1861-62 Heavy flooding. Fifty inches of rain falls during December and January. 1867 Floods create a large, temporary lake out to Ballona Creek. 1884 Heavy flooding caused river to change course, turning east to Vernon & then south to San Pedro. 1914 Heavy flooding. Great damage to the harbor. 1934 Moderate flood starting January 1. Forty dead in La Canada. 1938 Great County-wide flood with 4 days of rain. Most rain on day 4. 1941-44 L.A. River floods five times. 1969 One heavy flood after 9 day storm. One moderate flood. 1979 Los Angeles experiences severe flooding and mudslides. 1980 Flood tops banks of river in Long Beach. Sepulveda Basin spillway almost opened. 1983 Flooding kills six people. 1992 15 year flood. Motorists trapped in Sepulveda basin. Six people dead. 1994 Heavy flooding Sources: http://www.lalc.k12.ca.us/target/units/river/tour/hist.html and (http://www.losangelesalmanac.com/topics/History/hi01i.htm) While the City of Arcadia is 15 miles east of Los Angeles, it is not so far away as to not be Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-3 affected by the heavy rains that brought flooding to Los Angeles. In addition, the towering mountains that give the Los Angeles region its spectacular views also bring a great deal of rain out of the storm clouds that pass through. Because the mountains are so steep, the rainwater moves rapidly down the slopes and across the coastal plains on its way to the ocean. surround three sides of the valley, seldom reach heights above three thousand feet. The western San Gabriel Mountains, in contrast, have elevations of more than seven thousand feet. These higher ridges often trap eastern-moving winter storms. Although downtown Los Angeles averages just fifteen inches of rain a year, some mountain peaks in the San Gabriels receive more than forty iii Naturally, this rainfall moves rapidly downstream, often with severe consequences for anything in its path. In extreme cases, flood-generated debris flows will roar down a canyon at speeds near 40 miles per hour with a wall of mud, debris and water tens of feet high. In Southern California, stories of floods, debris flows, persons buried alive under tons of mud and rock and persons swept away to their death in a river flowing at thirty-five miles an hour are without end. No catalog of chaos could contain all the losses suffered by man and his possessions from the Regions Rivers and streams. Arcadia and surrounding areas are, like most of Southern California, subject to unpredictable seasonal rainfall. Most years, the scant winter rains are barely sufficient to turn the hills green for a few weeks, but every few years the region is subjected to periods of intense and sustained precipitation that sometimes results in localized flooding. Natural (Storm) Flooding In Southern California, storm flooding is difficult to predict, and thus plan for, because rainfall varies from year to year. Flood hazards related to storm events generally are described in terms of a 100- or 500-year flood. A 100-year flood is defined as a major flood event that has a one percent or greater chance of occurring during any one year. Flood hazard planning practices addresses such storms, as well as 500-year events. These floods are considered severe; however, these floods can be reasonably predicted and therefore reasonably mitigated. As noted above, the Los Angeles County Department of Public Works has constructed regional flood and debris control facilities throughout the region, including the flood control channels in Arcadia that direct runoff water through the City into regional facilities to the south. A system of spreading basins manages storm water runoff and helps recharge groundwater basins. Locally, the City maintains approximately four miles of subsurface storm drains that flow into the regional channels. Due to the combination of these two systems, no areas in Arcadia lie within a 100-year iv The City has experienced Urban Flooding. storm. The water overflowed onto the City streets but caused little to no damage to any public or private property. Once the rainfall lessened, the sewer system was able once again channel the Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-4 water through and away from the City. The 2010 City of Arcadia General Plan under Chapter 8 superior storm draining and flood control facilities that minimize the risk of flooding. The goal is achieved through the following policies: Policy S- prone to localized ponding and flooding. Policy S-2.2: Continue rigorous maintenance of storm drainage and flood control Policy S-2.3: Require that new development projects retain as much runoff as possible on the development site to reduce flow volumes into the storm drain system, allow for requirements (consistent with the National Pollutant Discharge Elimination Systems program, or NPDES) and employ Best Management Practices (BMPs). Policy S-2.4: Support efforts of the Los Angeles County Department of Public Works and other agencies responsible for the maintenance of dams and reservoirs above Arcadia to improve conditions of the facilities and reduce the risk of inundation resulting from dam or reservoir failure. National Flood Insurance Program The City of Arcadia does not participate in the National Flood Insurance Program. Flooding Hazard Assessment The most current FEMA map confirms that the City of Arcadia is rated area X, areas to be outside the .2% annual chance floodplain and in area D, areas in which flood hazards are undetermined but possible. Due to the fact Arcadia does not have areas considered to be flood prone the City does not have recurring loss properties. However, there are portions of the City that are located within the inundation areas of three (3) dams, including the Morris S. Jones Reservoir in East Pasadena, the Santa Anita Dam, which is located in the Angeles National Forest above Arcadia, and the Sawpit Dam, which is located in Monrovia. See Map 7.2a for flood inundation areas. Risk Analysis Risk analysis is the third and most advanced phase of a hazard assessment. It builds upon the hazard identification and vulnerability assessment. A flood risk analysis for the City of Arcadia should include two components: (1) the life and value of property that may incur losses from a flood event (defined through the vulnerability assessment); and (2) the number and type of flood events expected to occur over time. Within the broad components of a risk analysis, it is possible to predict the severity of damage from a range of events. Flow velocity models can assist in predicting the amount of damage expected from different magnitudes of flood events. The data used to develop these models is based on hydrological analysis of landscape features. Changes in the landscape, often associated with human development, can alter the flow velocity and the severity of damage that can be expected from a flood event. Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-5 Using GIS technology and flow velocity models, it is possible to map the damage that can be expected from flood events over time. It is also possible to pinpoint the effects of certain flood events on individual properties. Economic Impact There are four dam inundation zones that impact the City of Arcadia. As mentioned in this section, the zones are Morris S. Jones Reservoir Inundation Area, Santa Anita Dam Inundation Area, and Sawpit Dam Inundation. The assessed valuation for the three areas are as follows: Sawpit Dam Inundation Area $276,166,986 Santa Anita Dam Inundation Area $669,813,106 Morris Jones Reservoir $271,501,566 Community Flood Issues What is Susceptible to Damage during a Flood Event? The largest impact on communities from flood events is the loss of life and property. During certain years, property losses resulting from flood damage are extensive. Property loss from floods strikes both private and public property. Because the City of Arcadia does not lie in a flood plain, the damage to property in the City has been minimal since incorporation. Property Loss Resulting from Flooding Events The type of property damage caused by flood events depends on the depth and velocity of the flood waters. Faster moving flood waters can wash buildings off their foundations and sweep cars downstream. Pipelines, bridges, and other infrastructure can be damaged when high waters combine with flood debris. Extensive damage can be caused by basement flooding and landslide damage related to soil saturation from flood events. Most flood damage is caused by water saturating materials susceptible to loss (i.e., wood, insulation, wallboard, fabric, furnishings, floor coverings, and appliances). In many cases, flood damage to homes renders them unlivable. Business/Industry Flood events impact businesses by damaging property and by interrupting business. Flood events can cut off customer access to a business as well as close a business for repairs. A quick response to the needs of businesses affected by flood events can help a community maintain economic vitality in the face of flood damage. Responses to business damages can include funding to assist owners in elevating or relocating flood-prone business structures. Public Infrastructure Publicly owned facilities are a key component of daily life for all citizens of the county. Damage to public water and sewer systems, transportation networks, flood control facilities, emergency facilities, and offices can hinder the ability of the government to deliver services. Government can take action to reduce risk to public infrastructure from flood events, as well as craft public policy that reduces risk to private property from flood events. Roads During natural hazard events, or any type of emergency or disaster, dependable road connections Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-6 are critical for providing emergency services. The Public Works Services Department maintains roads systems in the City of Arcadia. Federal, state, county, and city governments all have a stake in protecting roads from flood damage. Road networks often traverse floodplain and floodway areas. Transportation agencies responsible for road maintenance are typically aware of roads at risk from flooding. Bridges Bridges are key points of concern during flood events because they are important links in road networks and can inhibit the flow of water during flood events. The bridges in the City of Arcadia are state, county, city, or privately owned. A state-designated inspector must inspect all state, county, and city bridges every two years; but private bridges are not inspected, and can be very dangerous. The inspections are rigorous, looking at everything from seismic capability to erosion and scour. Storm Water Systems Local drainage problems are common throughout the City of Arcadia. While the City does not have a drainage master plan, Public Works staff is aware of local drainage threats. The problems are often present where storm water runoff enters culverts or goes underground into storm sewers. Inadequate maintenance can also contribute to the flood hazard in urban areas. Water/Wastewater Treatment Facilities There is one sanitary district that services the City of Arcadia (Los Angeles County Sanitation). There are also four (4) water service companies and or districts in the City of Arcadia. This number includes the water service provided to the residents by the City of Arcadia. Wastewater Management Arcadia's sewer system is a series of privately owned lateral connections from individual businesses and residences, which connect to larger City-owned main lines - then to subsequently larger trunk lines, which then take Arcadia's sanitary and industrial wastes to treatment plants operated by the LA County Sanitation District. These wastes are treated to varying degrees and either used for specific industrial purposes such as freeway irrigation or power (plant) generation, or discharged in to water bodies of the State, where they flow to the Pacific Ocean. Water Districts All of the water districts in the City as well as the City Public Works Services Department are in the process of replacing old cast iron pipes with more ductile iron pipes, which will be more resilient in disaster situations. During a disaster, water districts in the region work together to provide water for the city of Arcadia residents. Water Quality The City of Arcadia is committed to making sure that water from the water supply as well as storm water, which make its way into the water conveyance system, are safe and reliable by complying with all Federal and State water standards. The City of Arcadia water supply is always tested to make sure there are no harmful constituents. Local Hazard Mitigation Plan 2022 Section 7.2 Flood 7.2-7 Community Issues Summary Flood is not a high hazard for the City of Arcadia. This statement is based on lack of a history of flooding within the City of Arcadia along with what is depicted on the most current FEMA map. The details from the most current FEMA map can be found on page 7.2-4 under the heading "Flood Hazard Assessment" The City of Arcadia does not have areas considered to be flood prone and does not have recurring loss properties. Works Cited i http://www.merriam-webster.com/ ii. http://www.lalc.k12.ca.us/target/units/river/tour/hist.html iii. Gumprecht, Blake, 1999, Johns Hopkins University Press, Baltimore, MD. iv City of Arcadia General Plan Chapter 8 Safety Element, Flooding Section City of Arcadia Flood Hazards Map MAP 7-2.1 Monrovia El Monte Temple City Irwindale Sierra Madre Pasadena Los Angeles County Las Tunas Dr Camino Real Huntington Dr 0 1,000 2,000 3,000 4,000 Feet Mapped by: Hogle-Ireland Inc., 2010. Source: Federal Emergency Management Agency (FEMA), September 26, 2008. National Flood Hazards Layer (NFHL). FEMA Map Service Center: Web Page, <http://msc.fema.gov> Base Map Features City Boundary Sphere of Influence Freeway Railroad City Road Water Feature Flood Hazard Zones Areas of 0.2% annual chance flood. Areas in which flood hazards are undetermined, but possible. Areas determined to be outside the 0.2% annual chance floodplain. AN I T A SANTA WA S H LIBRARY STATION FI R E W A S H SIE R R A M A D R E D E B R I S D I S P O S A L DR R DCANYON SUNSET MICHILLINDA ORANGE GROVE ELKINS AV H I G H L A N D VIS TA SAWPIT GOLF COURSE SANTA ANITA P A R K A R C A D I A C O U N T YC I T Y STATION FI R E A R B O R E T U M S T A T E A N D C O U N T Y L O S A N G E L E S RACE TRACK P A R K ANITA SANTA WA S H A R C A DIA AR C A D I A ARCADIA H S HUGO REID PRIMARY SERENDIPITY SCHOOL CONTINUATION SCHOOL HUGO REID ELEM. BALDWIN STOCKER ELEM. LONGLEY WAY ELEM. CAMINO GROVE ELEM. RICHARD H DANA JR H S 1ST AVENUE JR H S FOOTHILLS JR H S HIGHLAND OAKS ELEM HOLLY AVENUE ELEM TIERRA VERDE PARK WINNIE WAY PARK BICENTENNIAL PARK LONGDEN AVENUE PARK BALDWIN STOCKER PARK HOLLY AVENUE PARK FAIRVIEW AVENUE PARK WILDERNESS PARK TRIPOLIS FRIENDSHIP PARK HUGO REID PARK CIVIC CENTER ATHLETIC FIELD HIGHLAND OAKS PARK PARK BONITA EISENHOWER PARK FOREST PARK PARK GROVE CAMINO ORANGE GROVE PARK NEWCASTLE PARK SANTA CLARA ST H A L L COURSE ARCADIA GOLF ARCADIA S A N T A A N I T A W A SH FIRE STATION EA S T BRANCH L A T E R A L A R E A WASH LAS TUNAS DR FYFOOTHILLRTE 210 RTE 210 CENTEN NIAL REAL GOLDRING CLARK A Z U S A RD L O W E R PECK RD L I V E O A K A V RD CAMINO SIERRA MADRE BL AV AV GRAND VIEW DR OAKS HIGHLAND ST JOSEPH ST DR CAMPUS DR D U A RT E AV W AY H UNTIN GTO N BALDWIN AV HUNTINGTON AV 6TH AV 10TH 1STAV AV ANITA SANTA EL MONTE REALCAMINO HOLLY R D AV AV AV LONGDEN AV 2ND GOLDEN W EST BALDWIN BL BLADWIN AV COLORADO BL DR HUNTINGTON BLFOOTHILL COLORADO ST LI M A PUBLIC WORKS SERVICES DEPARTMENT CHAMBER OF COMMERCE RECREATION & COMMUNITY SERVICES DEPARTMENT M ETH ODIST HOSPITAL WESTFIELDSHOPPING TOWNATSANTA ANITA PD CITY OF MONROVIA CITY OF EL MONTE CITY OF IRWINDALETEMPLE CITY CITY OF SIERRA MADRE ANGELES NATIONAL FOREST LOS ANGELES COUNTYCITY LOS ANGELES COUNTY CITY OF SIERRA MADRE LOS ANGELES COUNTY TEMPLE CITY E SIERRA MADRE BLVD HASTINGS RANCH DRHAMPTON RD N A L T U R A R D N R O S E M E A D B L V D MONTE VERDE DR VOLANTE DR WO O D L A N D D R CHURCHILL RD FO OTHILL AV N C A N O N A V RA N C H O R D S A L T A V I S T A A V VI O L E T A V S M A Y F L O W E R A V EL N I D O A V SIERRA MADRE VILLA AV CITY OF PASADENA PECK ROAD PLANT SANTA ANITA PLANT LIVE OAK PLANT LOWER CANYON PLANT UPPER CANYON PLANT LONGLEY WELL LONGDEN PLANT BALDWIN PUMP PLANT RANCHO WELL NO. 6 HUGO REID WELL BALDWIN WELL NO. 2 CHAPMAN PLANT ANOKIA WELL CAMINO REAL PLANT TORREY PINE RESERVOIRSGROVE PLANT ORANGE ST JOSEPHPLANT P E C K R O A D W A T E R & C O N S E R V A T I O N P A R K HIGH PR ES S U RE GAS PI PE L INE HIGH PRESSURE HIGH PRESSURE GAS PIPELINE HIGH PRESSURE GAS PIPELINE HIGH PRESSURE GAS PIPELINE GAS PIPELINE 3 8 1 2 9 6 5 10 4 7 11 ARCADIA GOLDLINE STATION LEGEND SANTA ANITA DAM INUNDATION AREA MORRIS S. JONES RESERVOIR INUNDATION AREA SIERRA MADRE DAM INUNDATION AREA SAWPIT DAM INUNDATION AREA HIGH PRESSURE GAS PIPELINE RESERVOIRS CRITICAL BUILDINGS Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-1 Definition of a Slope Failure Slope failure, also referred to as mass wasting, is the. downslope movement of rock debris and soil in response to gravitational stresses. Three major types of mass wasting are classified by the type of downslope movement: falls, slides, and flows.1 Slope Failure Hazards Slope Failure and flows. Slope Failures can be initiated by rainfall, earthquakes, volcanic activity, changes in groundwater, disturbance and change of a slope by fabricated construction activities, or any combination of these factors. The size of a Slope Failure usually depends on the geology and the initial cause of the Slope Failure. Slope Failures vary greatly in their volume of rock and soil, the length, width, and depth of the area affected, frequency of occurrence, and speed of movement. Some characteristics that determine the type of Slope Failure are slope of the hillside, moisture content, and the nature of the underlying materials. Slope Failures are given different names, depending on the type of failure and their composition and characteristics. Slides move in contact with the underlying surface. These movements include rotational slides, where sliding material moves along a curved surface, and translational slides, where movement occurs along a flat surface. These slides are generally slow moving and can be deep. Slumps are small rotational slides that are generally shallow. Slow-moving Slope Failures can occur on relatively gentle slopes and can cause significant property damage, but they are far less likely to result in serious injuries than rapidly moving Slope Failures.2 exceeds the strength of the earth materials that compose the slope. They can move slowly (millimeters per year), or they can move quickly and disastrously, as is the case with debris-flows. Debris-flows can travel down a hillside of speeds up to 200 miles per hour (more commonly, 30 50 miles per hour), depending on the slope angle, water content, and type of earth and debris in the flow. These flows are initiated by heavy, usually sustained, periods of rainfall, but sometimes can happen because of short bursts of concentrated rainfall in susceptible areas. Burned areas charred by wildfires are particularly susceptible to debris flows, given certain soil characteristics and slope 3 A debris or mudflow is a river of rock, earth, and other materials, including vegetation that is saturated with water. This high percentage of water gives the debris flow a very rapid rate of movement down a slope. Debris flows often with speeds greater than 20 mile per hour and can often move much faster.4 This high rate of speed makes debris flows extremely dangerous to people and property in its path. Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-2 History of Slope Failures in Southern California Slope Failures are a serious geologic hazard in almost every state in America. Nationally, Slope Failures cause 25 to 50 deaths each year.5 The best estimate of direct and indirect costs of Slope Failure damage in the United States range between $1 and $2 billion annually.6 As a seismically active region, California has had significant number of locations impacted by Slope Failures. Some Slope Failures result in private property damage; other Slope Failures impact transportation corridors, fuel and energy conduits, and communication facilities. They can also pose a serious threat to human life. Below is a list of some of the major Slope Failures and their results in recent Southern Californian history. 1963 Baldwin Hills Dam Failure. On December 14, the 650-foot long by 155-foot high earth fill dam gave way and sent 360 million gallons of water in a fifty-foot high wall cascading onto the community below, killing five persons, and damaging 50 million (1963 dollars) dollars in property. 1971 Upper and Lower Van Norman Dams, San Fernando, California Earthquake-induced Slope Failures. Cost estimate $302.4 million (2000 dollars). Damage due to the February 9, 1971, magnitude 7.5 San Fernando, California, earthquake. The earthquake of February 9 severely damaged the Upper and Lower Van Norman Dams.7 1971 Juvenile Hall, San Fernando, California Slope Failures caused by the February 9, 1971, San Fernando, California, earthquake Cost, $266.6 million (2000 dollars). In addition to damaging the San Fernando Juvenile Hall, this 1.2 km-long slide damaged trunk lines of the Southern Pacific Railroad, San Fernando Boulevard, Interstate Highway 5, an electrical converter station, and several pipelines and canals.8 1978 Bluebird Canyon Orange County, California October 2, 1978. Cost estimate $52.7 million (2000 dollars). Sixty houses destroyed or damaged. Unusually heavy rains in March of 1978 may have contributed to initiation of the Slope Failure. Although the 1978 slide area was approximately 3.5 acres, it is suspected to be a portion of a larger, ancient Slope Failure.9 1978-1979, 1980 San Diego County, California Experienced major damage from storms in 1978, 1979, and 1979-80, as did neighboring areas of Los Angeles and Orange County, California. One hundred and twenty Slope Failures were reported to have occurred in San Diego County during those two years. Rainfall for the rainy seasons of 1978-79 and 1979-80 was 14.82 and 15.61 inches (37.6 and 39.6 cm) respectively, compared to a 125-year average (1850-1975) of 9.71 inches (24.7 cm). Significant Slope Failures occurred in the Friars Formation; a unit that was noted as slide-prone in the Seismic Safety Study for the City of San Diego. Of the nine Slope Failures that caused damage in excess of $1 million, seven occurred in the Friars Formation, and two in the Santiago Formation in the northern part of San Diego Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-3 County.10 1994 Northridge, California, earthquake Slope Failures As a result of the magnitude 6.7 Northridge, California, earthquake, more than 11,000 Slope Failures occurred over an area of 10,000 km2. Most were in the Santa Susana Mountains and in mountains north of the Santa Clara River Valley. Destroyed dozens of homes, blocked roads, and damaged oil-field infrastructure. March 1995 Los Angeles and Ventura Counties, Southern California Above normal rainfall triggered damaging debris flows, deep-seated Slope Failures, and flooding. Several deep-seated Slope Failures were triggered by the storms, the most notable was the La Conchita Slope Failure, which in combination with a local debris flow, destroyed or badly damaged 11 to 12 homes in the small town of La Conchita, about 20 km west of Ventura. There also was widespread debris-flow and flood damage to homes, commercial buildings, and roads and highways in areas along the Malibu coast that had been devastated by wildfire two years before.11 June 2005 Bluebird Canyon, Laguna Beach, California In the early morning of June 1, 2005, a Slope Failure began moving in the Bluebird Canyon area of Laguna Beach, California. No rainfall or earthquake activity occurred during or immediately before the Slope Failure movement. This movement is almost certainly related to the extremely heavy winter rains that occurred from December through February. Rainfall from the winter season has been slowly percolating downward through the soil and is gradually raising ground-water levels. As ground water rises, slopes can become unstable and begin to move, even if no rain is presently occurring.12 January 2005 La Conchita, California On January 10, 2005, a Slope Failure struck the community of La Conchita in Ventura County, California, destroying or seriously damaging 36 houses and killing 10 people. Although rainfall intensities were not extreme, moderate- to high-intensity rainfall persisted for more than two weeks, and the Slope Failure occurred at the culmination of this 15-day high-rainfall period. 13 January February 2010 La Cañada Flintridge, California Heavy winter storms hit the hills of La Cañada Flintridge in the early months of the year. The area had already been devastated in the summer of 2009 with one of the largest wildfires in modern history. The loss of so much vegetation combined with the downpour of rains caused significant mudslides to the area. Over 500 homes evacuated, about fifty homes were damaged, and another twenty were red tagged. Initial estimates of damage were in excess of $20 million (2010 dollars). January 2018 Montecito, CA A heavy winter storm hit the mountains above Montecito and Carpenteria California in January of 2018. The area had burned during the devastating Thomas Fire in December of 2017 which burned 115,000 acres. The mudflow caused 21 reported deaths. Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-4 Approximately 163 people were hospitalized with various injuries, including four in critical condition. The mudflows caused at least $177 million (2018 dollars) in property damage, cost at least $7 (2018 dollars) million in emergency responses, and another $43 (2018 dollars) million to clean up. History of Slope Failures in Cities in the San Gabriel Valley December 2008 Sierra Madre, CA. In May 2008, over 600 acres of mountainside north of our neighboring city of Sierra Madre burned again in the Santa Anita II Fire. Portions of their hillside communities were inundated with mud and debris following the rains in the winter of 2008 and 2009. November 2013 Monrovia, CA. In May of 2013, approximately 213 acres above the city of Monrovia were burned in the Madison Fire. In the fall of that year, the foothills of City of Monrovia experienced mud and debris flows in the neighborhoods up against the foothills. November 2014 Glendora/Azusa, CA. In January of 2014, the Colby Fire burned 1,192 acres above the cities of Azusa and Glendora approximately 14 miles from the City of Arcadia. In November and December of 2014 both communities developed mudflow action plans and placed the plans into action and during periods of heavy rain during late fall and winter. November 2016 Duarte/Azusa CA. In June of 2016, the Fish Fire burned 3,700 acres in the foothills above Duarte and Azusa, CA 4 miles from the City of Arcadia. In November and December of 2016 both communities developed mudflow action plans and placed the plans into action and during periods of heavy rain during late fall and winter. History of Slope Failures in Arcadia January February 2000 In the wake of the December 27, 2000, Santa Anita Wildfire heavy rains brought mudslides to the north end of Arcadia. The Arcadia City Council appropriated $334,000 to purchase K-rail, fill sandbags, clear debris basins, among numerous other costs in response, minimal damage occurred to private properties. 14 January 2005 Heavy rainstorms triggered as many as 18 mudslides in Santa Anita Canyon, two of which were enormous events that buried the roadway under mounds of debris. The first major slide deposited about 6,000 cubic yards of debris on the road. A Forest Service Fire Station had to be shut down due to lack of access and a pack station owner said that the road closures had devastated her business financially. 15 Slope Failure Hazard Assessment Locations at risk from Slope Failures or debris flows include areas with one or more of Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-5 the following conditions: 1. On or close to steep hills. 2. Steep road-cuts or excavations. 3. Existing Slope Failures or places of known historic Slope Failures (such sites often have tilted power lines, trees tilted in various directions, cracks in the ground, and irregular-surfaced ground). 4. Steep areas where surface runoff is channeled, such as below culverts, V-shaped valleys, canyon bottoms, and steep stream channels. 5. Fan-shaped areas of sediment and boulder accumulation at the outlets of canyons. 6. Canyon areas below hillsides and mountains that have recently (within 1-6 years) been subjected to a wildland fire. On December 27, 1999, a fire occurred in the Angeles National Forest north of the City of Arcadia that resulted in the burning of over 500 acres of chaparral. The U.S. Forestry Service classified this as a medium intensity fire that burned off vegetation at the surface level, however left the root structures intact. Initial estimates are that the natural recovery process will take between four to ten years for full restoration of the vegetation and chaparral. In the interim, the burn area is barren of vegetation. The soil is composed of loose gravel and dirt and due to burn, which creates a coating, having a water repelling effect. This means that the normal absorption and stability of the soil is diminished. With the lack of vegetation and water repellency of the soil, geologists and hydrologists surveying the area forecast the likelihood of natural soil erosion and runoff with or without rainfall. The City of Arcadia anticipated that with rainfall, flooding and mudslides were likely. The degree of flooding or mudslides depended upon the amount and intensity of rainfall; however, experts believe that one-half inch of rain falling over a short period of time could be sufficient to create a problem. Several residences were identified as being threatened to varying degrees by mudslides and flooding due to their proximity to the mountainside and the watersheds where water and debris naturally flowed. Furthermore, several streets possessed the potential of being impacted by flooding, mud, and debris flow. The Public Works Services Department created an action plan to coincide with the overall city emergency operations plan in preparation for the anticipated flood, mud, and debris programs. Probability Once a wildfire occurs the next greatest concern for the foothill community that experiences the wildfire is a Slope Failure or debris flow when the winter rains arrive. Looking at other data from debris flows in Los Angeles County, once a wildfire burns through an area, that location is an area of concern for the next five years. A significant rainstorm in the year following a wildfire creates the highest degree of probability of Slope Failure or debris flow. This probability is directly tied to a wildfire occurring in Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-6 the months leading up to the rainy season. The communities of Monrovia, Duarte, Azusa and Glendora, California all experienced significant Slope Failure or debris flows in the winter months after the Madison, Fish and Colby Fires. With the foothills above Arcadia experiencing a wildfire every 4.5 years as outlined in the Wildfire section of this report, the probability of Slope Failure or debris flows in the fire impacted areas could also be every 4.5 years. Risk Analysis Vulnerability assessment for Slope Failures will assist in predicting how different types of property and population groups will be affected by a hazard.16 Data that includes specific Slope Failure-prone and debris flow locations in the city can be used to assess the population and total value of property at risk from future Slope Failure occurrences. indicator of hill slope stability. The City uses a 20% or greater threshold to identify potentially unstable hill slopes. The Mt. Wilson and El Monte seismic hazard maps, which are published by the California Department of Conservation, Division of Mines, show that the extreme northeast section of the City is the only portion of the City with the potential for Slope Failures. Although the acreage has not been calculated, it accounts for a very small part of the City. While a quantitative vulnerability assessment (an assessment that describes number of lives or amount of property exposed to the hazard) has not yet been conducted for City of Arcadia Slope Failure events, there are many qualitative factors that point to potential vulnerability. Slope Failures can impact major transportation arteries, blocking residents from essential services and businesses. Past Slope Failure events have caused property damage or significantly impacted City residents and continuing to map City Slope Failure and debris flow areas will help in preventing future loss. Factors included in assessing Slope Failure risk include population and property distribution in the hazard area, the frequency of Slope Failure or debris flow occurrences, slope steepness, soil characteristics, and precipitation intensity. This type of analysis could generate estimates of the damages to the City due to a specific Slope Failure or debris flow event. At the time of publication of this plan, data was insufficient to conduct a risk analysis and the software needed to conduct this type of analysis was not available. To view potential areas for Slope Failures, see the Slope Failure and Debris Flow Map 7- 3 Economic Impact The City of Arcadia has a total assessed valuation of $15,676,471,562. This can be further broken into: Residential properties valued at $12,959,501,963 Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-7 Commercial properties valued at $1,524,210,934 Other properties valued at $ 1,192,758,665 A Slope Failure or debris flow could only affect a small portion of the City of Arcadia. Until further studies are run, no more specific information is available. Arcadia s Current Mitigation of Slope Failure Hazards Slope Failures can affect utility services, transportation systems, and critical lifelines. Communities may suffer immediate damages and loss of service. Disruption of infrastructure, roads, and critical facilities may also have a long-term effect on the economy. Utilities, including potable water, wastewater, telecommunications, natural gas, and electric power, are all essential to service community needs. Loss of electricity has the most widespread impact on other utilities and on the whole community. Natural gas pipes as small as an inch or two may also be at risk of breaking during Slope Failure movements. Roads and Bridges Losses incurred from Slope Failure hazards in the City of Arcadia have been associated with roads. The City of Arcadia Public Works Services Department is responsible for responding to slides that inhibit the flow of traffic or are damaging a road/bridge. Lifelines and Critical Facilities Lifelines and critical facilities should remain accessible, if possible, during a hazardous event. The impact of closed transportation arteries may be increased if the closed road or bridge is critical for hospitals and other emergency facilities. Therefore, inspection and repair of critical transportation facilities and routes is essential and should receive high priority. Losses of power and phone service are also potential consequences of Slope Failure events. Due to heavy rains, soil erosion in hillside areas can be accelerated, resulting in loss of soil support beneath high voltage transmission towers in hillsides and remote areas. Flood events can also cause Slope Failures, which can have serious impacts on gas lines that are located in vulnerable soils. Slope Failure Building/Zoning Codes building and zoning codes. The codes outline standards for development within the hillside area of the City. Generally, the ordinance requires geotechnical and engineering geologic studies for developments proposed on slopes of 20 percent or greater. More detailed surface and subsurface investigations shall be warranted if indicated by the geotechnical and geologic studies. This may include soils, vegetation, geologic formations, and drainage patterns. Site evaluations may also occur where stability might be lessened by proposed grading/filling or land clearing. Residential Areas Even minor amounts of rain and mud flow have the potential to cause extensive damage to homes and properties. In order to assist the residents of Arcadia, the City provides free sandbags to help in their mitigation activities. Local Hazard Mitigation Plan 2022 Section 7.3 Slope Failure 7.3-8 Community Issues Summary The hillsides above the residences in the WUI area of Arcadia are very steep. In the past rainstorms following a wildland fire have created slope failures and debris flows in the residential areas. Works Cited 1 Geosciences, Idaho State University 3 Ibid. 4 Barrows, Alan and Smith, Ted, DMG Note 13, http://www.consrv.ca.gov/cgs/information/publications/cgs_notes/note_33/ 5 Mileti, Dennis, Disasters by Design: A Reassessment of Natural Hazards in the United States (1999) Joseph Henry Press, Washington D.C. 6 Brabb, E.E., and B.L Harrod. (Eds) Slope Failures: Extent and Economic Significance. Proceedings of the 28th International Geological Congress Symposium on Slope Failures. (1989) Washington D.C., Rotterdam: Balkema. 7 Ibid. 8 Ibid 9 Ibid. 10 Ibid. 11Ibid. 12 http://www.usgs.gov/homepage/Slope Failure_laguna.asp 13 http://pubs.usgs.gov/of/2005/1067/pdf/OF2005-1067.pdf 14Pasadena Star News, Feb 24, 2000 15 Pasadena Star News, Jan 29, 2005 Pg. A1 and A4 16 Burby, R. (Ed.) Cooperating With Nature (1998) Washington D.C.: Joseph Henry Press. LAS TUNAS DR CENTEN NIAL REAL GOLDRING CLARK AZ U S A RD L O W E R PECK RD L I V E O A K A V RD CAMINO SIERRA MADRE BL AV AV GRAND VIEW DR OAKS HIGHL AND ST JOSEPH ST DR CAMPUS DR DU A RT E AV W AY DR HU NTIN GTO N BALDWIN AV HUNTINGTON AV 6TH AV 10TH 1STAV AV ANITA SANTA EL MONTE REALCAMINO HOLLY R D AV AV AV LONGDEN AV 2ND GOLDEN W EST BALDWIN BL BLADWIN AV COLORADO BL DR HUNTINGTON BLFOOTHILL COLORADO ST SANTA CLARA ST DRR DCANYON SUNSET MICHILLINDA AV ORANGE GROVE ELKINS AV H I G H L A N D VISTA ARCADIA H S HUGO REID PRIMARY SERENDIPITY SCHOOL CONTINUATION SCHOOL HUGO REID ELEM. BALDWIN STOCKER ELEM. LONGLEY WAY ELEM. CAMINO GROVE ELEM. RICHARD H DANA JR H S 1ST AVENUE JR H S FOOTHILLS JR H S HIGHLAND OAKS ELEM HOLLY AVENUE ELEM TIERRA VERDE PARK WINNIE WAY PARK BICENTENNIAL PARK LONGDEN AVENUE PARK BALDWIN STOCKER PARK HOLLY AVENUE PARK FAIRVIEW AVENUE PARK WILDERNESS PARK TRIPOLIS FRIENDSHIP PARK HUGO REID PARK CIVIC CENTER ATHLETIC FIELD HIGHLAND OAKS PARK PARK BO NITA EISENHOWER PARK FOREST PARK PARK GROVE CAMINO ORANGE GROVE PARK NEWCASTLE PARK S A N T A A N I T A W A S H EAST BRANCH A R C A D I A LIBRARY STATION FI R E WA S H S A N T A A N I T AOFFICE PO S T EAST BRANCH WA S H ARCADIA AR C A D I A DR A IN WASH SAN GABRIEL6' SEWER EASE W A S H GOLF COURSE SANTA ANITA H A L L STATION FI R E A R B O R E T U M S T A T E A N D C O U N T Y L O S A N G E L E S RACE TRACK P A R K ANITA SANTA WA S H SANTA ANITA ARCADIA PO S T OF F I C E A R E A WASH SI E R R A M A D R E D E B R I S D I S P O S A L ELEM RIO HONDO COURSE SAWPIT FIRE D R A I N STATION WASH A RCAD IA L A T E R A L W A SH SANT A A N I T A LI M A SANTA ANITA WASH DEBRIS BASIN GOLF ARCADIA C H A N N E L H O N D ORIO PUBLIC WORKS SERVICES DEPARTMENT P D CHAMBER OF COMMERCE RECREATION & COMMUNITY SERVICES DEPARTMENT M ETHO DIST H OSPITAL C I T Y RIVER WESTFIELDSHOPPING TOWNATSANTA ANITA ARCADIA COUNTY PARK PE C K R O AD W A T E R & C O N S E R V A TIO N P A R K GROVE PLANT ORANGE ST JOSEPH PLANT PECK ROAD PLANT SANTAANITA PLANT LIVE OAK PLANT LOWER CANYON PLANT UPPERCANYON PLANT LONGLEYWELL LONGDEN PLANT BALDWIN PUMP PLANT RANCHO WELL NO. 6 HUGO REID WELL BALDWIN WELL NO. 2 CHAPMAN PLANT ANOKIA WELL CAMINO REALPLANT TORREY PINE RESERVOIRS HIGH PRES SURE GAS PIPELINE HIGH PRESSURE HIGH PRESSURE GAS PIPELINE HIGH PRESSURE GAS PI PELINE HIGH PRESSURE GAS PIPELINE GAS PIPELINE 3 8 1 2 9 6 5 10 4 7 11 ARCADIA GOLDLINE STATION Liquefaction Earthquake-Induced Landslides RESERVOIRS CRITICAL BUILDINGS HIGH PRESSURE GAS PIPELINE LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-1 Definition of a Windstorm A storm marked by high wind with little or no precipitation Windstorm Related Hazards Santa Ana Winds Santa Ana winds are generally defined as warm, dry winds that blow from the east or northeast (offshore). These winds occur below the passes and canyons of the coastal ranges of Southern California and in the Los Angeles basin. Santa Ana winds often blow with exceptional speed in the Santa Ana Canyon (the canyon from which it derives its name). Forecasters at the National Weather Service offices in Oxnard and San Diego usually place speed minimums on these winds and reserve the use of "Santa Ana" for winds greater than 25 knots.1 These winds accelerate to speeds of 35 knots as they move through canyons and passes, with gusts to 50 or even 60 knots. The complex topography of Southern California combined with various atmospheric conditions creates numerous scenarios that may cause widespread or isolated Santa Ana events. Commonly, Santa Ana winds develop when a region of high pressure builds over the Great Basin (the high plateau east of the Sierra mountains and west of the Rocky mountains including most of Nevada and Utah). Clockwise circulation around the center of this high-pressure area forces air down slope from the high plateau. The air warms as it descends toward the California coast at the rate of 5 degrees F per 1000 feet due to compressional heating. Thus, compressional heating provides the primary source of warming. The air is dry since it originated in the desert, and it dries out even more as it is heated.2 These regional winds typically occur from October to March, and, according to most accounts, are named either for the Santa Ana River Valley where they originate or for the Santa Ana Canyon, southeast of Los Angeles, where they pick up speed. Tornados Tornadoes are spawned when there is warm, moist air near the ground, cool air aloft, and winds that speed up and change direction. An obstruction, such as a house, in the path of the wind causes it to change direction. This change increases pressure on parts of the house, and the combination of increased pressures and fluctuating wind speeds creates stresses that frequently cause structural failures. In order to measure the intensity and wind strength of a tornado, Dr. T. Theodore Fujita developed the Fujita Tornado Damage Scale. This scale compares the estimated wind velocity with the corresponding amount of suspected damage. The scale measures six classifications of LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-2 The chart below depicts the Fujita Tornado Damage Scale: Scale Wind Estimate (mph) Typical Damage F0 < 73 Light damage. Some damage to chimneys and TV antennas; breaks twigs off trees; pushes over shallow-rooted trees. F1 73-112 Moderate damage. Peels surface off roofs; windows broken; light trailer houses pushed or overturned; some trees uprooted or snapped; moving automobiles pushed off the road. 74 mph is the beginning of hurricane wind speed. F2 113-157 Considerable damage. Roofs torn off frame houses leaving strong upright walls; weak buildings in rural areas demolished; trailer houses destroyed; large trees snapped or uprooted; railroad boxcars pushed over; light object missiles generated; cars blown off highway. F3 158-206 Severe damage. Roofs and some walls torn off frame houses; some rural buildings completely demolished; trains overturned; steel-framed hangar-warehouse-type structures torn; cars lifted off the ground; most trees in a forest uprooted snapped, or leveled. F4 207-260 Devastating damage. Whole frame houses leveled, leaving piles of debris; steel structures badly damaged; trees debarked by small flying debris; cars and trains thrown some distances or rolled considerable distances; large missiles generated. F5 261-318 Incredible damage. Whole frame houses tossed off foundations; steel-reinforced concrete structures badly damaged; automobile- sized missiles generated; trees debarked; incredible phenomena can occur. F6- F12 319 to sonic Inconceivable damage. Should a tornado with the maximum wind speed in excess of F5 occur, the extent and types of damage may not be conceived. A number of missiles such as iceboxes, water heaters, storage tanks, automobiles, etc. will create serious secondary damage on structures. Source: http://weather.latimes.com/tornadoFAQ.asp LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-3 Microbursts Unlike tornados, microbursts are strong, damaging winds, which strike the ground and often give the impression a tornado has struck. They frequently occur during intense thunderstorms. The origin of a microburst is downward moving air from a thunderstorm's core. However, unlike a tornado, they affect only a rather small area. Tornados, like those that occur every year in the Midwest and Southeast parts of the United States, are a rare phenomenon in most of California, with most tornado-like activity coming from microbursts. History of Windstorms in Southern California While the effects of Santa Ana Winds are often overlooked, it should be noted that in 2003, two deaths in Southern California were directly related to the fierce condition. A falling tree struck one woman in San Diego.3 The second death occurred when a flying pickup truck cover launched by the Santa Ana Winds hit a passenger in a vehicle.4 Windstorms in Arcadia December 1988 - Windstorm Fifty- to sixty-mile per hour winds blew through Arcadia. Over forty trees were uprooted, power lines were knocked down, structures were damaged, and there was even a 150-gallon diesel fuel spill when a semi-fuel line was ripped apart by a fallen street sign. Some residents were left without power for days and about 200 lost telephone services. City officials said it would take about a week to 10 days to clean up all the debris. 5 January 2003 Windstorm Eighty- to one hundred-mile an hour winds swept through Arcadia causing major damage to the south end of the City. Twenty-nine Edison power poles were knocked down and another six suffered severe damage; all needing to be replaced by metal poles. More than 250,000 people were without power. Businesses suffered damage, lost customers, and product spoiled. One business owner said he lost over $500 in spoiled food that required refrigeration and at least twenty-five regular customers. 6 October 2009 -Windstorm High winds with gusts up to eighty miles per hour blew through Southern California. Although Arcadia received less damage than some other southland cities, power lines were damaged and caused 16,000 Edison customers in and around Arcadia to be without electricity. 7 December 2011 Windstorm High north winds with gusts up to 70 miles per hour blew through the San Gabriel Valley. For a period of time the entire community of Arcadia was without electrical power and many major transportation arteries were blocked with down trees and wires. The City of Arcadia activated its Emergency Operations Center and declared a local emergency. The EOC remained fully LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-4 activated through December 5, 2011. Many residents were without electrical service for up to one week. The City of Arcadia opened up a warming/charging center for residents during the event. Emergency crews worked through the first week clearing trees from roadways to gain emergency access. Public works crews worked through January 2012 clearing debris piles in the public right of ways. The total cost to the City of Arcadia for response to and recover from the incident was approximately $2,800.000. Windstorm Hazard Assessment A windstorm event in the region can range from short term microburst activity lasting only minutes to a long duration Santa Ana wind condition that can last for several days as in the case of the January 2003 Santa Ana wind event. Windstorms in the City of Arcadia area can cause extensive damage including heavy tree stands, exposed coastal properties, road and highway infrastructure, and critical utility facilities. The map shows clearly the direction of the Santa Ana winds as they travel from the stable, high-pressure weather system called the Great Basin High through the canyons and towards the low-pressure system off the Pacific. Clearly the area of the City of Arcadia is in the direct path of the ocean-bound Santa Ana winds. Probability When looking at damaging wind events, it is important to look at the frequency they have occurred in order to estimate the probability of an event taking place in the future. After the 2011 Windstorm event, Scott Sukup of the NOAA/NWS Oxnard, CA office wrote a paper titled Downslope Wind E strong north to NNE flow over the San Gabriel Mountain Range are a very rare phenomenon. From October 1979 through March 2014, there were only nine events with documented wind damage in this area. Of these nine events, the 1 December 2011 and 6 January 1997 events were the only events to produce widespread damage across most of the foothill and valley areas south of the SGM. It is estimated that extreme events such as these occur about once every 10-20 years, while less significant events occur once every 3-5 years.8 LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-5 Risk Analysis With an analysis of the can deduce the common windstorm impact areas including impacts on life, property, utilities, infrastructure, and transportation. Additionally, if a windstorm disrupts power to local residential communities, the American Red Cross and City resources might be called upon for care and shelter duties. Displacing residents and utilizing City resources for shelter staffing and disaster cleanup can cause an economic hardship on the community. Life and Property Based on the history of the region, windstorm events can be expected, perhaps annually, across widespread areas of the region, which can be adversely impacted during a windstorm event. This can result in the involvement of City of A wide-ranging windstorm or microburst tornadic activity. Both residential and commercial structures with weak reinforcement are susceptible to damage. Wind pressure can create a direct and frontal assault on a structure, pushing walls, doors, and windows inward. Conversely, passing currents can create lift suction forces that pull building components and surfaces outward. With extreme wind forces, the roof or entire building can fail causing considerable damage. Such damage occurred to property on December 2011 when severe windstorm knocked down power lines, disrupted traffic and electrical service. Debris carried along by extreme winds can directly contribute to loss of life and indirectly to the failure of protective building envelopes, siding, or walls. When severe windstorms strike a community, downed trees, power lines, and damaged property can be major hindrances to emergency response and disaster recovery. The Beaufort scale below, coined and developed by Sir Francis Beaufort in 1805, illustrates the effect that varying wind speed can have on sea swells and structures: Beaufort Force Speed (mph) Wind Description - State of Sea - Effects on Land 0 Less 1 Calm - Mirror-like - Smoke rises vertically 1 1-3 Light - Air Ripples look like scales; No crests of foam - Smoke drift shows direction of wind, but wind vanes do not 2 4-7 Light Breeze - Small but pronounced wavelets; Crests do not break - Wind vanes move; Leaves rustle; You can feel wind on the face 3 8-12 Gentle Breeze - Large Wavelets; Crests break; Glassy foam; A few whitecaps - Leaves and small LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-6 twigs move constantly; Small, light flags are extended 4 13-18 Moderate Breeze - Longer waves; Whitecaps - Wind lifts dust and loose paper; Small branches move 5 19-24 Fresh Breeze - Moderate, long waves; Many whitecaps; Some spray - Small trees with leaves begin to move 6 25-31 Strong Breeze - Some large waves; Crests of white foam; Spray - Large branches move; Telegraph wires whistle; Hard to hold umbrellas 7 32-38 Near Gale - White foam from breaking waves blows in streaks with the wind - Whole trees move; Resistance felt walking into wind 8 39-46 Gale - Waves high and moderately long; Crests break into spin drift, blowing foam in well marked streaks - Twigs and small branches break off trees; Difficult to walk 9 47-54 Strong Gale - High waves with wave crests that tumble; Dense streaks of foam in wind; Poor visibility from spray - Slight structural damage 10 55-63 Storm - Very high waves with long, curling crests; Sea surface appears white from blowing foam; Heavy tumbling of sea; Poor visibility - Trees broken or uprooted; Considerable structural damage 11 64-73 Violent Storm - Waves high enough to hide small and medium sized ships; Sea covered with patches of white foam; Edges of wave crests blown into froth; Poor visibility - Seldom experienced inland; Considerable structural damage 12 >74 Hurricane - Sea white with spray. Foam and spray render visibility almost non-existent - Widespread damage. Very rarely experienced on land. Source: http://www.compuweather.com/decoder-charts.html Utilities Historically, falling trees have been the major cause of power outages in the region. Windstorms such as strong microbursts and Santa Ana Wind conditions can cause flying debris and downed utility lines. For example, tree limbs breaking in winds of only 45 mph can be thrown over 75 feet. As such, overhead power lines can be damaged even in relatively minor windstorm events. Falling trees can bring electric power lines down to the pavement, creating the possibility of lethal electric shock. Rising population growth and new infrastructure in the region creates a higher probability for damage to occur from windstorms as more life and property are exposed to risk. Infrastructure Windstorms can damage buildings, power lines, and other property and infrastructure due to falling trees and branches. During wet winters, saturated soils cause trees to become less stable and more vulnerable to uprooting from high winds. Windstorms can result in collapsed or damaged buildings or blocked roads and bridges, damaged traffic signals, streetlights, and parks, among others. Roads blocked by fallen trees during a LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-7 windstorm may have severe consequences to people who need access to emergency services. Emergency response operations can be complicated when roads are blocked or when power supplies are interrupted. Industry and commerce can suffer losses from interruptions in electric services and from extended road closures. They can also sustain direct losses to buildings, personnel, and other vital equipment. There are direct consequences to the local economy resulting from windstorms related to both physical damages and interrupted services. Increased Fire Threat Perhaps the greatest danger from windstorm activity in Southern California comes from the combination of the Santa Ana winds with the major fires that occur every few years in the urban/wildland interface. With the Santa Ana winds driving the flames, the speed and reach of the flames is even greater than in times of calm wind conditions. The higher fire hazard raised by a Santa Ana wind condition requires that even more care and attention be paid to proper brush clearances on property in the wildland/urban interface areas. Transportation Windstorm activity can have an impact on local transportation in addition to the problems caused by downed trees and electrical wires blocking streets and highways. During periods of extremely strong Santa Ana winds, major highways can be temporarily closed to truck and recreational vehicle traffic. However, typically these disruptions are not long lasting, nor do they carry a severe long-term economic impact on the region. Existing Windstorm Mitigation in Arcadia As stated, one of the most common problems associated with windstorms is power outage. High winds commonly occur during winter storms, and can cause trees to bend, sag, or fail (tree limbs or entire trees), coming into contact with nearby distribution power lines. Fallen trees can cause short-circuiting and conductor overloading. Wind-induced damage to the power system causes power outages to customers, incurs cost to make repairs, and in some cases can lead to ignitions that start wild land fires. One of the strongest and most widespread existing mitigation strategies pertains to tree clearance. Currently, California State Law requires utility companies to maintain specific clearances (depending on the type of voltage running through the line) between electric power lines and all vegetation. Enforcement of the following California Public Resource Code Sections provides guidance on tree pruning regulations:9 LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-8 4293: Power Line Clearance Required 4292: Power Line Hazard Reduction 4291: Reduction of Fire Hazards Around Buildings 4171: Public Nuisances The following pertain to tree pruning regulations and are taken from the California Code of Regulations: Title 14: Minimum Clearance Provisions Sections 1250-1258 General Industry Safety Orders Title 8: Group 3: Articles 12, 13, 36, 37, 38 California Penal Code Section 385 Finally, the following California Public Utilities Commission section has additional guidance: California Public Utilities Commission General Order 95: Rule 35 Homeowner Liability Failure to allow a utility company to comply with the law can result in liability to the homeowner for damages or injuries resulting from a vegetation hazard. Many insurance companies do not cover these types of damages if the policy owner has refused to allow the hazard to be eliminated. The power companies, in compliance with the above regulations, collect data about tree failures and their impact on power lines. This mitigation strategy assists the power company in preventing future tree failure. From the collection of this data, the power company can advise residents as to the most appropriate vegetative planting and pruning procedures. Economic Impact The City of Arcadia has a total assessed valuation of $15,676,471,562. This can be further broken into: Residential properties valued at $12,959,501,963 Commercial properties valued at $ 1,524,210,934 Other properties valued at $ 1,192,758,665 A windstorm would only influence a specific portion of the city and each event would be unique. A more detailed projected economic impact cannot be obtained. The impact of a wind driven wildfire will be discussed under the section devoted to a wildfire hazard. 1http://www.treesaregood.com/tree care/avoiding_conflicts.asp LOCAL HAZARD MITIGATION PLAN 2022 Section 7.4 WINDSTORM 7.4-9 Community Issues Summary A windstorm within Arcadia can create local impacts with power outages in neighborhoods and trees down blocking traffic. Major streets blocked by trees would also impact traffic within neighboring communities. Several major power lines that feed the San Gabriel Valley run through Arcadia and have been impacted by previous windstorms. Works Cited: 1 http://nimbo.wrh.noaa.gov/Sandiego/snawind.html 2 Ibid 3 www.cbsnews.com, January 8, 2003 4 www.cbsnews.com/stories/2003/01/06/national/ 5 Arcadia Tribune 12/11/1988 Pg A1-A2 6 Pasadena Star News 01/08/2003 Pg A1-A4 7 www.nbclosangeles.com/news/loacl-beat/Fierce-Wind-Storm-Rips-Through-Southern 8 DAMAGING DOWNSLOPE WIND EVENTS IN THE SAN GABRIEL VALLEY OF SOUTHERN CALIFORNIA SCOTT SUKUP NOAA/NWS, Oxnard, California 9 www.cpuc.ca.gov/js.asp Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-1 Definition of a Wildfire A sweeping and destructive conflagration especially in a wilderness or a rural area.i Wildfire Related Hazards There are three categories of interface fire:ii The classic wildland/urban interface exists where well-defined urban and suburban development presses up against open expanses of wildland areas. The mixed wildland/urban interface is characterized by isolated homes, subdivisions, and small communities situated predominantly in wildland settings. The occluded wildland/urban interface exists where islands of wildland vegetation occur inside a largely urbanized area. Certain conditions must be present for significant interface fires to occur. The most common conditions include hot, dry and windy weather; the inability of fire protection forces to contain or suppress the fire; the occurrence of multiple fires that overwhelm committed resources; and a large fuel load (dense vegetation). Once a fire has started, several conditions influence its behavior, including fuel topography, weather, drought and development. Southern California has two distinct areas of risk for wildland fire. The foothills and lower mountain areas are covered with scrub brush or chaparral. The higher elevations of mountains also have heavily forested terrain. The lower elevations covered with chaparral create one type of exposure. The Interface One challenge Southern California faces regarding the wildfire hazard is from the increasing number of houses being built on the urban/wildland interface. Every year the growing population has expanded further and further into the hills and mountains, including forestlands. The increased "interface" between urban/suburban areas and the open spaces created by this expansion has produced a significant increase in threats to life and property from fires and has pushed existing fire protection systems beyond original or current design and capability. Property owners in the interface are not aware of the problems and threats they face. Therefore, many owners have done very little to manage or offset fire hazards or risks on their own property. Furthermore, human activities increase the incidence of fire ignition and potential damage. Fuel Fuel is the material that feeds a fire and is a key factor in wildfire behavior. Fuel is classified by volume and by type. Volume is described in terms of "fuel loading," or the amount of available vegetative fuel. The type of fuel also influences wildfire. Chaparral is a primary fuel of Southern California wildfires. Chaparral communities experience long dry summers and receive most of their annual precipitation from winter rains. Although chaparral is often considered as a single species, there are two distinct types: hard chaparral and soft chaparral. Within these two types are dozens of different plants, each with its own particular characteristics. Topography Topography influences the movement of air, thereby directing a fire course. For example, if the percentage of uphill slope doubles, the rate of spread in wildfire will Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-2 likely double. Gulches and canyons can funnel air and act as chimneys, which intensify fire behavior and cause the fire to spread faster. Solar heating of dry, south-facing slopes produces up slope drafts that can complicate fire behavior. Unfortunately, hillsides with hazardous topographic characteristics are also desirable residential areas in many communities. This underscores the need for wildfire hazard mitigation and increased education and outreach to homeowners living in interface areas. Weather Weather patterns combined with certain geographic locations can create a favorable climate for wildfire activity. Areas where annual precipitation is less than 30 inches per year are extremely fire susceptible.iii High-risk areas in Southern California share a hot, dry season in late summer and early fall when high temperatures and low humidity favor fire activity. The so- they flow down to Southern California from Utah, create a particularly high risk, as they can rapidly spread what might otherwise be a small fire. Drought Recent concerns about the effects of climate change, particularly drought, are contributing to concerns about wildfire vulnerability. The term drought is applied to a period in which an unusual scarcity of rain causes a serious hydrological imbalance. Unusually dry winters, or significantly less rainfall than normal, can lead to relatively drier conditions and leave reservoirs and water tables lower. Drought leads to problems with irrigation and may contribute to additional fires, or additional difficulties in fighting fires. Development Growth and development in scrubland and forested areas is increasing the number of human-made structures in Southern California interface areas. Wildfire has an effect on development, yet development can also influence wildfire. Owners often prefer homes that are private, have scenic views, are nestled in vegetation and use natural materials. A private setting may be far from public roads, or hidden behind a narrow, curving driveway. These conditions, however, make evacuation and firefighting difficult. The scenic views found along mountain ridges can also mean areas of dangerous topography. Natural vegetation contributes to scenic beauty, but it may also provide a ready trail of fuel leading a fire directly to the combustible fuels of the home itself. History of Wildfires in California Large fires have been part of the Southern California Landscape. Five of the top ten fires based on acreage in California have occurred since 2003. On the next page is the top ten list. Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-3 Table 7.5-1 Ten Largest Wildfires in California Based on Acreage. Fire Name Date County Acres August Complex August 200 Mendocino, Humboldt, Trinity, Tehama, Glenn, Lake & Colusa 1,032,649 Mendocino Complex July 2018 Colusa, Lake, Mendocino & Glenn 459,123 SCU Lightning Complex August 2020 Stanislaus,, Santa Clara, Alameda, Contra costa, San Joaquin 396,624 Creek Fire September 2020 Fresno & Madrea 377,693 LNU Lightning Complex August 2020 Sonoma, Lake, Napa, Yolo & solano 363,220 North Complex August 2020 Butte, Plumas & Yuba 318,930 Thomas December-17 Ventura & Santa Barbara 287,893 Cedar October-03 San Diego 273,246 Rush August-12 Lassen 271,911 CA / 43,666 NV Rim August-13 Tuolumne 257,314 CALFIRE 11/3/2020 Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-4 History of Wildfires in and near Arcadia Bobcat Fire In September 2020 the Bobcat Fire began at the Cogswell Reservoir area of the Angeles National Forest. Throughout the next week fire burned toward the City of Arcadia. One week after the Bobcat Fire started, it had reached the ridge line directly above the City of Arcadia. Three hundred homes were evacuated as a precaution. Due to firefighting efforts, no homes were damaged within Arcadia. All the displaced residents were allowed back into their homes four days later. In total the Bobcat Fire burned for more than three weeks and consumed over 116,000 acres within the Angeles National Forest. Santa Anita II Fire In April 2008 the Santa Anita II Fire began on Santa Anita Canyon Road and burned West to the foothills above Sierra Madre, CA. Over 600 acres burned, one out building was lost, and four minor injuries to personnel fighting the fire. Over 400 people had to be evacuated from the community of Sierra Madre as the fire raged dangerously close to homes. The fire consumed almost 600 acres and was contained in about a week. Madison Fire In April 2013 the Madison Fire took place in foothills above the community of Monrovia immediately adjacent to the City of Arcadia. When the fire was contained 213 acres had been consumed and no property was damaged. Colby Fire In January of 2014 the Colby Fire took place in the foothill above the communities of Azusa and Glendora in the East end of the San Gabriel Valley. The fire burned more than 1,992 acres and destroyed 15 properties including 5 residences. Fish Fire In June of 2016 the Fish Fire broke out above the community of Duarte in the San Gabriel Valley. 3,700 acres were burned in the fire and there was no reported damage to structures. Station Fire In late August 2009, an arsonist started a fire in the hills above La Cañada Flintridge, California. The flames raged for over two months and experts stated that the embers wo 160,577 acres (251 sq. mi), 209 structures destroyed, including 89 homes, and the lives of two LA County Firefighters The blaze threatened 12,000 structures in the National Forest and the nearby communities of La Cañada Flintridge, Glendale, Acton, La Crescenta, Littlerock and Altadena, as well as the Sunland and Tujunga neighborhoods of the City of Los Angeles. The blaze is the 15th largest in California history. Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-5 Wildfire Hazard Assessment Wildfire hazard areas are commonly identified in regions of the wildland/urban interface. Ranges of the wildfire hazard are further determined by the ease of fire ignition due to natural or human conditions and the difficulty of fire suppression. The wildfire hazard is also magnified by several factors related to fire suppression/control such as the surrounding fuel load, weather, topography, and property characteristics. Generally, hazard identification rating systems are based on weighted factors of fuels, weather and topography. Table 11.3 illustrates a rating system to identify wildfire hazard risk (with a score of 3 equaling the most danger and a score of 1 equaling the least danger.) Sample Hazard Identification Rating System Table Table 7.5-2 Category Indicator Rating Roads and Signage Steep; narrow; poorly signed 3 One or two of the above 2 Meets all requirements 1 Water Supply None, except domestic 3 Hydrant, tank, or pool over 500 feet away 2 Hydrant, tank, or pool within 500 feet 1 Location of the Structure Top of steep slope with brush/grass below 3 Mid-slope with clearance 2 Level with lawn, or watered groundcover 1 Exterior Construction Combustible roofing, open eaves, Combustible siding 3 One or two of the above 2 Non-combustible roof, boxed eaves, non-combustible siding 1 In order to determine the "base hazard factor" of specific wildfire hazard sites and interface regions, several factors must be taken into account. Categories used to assess the base hazard factor include: topographic location, characteristics, and fuels; site/building construction and design; site/region fuel profile (landscaping); defensible space; accessibility; fire protection response; and water availability. The use of Geographic Information System (GIS) technology in recent years has been a great asset to fire hazard assessment, allowing further integration of fuels, weather, and Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-6 topography data for such ends as fire behavior prediction, watershed evaluation, mitigation strategies, and hazard mapping. Probability Southern California and Los Angeles County have an extensive history of wildfires. Between 1993 and today, there have be wildland fires in the foothills of Arcadia on numerous occasions. These include: Year Fire Name Acerage 1993 Kinneloa 5700 1999 Santa Anita I 100 2002 Chantry Rd 11 2008 Santa Anita II 600 2009 Station Fire 160,577 2013 Madison 213 2017 Norumbega 5 2021 Chantry Flats 3 2021 Bobcat 116,000 These fires took place either above Arcadia or an immediate neighbors of Sierra Madre and Monrovia. This averages out to a significant wildland fire once every 4.5 years. Risk Analysis Southern California residents are served by a variety of local fire departments as well as county, state and federal fire resources. Data that includes the location of interface areas in the county can be used to assess the population and total value of property at risk from wildfire and direct these fire agencies in fire prevention and response. Key factors included in assessing wildfire risk include ignition sources, building materials and design, community design, structural density, slope, vegetative fuel, fire occurrence and weather, as well as occurrences of drought. Refer to Map 7-5 to see the wildfire hazard ratings in the City of Arcadia. The National Wildland/Urban Fire Protection Program has developed the Wildland/Urban Fire Hazard Assessment Methodology tool for communities to assess their risk to wildfire. For more information on wildfire hazard assessment refer to http://www.Firewise.org. Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-7 Growth and Development in the Interface The hills and mountainous areas of Southern California are considered to be interface areas. The development of homes and other structures is encroaching onto the wildland and is expanding the wildland/urban interface. The interface neighborhoods are characterized by a diverse mixture of varying housing structures, development patterns, ornamental and natural vegetation and natural fuels. In the event of a wildfire, vegetation, structures and other flammables can merge into unwieldy and unpredictable events. Factors important to the fighting of such fires include access, firebreaks, proximity of water sources, distance from a fire station and available firefighting personnel and equipment. Reviewing past wildland/urban interface fires shows that many structures are destroyed or damaged for one or more of the following reasons: Combustible roofing material; Wood construction; Structures with no defensible space; Fire department with poor access to structures; Subdivisions located in heavy natural fuel types; Structures located on steep slopes covered with flammable vegetation; Limited water supply; and Winds over 30 miles per hour. Economic Impact The assess valuation of the Wildland Interface Area is $829,408,125.00. This is for all of the properties located in the Interface area as depicted on Map 7-5. A fire impacting the area on a small scale would obviously result in less of an economic impact. Current Mitigation in Arcadia Buildings Often times the reason structures are lost or damaged in wildland urban interface fires is due to wood shake roof coverings. The City of Arcadia Municipal Code 8130.18 has been implemented to reduce the risk of fire to structures in the City. Arcadia Municipal Code 8130.18 The roof covering on any structure regulated by this code shall have a minimum class A rating in the Wildland Interface Fire Area Boundaries and a class A or B rating in all other areas outside the Wildland Interface Fire Area Boundaries of the City. Pressure treated or untreated wood shakes and wood shingles shall not be installed on any building or structure located in the Wildland Interface Fire Area Boundaries. (See Map 7-5). The City of Arcadia implements Title 19 California Health and Safety Code and the City of Arcadia Municipal Codes to ensure the fire safety in building construction and materials. Equipment The Arcadia Fire Department has outfitted all of their stations with new engines capable of producing Compressed Air Foam systems (CAFs). CAFs enable firefighters to pre- treat homes with retardant foam in the event of a fire nearby. It also enables firefighters Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-8 to extinguish fires using less water, thus putting less demand on an already inundated water system. Operations On Red Flag Warning days the Arcadia Fire Department often staffs extra personnel and makes patrols in areas with high probability of wildfire ignition. In the event a wildland fire does occur in or around the City of Arcadia the Fire Department has created a Brush and Structure Pre-Fire Plan. The plan includes maps of the City with vital information required for operations on a wildland fire. Information includes but is not limited to: location of hydrants, potential staging areas, potential command posts, safe refuge zones, schools, and other critical information for use in the event of a wildland urban interface fire in or near the City of Arcadia. Road Access Road access is a major issue for all emergency service providers. As development encroaches into the rural areas of the county, the number of houses without adequate turn-around space is increasing. In many areas, there is not adequate space for emergency vehicle turnarounds in single-family residential neighborhoods, causing emergency workers to have difficulty doing their jobs because they cannot access houses. As fire trucks are large, firefighters are challenged by narrow roads and limited access, when there is inadequate turn around space, the fire fighters can only work to remove the occupants, but cannot safely remain to save the threatened structures. However, pre- planning, evacuation notices, and road closures help to assist firefighters with mobility in the event of a fire. Water Supply Firefighters in remote and rural areas are faced by limited water supply and lack of hydrant taps. Rural areas are characteristically outfitted with small diameter pipe water systems, inadequate for providing sustained firefighting flows. In the City of Arcadia all new water main lines are eight inch and fire hydrant laterals are six inch. However, older pipes that were installed years ago do not meet the size standards and may be only four inches. Older pipes are upgraded as funds become available or as an opportunity arises and are addressed in sections of our Water Master Plan. They are also addressed completely in Section 7 (Domestic Water System) in City Water Standards. Replacement of older pipes is ongoing. Fire hydrants in Arcadia are spaced at 300 feet in both commercial and residential areas. Though there are some areas where spacing is greater, Public Works adds hydrants and adjusts spacing as lines are replaced. Most hydrants in the City are supplied at about one hundred psi. However, the City has a minimum pressure of twenty psi that each hydrant is to be supplied at all times. The water system is gravity fed and will supply water to hydrants for at least two hours in the event the City is without power. Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-9 Interface Fire Education Programs and Enforcement The biggest concern during a wildland urban interface fire is loss of life and property. Mitigation of loss to life and property begins with the residents and their pre-plans. To assist the residents in planning for a wildland urban interface fire the Arcadia Fire Department implemented an Annual Brush Clearance Program. The program begins by mailing a pamphlet detailing fire hazard reduction and safety guidelines. The pamphlet includes information about maintaining a defensible space, use of fire resistive building materials, planning escape routes, and preparations in the event of a fire near their home. The program is continued by Fire Department inspections of homes. Every May, firefighters asses the defensible space and specific hazards in order to further mitigate loss of life and property. The inspections also help to familiarize firefighters with the area to further assist them in the event of a fire. The Arcadia Fire Department Prevention Bureau has also produced various public safety announcements about smoke alarms, wildfire safety, holiday safety, and the use of fire extinguishers. The videos are played on the Arcadia City channel and are designed to help educate the public on fire safety. Federal Programs The role of the federal land managing agencies in the wildland /urban interface is reducing fuel hazards on the lands they administer; cooperating in prevention and education programs; providing technical and financial assistance; and developing agreements, partnerships and relationships with property owners, local protection agencies, states and other stakeholders in wildland/urban interface areas. These relationships focus on activities before a fire occurs, which render structures and communities safer and better able to survive a fire occurrence. Federal Emergency Management Agency (FEMA) Programs, FEMA is directly responsible for providing fire suppression assistance grants and, in certain cases, major disaster assistance and hazard mitigation grants in response to fires. The role of FEMA in the wildland /urban interface is to encourage comprehensive disaster preparedness plans and programs, increase the capability of state and local governments and provide for a greater understanding of FEMA programs at the federal, state and local levels.iv U.S. Forest Service The U. S. Forest Service (USFS) is involved in a fuel-loading program implemented to assess fuels and reduce hazardous buildup on forestlands. The USFS is a cooperating agency and, while it has little to no jurisdiction in the lower valleys, it has an interest in preventing fires in the interface, as fires often burn up the hills and into the higher elevation US forest lands. Other Mitigation Programs and Activities Some areas of the country are facing wildland/urban issues collaboratively. These are model programs that include local solutions. Summit County, Colorado, has developed a hazard and risk assessment process that mitigates hazards through zoning requirements. In California, the Los Angeles County Fire Department has retrofitted more than 100 fire Local Hazard Mitigation Plan 2022 Section 7.5 Wildfires 7.5-10 engines with fire retardant foam capability and Orange County is evaluating a pilot insurance grading and rating schedule specific to the wildland/urban interface. All are examples successful programs that demonstrate the value of pre-suppression and prevention efforts when combined with property owner support to mitigate hazards within the wildland/urban interface. Community Issues Summary Radio repeater sites are in the WUI area of Arcadia. These serve radios within Arcadia and neighboring communities. There are four reservoir locations within the WUI area of Arcadia Works Cited i http://www.merriam-webster.com/ ii Planning for Natural Hazards: The Oregon Technical Resource Guide, (July 2000) Department of Land Conservation and Development iii Planning for Natural Hazards: The Oregon Technical Resource Guide, (July 2000), Department of Land Conservation and Development iv Source: National Interagency Fire Center, Boise ID and California Division of Forestry, Riverside Fire Lab. DRR DCANYON SUNSET MICHILLINDA ORANGE GROVE ELKINS AV H I G H L A N D VISTA LAS TUNAS DR C EN TE N NIAL REAL GOLDRING CLARK A Z U S A R D L O W E R PECK RD L I VE O A K AV RD CAMINO SIERRA MADRE BL AV AV GRAND VIEW DR OAKS HIGHLAND ST JOSEPH ST DR CAMPUS DR D U ART E AV W AY HU NTIN GT O N BALDWIN AV HUNTINGTON AV 6TH AV 10TH 1STAV AV ANITA SANTA EL MONTE REALCAMINO R D AV AV AV LONGDEN AV 2ND GOLDEN WEST BALDWIN BL BLADWIN AV COLORADO BL D R HUNTINGTON BLFOOTHILL COLORADO ST SANTA CLARA ST ARCADIA H S HUGO REID PRIMARY SERENDIPITY SCHOOL CONTINUATION SCHOOL HUGO REID ELEM. BALDWIN STOCKER ELEM. LONGLEY WAY ELEM. CAMINO GROVE ELEM. RICHARD H DANA JR H S 1ST AVENUE JR H S FOOTHILLS JR H S HIGHLAND OAKS ELEM HOLLY AVENUE ELEM TIERRA VERDE PARK WINNIE WAY PARK BICENTENNIAL PARK LONGDEN AVENUE PARK BALDWIN STOCKER PARK HOLLY AVENUE PARK FAIRVIEW AVENUE PARK WILDERNESS PARK TRIPOLIS FRIENDSHIP PARK HUGO REID PARK CIVIC C ENTER ATHLETIC FIELD HIGHLAND OAKS PARK PARK BONITA EISENHOWER PARK FOREST PARK PARK GROVE CAMINO ORANGE GROVE PARK NEWCASTLE PARK FYFOOTHILLRTE 210 RTE 210 LI M A PUBLIC WORKS SERVICES DEPARTMENT CHAMBER OF COMMERCE RECREATION & COMMUNITY SERVICES DEPARTMENT METHO DIST H OSPITAL WESTFIELDSHOPPING TOWNATSANTA ANITA PD ARCADIA P E C K R O A D W A T E R & C O N S E R V A T I O N P A R K GOLF ARCADIA S A N T A A N I T A W A SH FIRESTATION ANITA SA N T A WA S H LIBRARY STATION FI R E W A S H S I E R R A M A D R E D E B R I S D I S P O S A L SAWPIT GOLF COURSE SANTA ANITA P A R K A R C A D I A C O U N T YC I T Y STATION FI R E A R B O R E T U M S T A T E A N D C O U N T Y L O S A N G E L E S RACE TRACK P A R K ANITA SANTA WASH A R C A DIA ARCADIA EA S T BRANCH LATER A L A R E A WASH H A L L COURSE GROVE PLANT ORANGE ST JOSEPHPLANT PECK ROADPLANT SANTA ANITA PLANT LIVE OAKPLANT LOWERCANYON PLANT UPPER CANYON PLANT LONGLEY WELL LONGDENPLANT BALDWIN PUMP PLANT RANCHO WELL NO. 6 HUGO REID WELL BALDWIN WELL NO. 2 CHAPMAN PLANT ANOKIA WELL CAMINO REAL PLANT TORREY PINE RESERVOIRS 3 8 1 2 9 6 5 10 4 HIGH PRESS URE GAS PIPELINE HIGH PRESSURE HIGH PRESSURE GAS PIPELINE HIGH PRESS URE GAS PIPE LINE HIGH PRESSURE GAS PIPELINE GAS PIPELINE 7 11 ARCADIA GOLDLINE STATION RESERVOIRS CRITICAL BUILDINGS HIGH PRESSURE GAS PIPELINE Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-1 Definition of Drought There are four different ways that drought can be defined: Meteorological a measure of departure of precipitation from normal. Due to climatic differences, what is considered a drought in one location may not be a drought in another location. Agricultural refers to a situation when the amount of moisture in the soil no longer meets the needs of a particular corp. Hydrological occurs when surface and subsurface water supplies are below normal. Socioeconomic refers to the situation that occurs when physical water shortage begins to affect people. Location of Impact Drought has the potential to impact all areas of the City of Arcadia. Concept of Drought Drought is an insidious hazard of nature. Although it has different definitions, it originates from a deficiency of precipitation over an extended period of time, usually a season or more. This deficiency results in a water shortage for some activity, group, or environmental sector. Drought should be considered relative to some long-term average condition of balance between precipitation and evapo-transpiration (i.e., evaporation + transpiration) in a particular area, a condition often percei occurrence, delays in the start of the rainy season, occurrence of rains in relation to principal crop growth stages) and the effectiveness of the rains (i.e., rainfall intensity, number of rainfall events). Other climatic factors such as high temperature, high wind, and low relative humidity are often associated with it in many regions of the world and can significantly aggravate its severity. Drought should not be viewed as merely a physical phenomenon or natural event. Its impacts on society result from the interplay between a natural event (less precipitation than expected resulting from natural climatic variability) and the demand people place on water supply. Human beings often exacerbate the impact of drought. Recent droughts in both developing and developed countries and the resulting economic and environmental impacts and A five-year drought has parched soils, lowered reservoirs and weakened forests. If the past is any guide, the dry spell could go on for decades. One dry year does not normally constitute a drought in California, but serves as a reminder of the need to pl its reservoirs, groundwater basins, and inter-regional conveyance facilities mitigates the effect of short-term dry periods for most water users. Hydrologic conditions constituting a drought for water users in one location may not constitute a drought for water users elsewhere, or for water users having a different water supply. Individual water suppliers may use criteria such as Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-2 rainfall/runoff, amount of water in storage, or expected supply from a water wholesaler to define their water supply conditions. Drought is a gradual phenomenon. Although droughts are sometimes characterized as emergencies, they differ from typical emergency events. Most natural disasters, such as floods or forest fires, occur relatively rapidly and afford little time for preparing for disaster response. Droughts occur slowly, over a multiyear period. There is no universal definition of when a drought begins or ends. Impacts of drought are typically felt first by those most reliant on annual rainfall ranchers engaged in dry land grazing, rural residents relying on wells in low-yield rock formations, or small water systems lacking a reliable source. Criteria used to identify statewide drought conditions do not address these localized impacts. Drought impacts increase with the length of a drought, as carry-over supplies in reservoirs are depleted and water levels in groundwater basins decline. Past California Droughts Droughts exceeding three years are relatively rare in Northern California, the source of much of -34 drought established the criteria commonly used in designing storage capacity and yield of large Northern California reservoirs. reconstruct data through the study of tree rings (called dendrochronology). Information on the thickness of annual growth rings can be used to infer the wetness of the season. Site-specific approaches to supplementing the historical record can include age-dating dry land plant remains now submerged in place by rising water levels, or sediment and pollen studies. For example, a 1994 study of relict tree stumps rooted in present-day lakes, rivers, and marshes suggested that California sustained two epic drought periods, extending over more than three centuries. The first epic drought lasted more than two centuries before the year 1112; the second drought lasted more than 140 years before 1350. In this study, the researcher used drowned tree stumps rooted in Mono Lake, Tenaya Lake, West Walker River, and Osgood Swamp in the central Sierra Nevada. These investigations indicate that California has been subject to droughts more severe and more prolonged than those witnessed in the brief historical record. Between 1986 and 1992, California endured one of its longest droughts ever observed. Drought worsened in 1988 as much of the United States also suffered from severe drought. In California, the six-year drought ended in late 1992 after a significant El Niño event. Between 2007 and 2009, California saw three years of drought conditions, the 12th worst drought period in the state's history, and the first drought for which a statewide proclamation of emergency was issued. This period of drought also saw greatly reduced water diversions from the state water project. The summer of 2007 saw some of the worst wildfires in Southern California history Between 2011 and 2017 California was in a statewide drought. In January 2014, California Governor Brown issued a drought emergency proclamation. The actions taken by the City of Arcadia during this time period are section later in this document. Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-3 Extent of Drought The Drought Severity Classification Table below describes the significance of each drought category Source: https://www.weather.gov/riw/drought_index The following maps show the extent of drought between 2015 and 2020. The City of Arcadia is located in Los Angeles County in the State of California. Los Angeles County is circled in each map. The maps can be found at: https://droughtmonitor.unl.edu/Maps/MapArchive.aspx. Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-4 2015 https://droughtmonitor.unl.edu/Maps/MapArchive.aspx Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-5 2017 Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-6 2020 Impacts of Drought Drought produces a complex web of impacts that spans many sectors of the economy and reaches well beyond the area experiencing physical drought. This complexity exists because water is integral to our ability to produce goods and provide services. Impacts are commonly referred to as direct or indirect. Reduced crop, rangeland, and forest productivity; increased fire hazard; reduced water levels; increased livestock and wildlife mortality rates; and damage to wildlife and fish habitat are a few examples of direct impacts. The consequences of these impacts illustrate indirect impacts. For example, a reduction in crop, rangeland, and forest productivity may result in reduced income for farmers and agribusiness, increased prices for food and timber, unemployment, reduced tax revenues because of reduced expenditures, increased crime, foreclosures on bank loans to farmers and businesses, migration, and disaster relief programs. Direct or primary impacts are usually biophysical. Conceptually speaking, the more removed the impact from the cause, the more complex the link to the cause. Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-7 In fact, the web of impacts becomes so diffuse that it is very difficult to come up with financial estimates of damages. The impacts of drought can be categorized as economic, environmental, or social. Many economic impacts occur in agriculture and related sectors, including forestry and fisheries, because of the reliance of these sectors on surface and subsurface water supplies. In addition to obvious losses in yields in both crop and livestock production, drought is associated with increases in insect infestations, plant disease, and wind erosion. Droughts also bring increased problems with insects and diseases to forests and reduce growth. The incidence of forest and range fires increases substantially during extended droughts, which in turn places both human and wildlife populations at higher levels of risk. Income loss is another indicator used in assessing the impacts of drought because so many sectors are affected. Reduced income for farmers has a ripple effect. Retailers and others who provide goods and services to farmers face reduced business. This leads to unemployment, increased credit risk for financial institutions, capital shortfalls, and loss of tax revenue for local, state, and federal government. Less discretionary income affects the recreation and tourism industries. Prices for food, energy, and other products increase as supplies are reduced. In some cases, local shortages of certain goods result in the need to import these goods from outside the stricken region. Reduced water supply impairs the navigability of rivers and results in increased transportation costs because products must be transported by rail or truck. Hydropower production may also be curtailed significantly. Environmental losses are the result of damages to plant and animal species, wildlife habitat, and air and water quality; forest and range fires; degradation of landscape quality; loss of biodiversity; and soil erosion. Some of the effects are short-term and conditions quickly return to normal following the end of the drought. Other environmental effects linger for some time or may even become permanent. Wildlife habitat, for example, may be degraded through the loss of wetlands, lakes, and vegetation. However, many species will eventually recover from this temporary aberration. The degradation of landscape quality, including increased soil erosion, may lead to a more permanent loss of biological productivity of the landscape. Although environmental losses are difficult to quantify, growing public awareness and concern for environmental quality has forced public officials to focus greater attention and resources on these effects. Social impacts mainly involve public safety, health, conflicts between water users, reduced quality of life, and inequities in the distribution of impacts and disaster relief. Many of the impacts specified as economic and environmental have social components as well. Population out-migration is a significant problem, often stimulated by greater availability of food and water elsewhere. Migration is usually to urban areas within the stressed area or to regions outside the drought area; migration may even be to adjacent countries, creating refugee problems. However, when the drought has abated, these persons seldom return home, depriving rural areas of valuable human resources necessary for economic development. For the urban area to which they have immigrated, they place ever-increasing pressure on the social infrastructure, possibly leading to greater poverty and social unrest. Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-8 Probability of Drought Probability is the likelihood of a hazard occurring in the future. The graph below shows approximately four droughts between 2000 and 2020 in Los Angeles County. The drought between 2014-2017 was severe. Source: National Weather Service https://droughtmonitor.unl.edu/Data/Timeseries.aspx Below is a table listing the frequency and severity of drought in Los Angeles County. Based on the table, Los Angeles County has experienced three years of Exceptional Drought in the past 20 years. Therefore, the County has the potential to experience an Exceptional Drought once every 6.7 years. Climate change might increase or decrease this probability in the future. Year Drought Condition Year Drought Condition 2001 None 2011 None 2002 Moderate Drought 2012 Moderate Drought 2003 Abnormally Dry 2013 Severe Drought 2004 Abnormally Dry 2014 Exceptional Drought 2005 None 2015 Exceptional Drought 2006 Abnormally Dry 2016 Exceptional Drought 2007 Severe Drought 2017 Abnormally Dry 2008 Moderate Drought 2018 Severe Drought 2009 Severe Drought 2019 Abnormally Dry 2010 None 2020 Abnormally Dry https://droughtmonitor.unl.edu/Maps/MapArchive.aspx Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-9 On the site listed above National Weather Service Forecast Offices were used for the Area Type and Los Angeles, CA (LOX) was used as the Area. The data compared the readings from the first week in December between 2001 and 2020. r Raymond Basin and direct delivery of treated imported water from Metropolitan Water District. The reliability of the water supply for the City is primarily dependent upon the management of the Main San Gabriel Basin and Raymond Basin. The management of both basins is based on their adjudication. The City pumps groundwater from both basins and can rely on the water supply sources of both basins in an average water year, a single-dry water year and during multiple-dry water years. California Drought Legislation The State of California delegates drought planning to local authorities. However, in light of the current drought conditions for the past three (3) years, the California Legislature passed Senate Bill 7x-7 of 2009, and the Governor signed it into law in November 2009. This comprehensive step towards ensuring a reliable water supply for future generations, as well as restoring the Sacramento-San Joaquin Delta and other ecologically sensitive areas. More importantly, the law is directed at water conservation and includes the requirement that the State reduce urban per capita water use by twenty (20) percent by the year 2020. Mitigating drought taking actions in advance of drought to reduce its long-term risk can involve a wide range of tools. These tools include policies, activities, plans, and programs. The California Urban Water Management Planning Act, which became effective on January 1, 1985, requires every Urban Water Supplier to prepare and adopt an Urban Water Management Plan and to periodically review its Management Plan every five (5) years and make any amendments or changes which are indicated by review. The primary objective of the Act is to direct urban water suppliers to evaluate their existing water conservation efforts and, to the extent practicable, to review and implement alternative and supplemental water conservation measures. As such, the City has adopted and implemented the Urban Water Management Plan and continues to update it on a regular basis as required by law. This Management Plan details demand management measures implemented by the City to increase and encourage water conservation in the community. Many demand management measures are in cooperation with the Upper San Gabriel Valley Municipal Water District in In the event of a water shortage or water emergency, the City has also established a Water Conservation Plan (Plan) in the Arcadia Municipal Code: ARTICLE VII. - PUBLIC WORKS, CHAPTER 5. - WATER RATES, SERVICE CHARGES AND REGULATIONS Local Hazard Mitigation Plan 2022 Section 7.6 Drought 7.6-10 PART 5. - REGULATIONS DIVISION 3. - WATER CONSERVATION PLAN The Plan is intended for the conservation of available water supply to minimize the adverse impacts of a drought or water supply emergency conditions. Specifically, the Plan implements water rationing in eight (8) phases, reducing water usage by a certain percentage in each phase. To further mitigate the impacts of drought, the City is also exploring conservation pricing in order to encourage and enhance water conservation efforts. claration, the Arcadia City Council adopted Resolution No. 7009 in February 2014 to implement a voluntary Water Conservation Program to reduce water use by 20 percent. After several months of voluntary conservation Statewide, the target reduction percentage was far from being met. Therefore, in July 2014, the State Water Resources Control Board adopted emergency water conservation regulations consisting of the following elements: water restrictions on outdoor water use for all Californians; a requirement that water suppliers implement their Water Shortage Contingency Plans; and the requirement that water suppliers provide monthly data on water production. In order to comply with the regulations, the Arcadia City Council adopted Resolution No. 7044 on These regulations are still in effect as of the writing of this plan. Community Issues Summary The City of Arcadia has its own water company and draws water from the water table beneath the community. A prolonged drought may impact our ability to obtain water from the aquifer. A prolonged drought would also change the susceptibility of the wildland fuel bed surrounding the north end of Arcadia making it more prone to a wildfire. Local Hazard Mitigation Plan 2022 Section 8 Human Caused Hazards 8 When developing the Local Hazard Mitigation Plan for the City of Arcadia, the committee decided to place the hazards into two broad categories. The categories are Natural Hazards and Human Caused Hazards. Section 8 of the plan covers Human Caused Hazards. The hazards are: Section 8.1 Hazardous Materials Release Section 8.2 Terrorism Event Section 8.3 Train Accident All data tables and maps included in this section were updated during the revision of this plan. Local Hazard Mitigation Plan 2022 Section 8.1 Hazardous Materials Release 8.1-1 Description of Hazard Hazardous waste/materials are widely used at and/or created by facilities such as hospitals, wastewater treatment plants, water treatment plants and industrial manufacturing warehouses. Several household products such as cleaning supplies and paint are also considered hazardous materials. Hazardous materials include: Explosives Flammable, nonflammable, and poisonous gases Flammable liquids Flammable, spontaneously combustible, and dangerous when wet solids Oxidizers and organic peroxides Poisons and infectious substances Radioactive materials Corrosive materials. Both mobile and external hazardous materials releases can spread and affect a wide area, through the release of plumes of chemical, biological, or radiological elements or leaks or spills. Conversely, internal releases are more likely to be confined to the structure the material is stored in. Chemical may be corrosive or otherwise damaging over time. A hazardous materials release could also result in fire or explosion. Contamination may be carried out of the immediate area of the incident by people, vehicles, wind, and water. Weather conditions can increase the size and intensity of the hazardous materials release. Topography such as h hills and canyons can increase the size of the release or make it more difficult to contain. Location and Extent of Hazard in Arcadia Over 160 business owners within Arcadia are required to submit a hazardous materials business plan with the local Certified Unified Program Agencies. In addition to being present at known businesses, hazardous materials are transported within and through Arcadia on a daily basis. History of Hazardous Materials Releases in Arcadia Most releases that have occurred in Arcadia have been minor releases and easily mitigated in compliance with industry standards in accordance with State and Federal regulations. There have been no significant historical events to report to date. Local Hazard Mitigation Plan 2022 Section 8.2 Terrorism Event 8.2-1 Description of Hazard There is no single, universally accepted definition of terrorism, and it can be interpreted in many ways. The term usually refers to intentional, criminal malicious acts. Terrorism is defined in the Code of Federal persons or property to intimidate or coerce a government, the civilian population , or any or the purposes of this plan, terrorism refers to the use of weapons of mass destruction, including biological, chemical, nuclear, and radiological weapons; arson, incendiary, explosive, and armed attacks; and industrial sabotage and intentional hazardous materials releases. Many of these incidents can be well-planned, coordinated attacks with multiple suspects, or the result of a lone individual on a rampage. Location and Extent of Hazard Terrorism can occur throughout the entire city but due to terrori most likely happen in more populous areas where more devastation, hear, and chaos will ensue History of Terrorism Events in Arcadia The city has little-to-no experience of terrorist events. Local Hazard Mitigation Plan 2022 Section 8.3 Train Accident 8.3-1 Definition of Train Accident Train accidents are defined as any accidents involving public or private trains carrying passengers or cargo along the rail corridor. Train accidents, like other transportation accidents, are less likely to lead to a state or federal disaster declaration, than other hazards previously and afore mentioned. Train Accident Related Hazards In September 2015, train service was re-established in the City of Arcadia. The Los Angeles County Metropolitan Transit Authority extended a light rail commuter line through Arcadia connecting communities in the eastern San Gabriel Valley with Downtown Los Angeles. Train accidents are localized, and the incidents result in limited impacts at the community level. However, if the train is in a highly populated death and injuries can occur. With the exception of the light rail line, no other rail lines run through the City of Arcadia. The closest freight line is the Burlington Northern Santa Fe Railway located 4 miles south of Arcadia in the City of El Monte. Train Accident Hazard Assessment There is only one at grade crossing for the light rail train running through the City of Arcadia. A portion of the light rail in Arcadia is located in the center divider of the 210 Freeway. Neighboring communities have had a few events involving big rig trucks that have come off the 210 Freeway and ended up on the train tracks Train accidents can occur anytime during the year. Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-1 The following action items have been placed into three categories based on the Local Hazard Mitigation Plan Committees recommendations. The LHMP Committee considered ease, cost, and importance of completion. The following three categories rank the achievability of each action item; category one action items being the action items to be completed first, and respectively category three being the last. Category One Wildfire A Continue to maintain a separation between flammable vegetation and structures within the Wildland Urban Interface. Implementation Ideas: Continue annual brush safety inspections Adopt new standards on building construction for hardening of structures in the wildland urban interface. Look into funding options for vegetation clearance on public infrastructure in the wildland-urban interface Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Ongoing Constraints: Funding Wildfire B Work with partner agencies to limit the threat of a wind driven wildland fire to the community. Implementation Ideas: Incorporate SCE Public Safety Power Shutoff plans and grid maps into City of Arcadia Base Map. Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Ongoing Constraints: Funding Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-2 Earthquake A Work to ensure minimal interruption in city services in the event of an earthquake Implementation Ideas Integrate Earthquake Early Warning Systems into Fire Station Alerting Integrate Earthquake Early Warning Systems into operation of city water wells and pumping stations Secure equipment within City facilities to protect employees and citizens. Coordinating Organization Public Works Services / Fire Department Funding Source Operating Budget / Mitigation Grants Timeline Ongoing Constraints Funding Earthquake B Adopt and enforce current building safety and seismic regulations Implementation Ideas Adopt and incorporate new versions of Building and Fire Codes Coordinating Organization Fire Department / Development Services Funding Source Operating Budget Timeline During next code update cycle Constraints None Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-3 Multi Hazard A Create and maintain communication mediums through which the City can communicate with the public on both an outgoing and incoming basis. Implementation Ideas: Continue to Update and Enhance methods to communicate with the public. Look into process to be able to provide Wireless Emergency Alerts to the community. Coordinating Organization: City Manager s Office Funding: Office, Fire Department, Police Department, Public Works Services Department Timeline: Ongoing Constraints: Staff time Multi Hazard B Work on lessening the impact a loss of electrical power would have on the community. Implementation Ideas: Update and maintain the back-up power that is available for key city infrastructure in the event of a power disruption to windstorm, wildfire, earthquake, etc. Coordinating Organization: City of Arcadia Public Works Services Funding Source: Public Works Timeline: Within the next three years Constraints: Cost associated with purchasing equipment. Category Two Slope Failure A Improve the capabilities of managing debris from Slope Failure events by developing a debris management strategy for the City of Arcadia. Ideas for implementation: Work with L.A. County Department of Public Works on establishing a regional Debris Management Plan. Coordinating Organization: City of Arcadia Public Works Services. L.A. County Department of Public Works Funding Source: Public Work Agencies Timeline: Within the next three years Constraints: Limited staff time, Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-4 Windstorm A Identify and implement projects to reduce the damage caused by trees during a windstorm. Ideas for Implementation: Continue regular tree trimming procedures: o Continue four-year tree trimming grid for optimum effectiveness to maintain healthy trees. o Ensure trees in the public right-of-way are trimmed to maintain a clearance from all electric power lines as specified in the California Code of Regulations and the California Public Utilities Commission o Continue to remove trees that are dead, diseased, or dying. o Continue the Crown Restoration Program to preserve the health of large aging trees o Ensure proper tree trimming techniques as approved by the Professional Arborist Association o Provide public education materials to residents to make them aware of the need to regularly maintain and trim their own trees o Update Urban Forest Master Plan to include type of trees to plant, when to plan, where easement trees will be placed, and how and when they will be maintained. Coordinating Organization: Public Works Services Department Funding Source: General Fund and Gas Tax Timeline: Ongoing Constraints: Limited staff time and capital resources to fund Tree Trimming Contractors Hazardous Materials A Reduce the threat of a Hazardous Materials Release in Arcadia. Implementation Ideas: Provide information to residents on Local Household Hazardous Materials Collection Events Update known hazardous material storage locations. Coordinating Organization: Fire Department Funding Source: Fire Department Timeline: Annually Constraints: Staff time for updating policies Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-5 Terrorism A Lessen the impact that a terrorist event would have city infrastructure. Implementation Ideas: Strengthen City Facilities and Networks to prevent physical and cyber attacks Coordinating Organization: Police Department Funding Source: General Fund, Police, Fire, and Public Works budgets Timeline: One year Constraints: Limited staff time Terrorism B Lessen the impact that a terrorist event would have on the community. Implementation Ideas: Develop a Stop the Bleed Campaign and provide stop the bleed materials in City Buildings Coordinating Organization: Fire Department Funding Source: General Fund, Grants budgets Timeline: One year Constraints: Limited staff time Transportation A Reduce the frequency of vehicle coming into contact with Metro Gold Line Train while travelling along with 210 Freeway Implementation Ideas: Work with CALTRANS to aid in increasing the height of the barrier wall separating the Gold Line right of way from the 210 Freeway to protect the light rail right of way from vehicles losing control and ending up on the tracks. Coordinating Organization: Development Services Department Funding Source: State of California Timeline: Within next three years Constraints: Lengthy approval process Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-6 Category Three Drought A Identify and implement projects to reduce the impact of drought. Implementation Ideas: Conserve water resources by: o Improving leak detection capability of the Public Works Services Staff o Continuing to provide water audits for indoor/outdoor uses o in the future o Funding Capital Improvement Projects to improve the reliability and o Develop and implement a Tiered Water Rate Pricing Structure Coordinating Organization: Public Works Services Department Funding Source: Water Fund (revenue generated from billing for water service) Timeline: Short Term (within the next five years) Constraints: Limited staff time, resistance from public and lack of public participation. Capability Assessment carry out mitigation efforts. The capabilities are divided into the four categories of Planning and Regulatory, Administrative and Technical, Financial and, Education and Outreach. Planning and Regulatory Plans Yes/No Year Does the plan address hazards? Does the plan identify projects to include in the mitigation strategy? Can the plan be used to implement mitigation actions? City Master Plan (General Plan) Yes 2010 Safety element of plan discusses hazards Capital Improvement Plan Yes 2020 Plan can be used to implement mitigation actions Economic Development Plan Yes 2010 No Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-7 Local Emergency Operations Plan Yes 2013 The EOP address various hazards Continuity of Operations plan No Transportation Plan Yes Does not address hazards Stormwater Management Plan Yes 2015 Yes Community Wildfire Protection Plan No Building Code, Permitting and Inspections Yes/No Year Are Codes Adequately enforced? Building Code Yes 2019 Yes Building Code Effectiveness grading schedule (BCEGS) Score Yes 2019 Score is 2 for residential and commercial Fire Department ISO Rating Yes 2018 Class I rating Land Use Planning and Ordinances Yes/No Year Is the ordinance an effective measure for reducing hazard impacts? Is the ordinance adequately administered and enforced? Zoning Ordinance Yes Yes, yes Subdivision Ordinance Yes Yes, Yes Natural hazard specific ordinance (stormwater, steep slope, wildfire) Yes Yes, yes Floor Insurance Rate Maps No City does not participate in program. How can Planning and Regulatory be expanded? This can be expanded by incorporating the plan into the upcoming General Plan update. Administrative and Technical Administrative Yes/No Describe capability. Is coordination effective? Planning Commission Yes Mitigation Planning Committee Yes Consists of representatives from each city department Maintenance programs to reduce risk (e.g., tree trimming, clearing drainage systems) Yes Arcadia Public Works have plans in place. Mutual aid agreements Yes Fire and Law have automatic and mutual aid agreements in place. Coordination is effective. Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-8 Staff Yes/No FT/PT Is staffing adequate to enforce regulations? Is staff trained on hazards and mitigation? Is coordination between agencies and staff effective? Chief Building Official Yes FT Yes Emergency Manager Yes PT Staff is trained and coordination takes place Community Planner Yes FT Civil Engineer Yes FT GIS Coordintor Yes PT Staff from various departments handle GIS needs for their respective departments Technical Yes/No Describe capability. Has capability been used to assess/mitigate risk in the past? Warning systems/services (Reverse 911, outdoor warning signals) Yes Reverse 911. System has been used to educate, warn and evacuate public. Grant writing Yes City staff has been assigned to apply for grants. City staff can apply for FEMA mitigation grants and other funding to be used for mitigation activities. HAZUS analysis No How can these capabilities be expanded and improved to reduce risk? One method to increase in the above area is to get a dedicated GIS coordinator within the city to make the data easily available to all staff. These GIS capabilities can be used for mitigation planning, grant applications and coordination. Financial Funding Resource Access / Eligibility (Yes/No) Has the funding resource been used in the past and for what type of activities? Could the resource be used to fund future mitigation actions? Capital improvements project funding Yes Funding used for annual maintenance projects, drought mitigation and wildfire response equipment Authority to levy taxes for specific purposes Yes Fees for water, sever, gas or electric services. Yes Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-9 Impact fees for new development No Incur debt through general obligation bonds and/or special tax bonds Yes Obligation bond passed for build grade separation for light rail commuter line. Community Development Block Grant Yes Other federal funding programs Yes SHSGP Recipient How can these capabilities be expanded and improved to reduce risk? One method to use is to pursue additional grant opportunities for mitigation activities. Education and Outreach Program/Organization Yes/No Describe program/organization and how relates to disaster resilience and mitigation. Could the program/organization help implement future mitigation activities? Local citizen group or non-profit organizations focused on environmental protection, emergency preparedness, access and functional needs populations, etc. Yes City partners with American Red Cross for preparedness outreaches Ongoing public education or information program (e.g. responsible water use, fire safety, household preparedness, environmental education) Yes Public education is conducted through social media, city newsletters, safety demonstrations and information tables at city events. Natural disaster or safety related school programs Yes City annually participates in Great Shakeout with community partners Firewise Communities certification No How can these capabilities be expanded and improved to reduce risk? One way to expand and/or improve would be to look into opportunities to educate the public on the hazards present in the community and ways individuals can mitigate those hazards to protect their homes and businesses. Local Hazard Mitigation Plan 2022 Section 9 Action Items 9-10 Local Hazard Mitigation Plan 2022 Section 10 Plan Maintenance Process 10-1 The plan maintenance section of this document details the formal process that will ensure Local Hazards Mitigation Plan remains an active and relevant document. The plan maintenance process includes a schedule for monitoring and evaluating the Plan annually and producing a plan revision every five years. This section describes how the city will integrate public participation throughout the plan maintenance process. Finally, this section includes an explanation of government intends to incorporate the mitigation strategies outlined in this Plan into existing planning mechanisms such as the City General Plan, Capital Improvement Plans, and Building and Safety Codes. Monitoring and Implementing the Plan Plan Adoption The City Manager or designee will be responsible for submitting it to the State Hazard Mitigation Officer at The California Office of Emergency Services (CAL OES). CAL OES will then submit the plan to the Federal Emergency Management Agency (FEMA) for review. This review will address the federal criteria outlined in FEMA Interim Final Rule 44 CFR Part 201. Upon acceptance by FEMA, The City Council will be This governing body has the authority to promote sound public policy regarding local hazards. Coordinating Body The coordinating implementation of Plan action items and undertaking the formal review process. The City Manager will assign representatives to the Hazard Mitigation Committee and assign a Project Manager. Convener Hazard Mitigation Committee will take responsibility for plan implementation. The Project Manager will serve as a convener to facilitate the Hazard Mitigation Committee meetings, and will assign tasks such as updating and presenting the Plan to the members of the committee. Plan implementation and evaluation will be a shared responsibility among all of the Local Hazard Committee Members. Implementation through Existing Programs The City of Arcadia addresses statewide planning goals and legislative requirements through its General Plan, Capital Improvement Plans, City Building and Safety Codes and other city documents. The Local Hazard Mitigation Plan provides a series of recommendations - many of which are closely related to the goals and objectives of existing planning programs. The 2012 Local Hazard Mitigation Plan was referenced in the 2013 update of the City of adopted/referenced into any other City of Arcadia plans since its 2012 adoption. Local Hazard Mitigation Plan 2022 Section 10 Plan Maintenance Process 10-2 During fiscal year 2021 will be updated. At that time staff will work toward adopting the Local Hazard Mitigation Plan into the Safety Element. The goals and action items in the mitigation plan may be achieved through activities recommended in the city's Capital Improvement Plans (CIP). Various city departments develop CIP plans, and review them on an annual basis. Economic Analysis of Mitigation Projects FEMA's approaches to identify the costs and benefits associated with natural hazard mitigation strategies, measures, or projects fall into two general categories: benefit/cost analysis and cost-effectiveness analysis. Conducting benefit/cost analysis for a mitigation activity can assist communities in determining whether a project is worth undertaking now, in order to avoid disaster- related damages later. Cost-effectiveness analysis evaluates how best to spend a given amount of money to achieve a specific goal. Determining the economic feasibility of mitigating natural hazards can provide decision-makers with an understanding of the potential benefits and costs of an activity, as well as a basis upon which to compare alternative projects. Given federal funding, the City of Arcadia will use a FEMA-approved benefit/cost analysis approach to identify and prioritize mitigation action items. For other projects and funding sources, the Hazard Mitigation Advisory Committee will use other approaches to understand the costs and benefits of each action item and develop a prioritized list. For more information regarding economic analysis of mitigation action items, please see Appendix A of the Plan. Evaluating and Updating the Plan Formal Review Process Local Hazards Mitigation Plan will be evaluated on an annual basis to determine the effectiveness of programs, and to reflect changes in land development or programs that may affect mitigation priorities. The evaluation process includes a firm schedule and time line, and identifies the local agencies and organizations participating in plan evaluation. The convener or designee will be responsible for contacting the Hazard Mitigation Advisory Committee members and organizing the annual meeting. The committee will review the goals and action items to determine their relevance to changing situations in the city, as well as changes in State or Federal policy, and to ensure they are addressing current and expected conditions. The committee will also review the risk assessment portion of the Plan to determine if this information should be updated or modified, given any new available data. The coordinating organizations responsible for the various action items will report on the status of their projects, the Local Hazard Mitigation Plan 2022 Section 10 Plan Maintenance Process 10-3 success of various implementation processes, difficulties encountered, success of coordination efforts, and which strategies should be revised. Continued Public Involvement The City of Arcadia is dedicated to involving the public directly in review and updates of the Local Hazard Mitigation Plan. The public will also have the opportunity to provide feedback about the Plan. Copies of the Plan will be catalogued and kept at all of the appropriate agencies in the city. The existence and location of these copies will be publicized in the quarterly city newsletter "Arcadia Community News", which reaches every household in the city In addition, copies of the plan and any proposed changes will be posted on the city website. This site will also contain an email address and phone number to which people can direct their comments and concerns. A public meeting will also be held after each annual evaluation or when deemed necessary by the City Manager. The meetings will provide the public a forum for which they can express its concerns, opinions, or ideas about the Plan. Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-1 Benefit/cost analysis is a key mechanism used by the California Office of Emergency Services, the Federal Emergency Management Agency, and other state and federal agencies in evaluating hazard mitigation projects, and is required by the Robert T. Stafford Disaster Relief and Emergency Assistance Act, Public Law 93-288, as amended. This appendix outlines several approaches for conducting economic analysis of natural hazard mitigation projects. It describes the importance of implementing mitigation activities, different approaches to economic analysis of mitigation strategies, and methods to calculate costs and benefits associated with mitigation strategies. Information in this section is derived in part from: The Interagency Hazards Mitigation Team, State Hazard Mitigation Plan, (Oregon State Police Office of Emergency Management, 2000), and Federal Emergency Management Agency Publication 331, Report on Costs and Benefits of Natural Hazard Mitigation. This section is not intended to provide a comprehensive description of benefit/cost analysis, nor is it intended to provide the details of economic analysis methods that can be used to evaluate local projects. It is intended to one (1) raise benefit/cost analysis as an important issue, and two (2) provide some background on how economic analysis can be used to evaluate mitigation projects. Why Evaluate Mitigation Strategies? Mitigation activities reduce the cost of disasters by minimizing property damage, injuries, and the potential for loss of life, and by reducing emergency response costs, which would otherwise be incurred. Evaluating the Local Hazard Mitigation Plan provides decision-makers with an understanding of the potential benefits and costs of an activity, as well as a basis upon which to compare alternative projects. Evaluating mitigation projects is a complex and difficult undertaking, which is influenced by many variables. First, natural disasters affect all segments of the communities they strike, including individuals, businesses, and public services such as fire, police, utilities, and schools. Second, while some of the direct and indirect costs of disaster damages are measurable, some of the costs are non-financial and difficult to quantify in dollars. Third, many of the impacts of such - social and economic consequences. While not easily accomplished, there is value, from a public policy perspective, in assessing the positive and negative impacts from mitigation activities, and obtaining an instructive benefit/cost comparison. Otherwise, the decision to pursue or not pursue various mitigation options would not be based on an objective understanding of the net benefit or loss associated with these actions. Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-2 What are Some Economic Analysis Approaches for Mitigation Strategies? The approaches used to identify the costs and benefits associated with natural hazard mitigation strategies, measures, or projects fall into two general categories: benefit/cost analysis and cost- effectiveness analysis. The distinction between the two methods is the way in which the relative costs and benefits are measured. Additionally, there are varying approaches to assessing the value of mitigation for public sector and private sector activities. Benefit/Cost Analysis Benefit/cost analysis is used in local hazard mitigation to show if the benefits to life and property protected through mitigation efforts exceed the cost of the mitigation activity. Conducting benefit/cost analysis for a mitigation activity can assist communities in determining whether a project is worth undertaking now, in order to avoid disaster related damages later. Benefit/cost analysis is based on calculating the frequency and severity of a hazard, avoided future damages, and risk. In benefit/cost analysis, all costs and benefits are evaluated in terms of dollars, and a net benefit/cost ratio is computed to determine whether a project should be implemented (i.e., if net benefits exceed net costs, the project is worth pursuing). A project must have a benefit/cost ratio greater than one in order to be pursued. Cost-Effectiveness Analysis Cost-effectiveness analysis evaluates how best to spend a given amount of money to achieve a specific goal. This type of analysis, however, does not necessarily measure costs and benefits in terms of dollars. Determining the economic feasibility of mitigating hazards can also be organized according to the perspective of those with an economic interest in the outcome. Hence, economic analysis approaches are covered for both public and private sectors as follows. Investing in public sector mitigation activities Evaluating mitigation strategies in the public sector is complicated because it involves estimating all of the economic benefits and costs regardless of who realizes them, and potentially to a large number of people and economic entities. Some benefits cannot be evaluated monetarily, but still affect the public in profound ways. Economists have developed methods to evaluate the economic feasibility of public decisions that involve a diverse set of beneficiaries and nonmarket benefits. Investing in private sector mitigation activities Private sector mitigation projects may occur on the basis of one of two approaches: it may be mandated by a regulation or standard, or it may be economically justified on its own merits. A building or landowner, whether a private entity or a public agency, required to conform to a mandated standard may consider the following options: Request cost sharing from public Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-3 agencies; Dispose of the building or land either by sale or demolition; Change the designated use of the building or land and the hazard mitigation compliance requirement; Evaluate the most feasible alternatives and initiate the most cost effective hazard mitigation alternative. The sale of a building or land triggers another set of concerns. For example, real estate disclosure laws can be developed which require sellers of real property to disclose known defects and deficiencies in the property, including earthquake weaknesses and hazards to prospective purchasers. Correcting deficiencies can be expensive and time consuming, but their existence can prevent the sale of the building. Conditions of a sale regarding the deficiencies and the price of the building can be negotiated between a buyer and seller. How can an Economic Analysis be Conducted? Benefit/cost analysis and cost-effectiveness analysis are important tools in evaluating whether or not to implement a mitigation activity. A framework for evaluating alternative mitigation activities is outlined below: 1. Identify the Alternatives: Alternatives for reducing risk from natural hazards can include structural projects to enhance disaster resistance, education and outreach, and acquisition or demolition of exposed properties, among others. Different mitigation project can assist in minimizing risk to hazards, but do so at varying economic costs. 2. Calculate the Costs and Benefits: Choosing economic criteria is essential to systematically calculating costs and benefits of mitigation projects and selecting the most appropriate alternative. Potential economic criteria to evaluate alternatives include: - Determine the project cost: This may include initial project development costs, and repair and operating costs of maintaining projects over time. - Estimate the benefits: Projecting the benefits or cash flow resulting from a project can be difficult. Expected future returns from the mitigation effort depend on the correct specification of the risk and the effectiveness of the project, which may not be well known. Expected future costs depend on the physical durability and potential economic obsolescence of the investment. This is difficult to project. These considerations will also provide guidance in selecting an appropriate salvage value. Future tax structures and rates must be projected. Estimating the costs and benefits of a hazard mitigation strategy can be a complex process. Employing the services of a specialist can assist in this process. Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-4 Financing alternatives must be researched, and they may include retained earnings, bond and stock issues, and commercial loans. - Consider costs and benefits to society and the environment: These are not easily measured, but can be assessed through a variety of economic tools including existence value or contingent value theories. These theories provide quantitative data on the value people attribute to physical or social environments. Even without hard data, however, impacts of structural projects to the physical environment or to society should be considered when implementing mitigation projects. - Determine the correct discount rate: Determination of the discount rate can just be the risk-ime preference and also a risk premium. Inflation should also be considered. 3. Analyze and Rank the Alternatives: Once costs and benefits have been quantified, economic analysis tools can rank the alternatives. Two methods for determining the best alternative given varying costs and benefits include: net present value and internal rate of return. - Net present value: Net present value is the value of the expected future returns dollars. If the net present value is greater than the project costs, the project may be determined feasible for implementation. Selecting the discount rate, and identifying the present and future costs and benefits of the project calculates the net present value of projects. - Internal Rate of Return: Using the internal rate of return method to evaluate mitigation projects provides the interest rate equivalent to the dollar returns expected from the project. Once the rate has been calculated, it can be compared to rates earned by investing in alternative projects. Projects may be feasible to implement when the internal rate of return is greater than the total costs of the project. Once the mitigation projects are ranked on the basis of economic criteria, decision- makers can consider other factors, such as risk; project effectiveness; and economic, environmental, and social returns in choosing the appropriate project for implementation. How are Benefits of Mitigation Calculated? Economic Returns of Local Hazard Mitigation The estimation of economic returns, which accrue to building or land owners as a result of Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-5 natural hazard mitigation, is difficult. Owners evaluating the economic feasibility of mitigation should consider reductions in physical damages and financial losses. A partial list follows: - Building damages avoided - Content damages avoided - Inventory damages avoided - Rental income losses avoided - Relocation and disruption expenses avoided ded These parameters can be estimated using observed prices, costs, and engineering data. The difficult part is to correctly determine the effectiveness of the hazard mitigation project and the resulting reduction in damages and losses. Equally as difficult is assessing the probability that an event will occur. The damages and losses should only include those that will be borne by the owner. The salvage value of the investment can be important in determining economic feasibility. Salvage value becomes more important as the time horizon of the owner declines. This is important because most businesses depreciate assets over a period of time. Additional Costs of Disasters Property owners should also assess changes in a broader set of factors that can change as a result negative, and include changes in the following: - Commodity and resource prices - Availability of resource supplies - Commodity and resource demand changes - Building and land values - Capital availability and interest rates - Availability of labor - Economic structure - Infrastructure - Regional exports and imports - Local, state, and national regulations and policies - Insurance availability and rates Changes in the resources and industries listed above are more difficult to estimate and require models that are structured to estimate total economic impacts. Total economic impacts are the sum of direct and indirect economic impacts. Total economic impact models are usually not combined with economic feasibility models. Many models exist to estimate total economic impacts of changes in an economy. Decision makers should understand the total economic impacts of natural disasters in order to calculate the benefits of a mitigation activity. This suggests that understanding the local economy is an important first step in being able to understand the potential impacts of a disaster, and the benefits of mitigation activities. Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-6 Additional Considerations Conducting an economic analysis for potential mitigation activities can assist decision-makers in choosing the most appropriate strategy for their community to reduce risk and prevent loss from natural hazards. Economic analysis can also save time and resources from being spent on inappropriate or unfeasible projects. Several resources and models are listed on the following page that can assist in conducting an economic analysis for hazard mitigation activities. Benefit/cost analysis is complicated, and the numbers may divert attention from other important issues. It is important to consider the qualitative factors of a project associated with mitigation that cannot be evaluated economically. There are alternative approaches to implementing mitigation projects. Many communities are looking towards developing multi-objective projects. With this in mind, opportunity rises to develop strategies that integrate local hazard mitigation with projects related to watersheds, environmental planning, community economic development, and small business development, among others. Incorporating natural hazard mitigation with other community projects can increase the viability of project implementation. Assessed Values of City of Arcadia The total assessed value for the City of Arcadia is $15,676,471,562. The nine hazards that could impact the City of Arcadia, would affect the city in various ways. Of all the hazards, only two would impact a specific area. Wildfire and Flooding. Four separate impact areas were looked at. One for the wildfire impact area and three separate dam inundation areas. Earthquake, Windstorm, Drought, Terrorism, Transportation, Debris Flow/Landslide, and Hazardous Materials Release hazards have the potential to impact any or all areas of the City of Arcadia so there was no separate study completed for those areas. The chart below indicated the assessed value in the City of Arcadia broken into entire city, residential property, commercial property and other. The chart also displays the assessed valuation in the dam inundation areas and the wildfire hazard area. Area Assessed Valuation Entire City 15,676,471,562 Residential 12,959,501,963 Commercial 1,524,210,934 Other 1,192,758,665 Sawpit Dam Inundation Area 276,166,986 Sierra Madre & Santa Anita Dam Inundation Area 669,813,106 Morris S. Jones Reservoir Inundation Area 271,501,566 Wildland Interface 829,408,125 Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-7 Resources CUREe Kajima Project, Methodologies For Evaluating The Socio-Economic Consequences Of Large Earthquakes, Task 7.2 Economic Impact Analysis, Prepared by University of California, Berkeley Team, Robert A. Olson, VSP Associates, Team Leader; John M. Eidinger, G&E Engineering Systems; Kenneth A. Goettel, Goettel and Associates Inc.; and Gerald L. Horner, Hazard Mitigation Economics Inc., 1997. Federal Emergency Management Agency, Benefit/Cost Analysis of Hazard Mitigation Projects, Riverine Flood, Version 1.05, Hazard Mitigation Economics Inc., 1996. Federal Emergency Management Agency Report on Costs and Benefits of Natural Hazard Mitigation. Publication 331, 1996. Goettel & Horner Inc., Earthquake Risk Analysis Volume III: The Economic Feasibility of Seismic Rehabilitation of Buildings in The City of Portland, Submitted to the Bureau of Buildings, City of Portland, August 30, 1995. Goettel & Horner Inc., Benefit/Cost Analysis of Hazard Mitigation Projects Volume V, Horner, Gerald, Benefit/Cost Methodologies for Use in Evaluating the Cost Effectiveness of Proposed Hazard Mitigation Measures, Robert Olson Associates, Prepared for Oregon State Police, Office of Emergency Management, July 1999. Interagency Hazards Mitigation Team, State Hazard Mitigation Plan, (Oregon State Police Office of Emergency Management, 2000). Risk Management Solutions, Inc., Development of a Standardized Earthquake Loss Estimation Methodology, National Institute of Building Sciences, Volume I and II, 1994. VSP Associates, Inc., A Benefit/Cost Model for the Seismic Rehabilitation of Buildings, Volumes 1 & 2, Federal Emergency Management Agency, FEMA, Publication Numbers 227 and 228, 1991. VSP Associates, Inc., Benefit/Cost Analysis of Hazard Mitigation Projects: Section 404 Hazard Mitigation Program and Section 406 Public Assistance Program, Volume 3: Seismic Hazard Mitigation Projects, 1993. Local Hazard Mitigation Plan 2022 Economic Analysis APPENDIX A Appendix A-8 VSP Associates, Inc., Seismic Rehabilitation of Federal Buildings: A Benefit/Cost Model, Volume 1, Federal Emergency Management Agency, FEMA, Publication Number 255, 1994. Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-1 This list is taken from the Emergency Management Glossary from the California Office of Emergency Services Website. A - B A&W - Alert and Warning AA - Administering Agency AAR - After Action Report AFN - Access & Functional Needs AFO - Area Field Office ANG - Army National Guard AO - Administrative Order AR - Atmospheric River ARB - Air Resources Board ARC - American Red Cross ARP - Accidental Risk Prevention ATC-20 - Applied Technology Council-20 ATC-21 - Applied Technology Council-21 BCP - Budget Change Proposal BOC - Business Operations Center BSA - California Bureau of State Audits C CA-ESF - California Emergency Support Function CAER - Community Awareness & Emergency Response CalARP - California Accidental Release Prevention CalBO - California Building Officials CalEPA - California Environmental Protection Agency CalREP - California Radiological Emergency Plan CalSCIP California Statewide Communications Interoperability Plan CalSIEC California Statewide Interoperability Executive Committee CALSTARS - California State Accounting Reporting System CARES - California Animal Response Emergency System CalTRANS - California Department of Transportation CBO - Community Based Organization CCC - California Conservation Corps CD - Civil Defense CDE - California Department of Education CDF - California Department of Forestry and Fire Protection CDFA - California Department of Forest & Agriculture CDHS California Department of Health Services CDMG - California Division of Mines and Geology CDPH - California Department of Public Health CDSS - California Department of Social Services Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-2 CEC - California Energy Commission CEPEC - California Earthquake Prediction Evaluation Council CESRS - California Emergency Services Radio System CGD - California Geological Survey CHIP - California Hazardous Identification Program CHMIRS - California Hazardous Materials Incident Reporting System CHP - California Highway Patrol CLETS - California Law Enforcement Telecommunications System CMD - California Military Department CMAS California Multiple Award Schedules CNG California National Guard CONOPS - Continuity of Operations COOP - Continuity of Operations Plan CSTI - California Specialized Training Institute CSWC California State Warning Center CTD Communications and Technology Development Division (of OES) CUEA - California Utilities Emergency Association CUPA - Certified Unified Program Agency D DAD - Disaster Assistance Division (of the state Office of Emergency Svcs) DFO - Disaster Field Office DCPP - Diablo Canyon Power Plant DGS - California Department of General Services DGS-PD Dept General Services Procurement Division DGS-TD Dept. General Services Telecommunications Division DHS Federal Department of Homeland Security DHS-RHB - California Department of Health Services, Radiological Health Branch DMORT Disaster Mortality Assistance Team DO - Duty Officer DOC - Department Operations Center DOD - Department of Defense DOE - Department of Energy (U.S.) DOF - California Department of Finance DOJ - California Department of Justice DPA - California Department of Personnel Administration DPH - Department of Public Health DPIG - Disaster Preparedness Improvement Grant DR - Disaster Response DRCC - Disaster Recovery Center DRCC Disaster Resistant California Conference DSA - Division of the State Architect DSR - Damage Survey Report DSS - Department of Social Services DSW - Disaster Service Worker Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-3 DSTC CA Department of Toxic Substance Control DWR - California Department of Water Resources E - H EAS - Emergency Alerting System EDIS - Emergency Digital Information System EDO - Executive Duty Officer EERI - Earthquake Engineering Research Institute EF - Emergency Function EMA - Emergency Management Assistance EMAC Emergency Management Assistance Compact EMAP - Emergency Management Accreditation Program EMI - Emergency Management Institute EMMA - Emergency Managers Mutual Aid EMPG Emergency Management Performance Grant EMS - Emergency Medical Services EO - Executive Order EOC - Emergency Operations Center EOP - Emergency Operations Plan EPA - Environmental Protection Agency (U.S.) EPEDAT - Early Post Earthquake Damage Assessment Tool EPI - Emergency Public Information EPIC - Emergency Public Information Council ESC - Emergency Services Coordinator ESF - Emergency Support Function FAY - Federal Award Year FCO Federal Coordinating Officer FDAA - Federal Disaster Assistance Administration FEAT - FEMA - Federal Emergency Management Agency FFY - Federal Fiscal Year FIR - Final Inspection Reports FIRM - Flood Insurance Rate maps FIRESCOPE - Firefighting Resources of California Organized for Potential Emergencies FMA - Flood Management Assistance FMAG Fire Management Assistance Grant FSA - Federal Staging Area FSR - Feasibility Study Report FY - Fiscal Year GEOEC GIS - Geographical Information System GOAR GO-BIZ - California Governor's Office of Business & Economic Development HAZMAT - Hazardous Materials Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-4 HAZMIT - Hazard Mitigation HAZUS - Hazards-United States (an earthquake damage assessment prediction tool) HCD - Housing and Community Development HEICS - Hospital Emergency Incident Command System HEPG - Hospital Emergency Planning Guidance HIA - Hazard Identification & Analysis Unit HMEP - Hazardous Materials Emergency Preparedness HMGP - Hazard Mitigation Grant Program HSEEP Homeland Security Exercise and Evaluation Program HSGP Homeland Security Grant Program I - O IA - Individual Assistance IAP - Incident Action Plan IDE - Initial Damage Estimate IC - Incident Commander ICE - U.S. Immigration &Customs Enforcement ICP Incident Command Post ICS - Incident Command System IFG - Individual & Family Grant (program) IPA - Information and Public Affairs (of state Office of Emergency Services) IHP - Individuals & Households Program IMAT - Incident Management Assistance Team IND - Improvised Nuclear Device IOF - Initial Operating Facility IRG - Incident Response Geographic Information System IRT Incident Response Team JEOC Joint Emergency Operations Center JFO Joint Field Office JIC Joint Information Center JIS - Joint Information System JRIES Joint Regional Information Exchange System LAC Local Assistance Center LAN - Local Area Network LEMA - Law Enforcement Mutual Aid LEPC - Local Emergency Planning Committee LEVS Law Enforcement and Victims Services Branch (of OES) MAC Group - Multiagency Coordination Group MARAC - Mutual Aid Regional Advisory Council MHID - Multi-hazard Identification MHOAC - Medical Health Operational Area Coordinator MOA - Memorandum of Agreement MOU - Memorandum of Understanding NBC - Nuclear, Biological, Chemical NDRF - National Disaster Recovery Framework Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-5 NEMA - National Emergency Management Agency NEMIS - National Emergency Management Information System NFIP - National Flood Insurance Program NGO - Non-Governmental Organization NIMS - National Incident Management System NIMSCAST - National Incident Management System Compliance Assistance Support Tool NOAA - National Oceanic and Atmospheric Association NPP - Nuclear Power Plant NRF - National Response Framework NSF - National Science Foundation NWS - National Weather Service OA - Operational Area OASIS - Operational Area Satellite Information System OCC - Operations Coordination Center OCD - Office of Civil Defense OCJP Office of Criminal Justice Planning OEP - Office of Emergency Planning OES - OHS Homeland Security OPI Office of Public Information (of OES) ORT - Operational Readiness Team OSHPD - Office of Statewide Health Planning and Development OSPR - Oil Spill Prevention and Response P - R PA - Public Assistance PC - Personal Computer PDA - Preliminary Damage Assessment PFO Principle Federal Official PIO - Public Information Officer POD - Point of Distribution POST - Police Officer Standards and Training PPA/CA - Performance Partnership Agreement/Cooperative Agreement (FEMA) PRA Public Records Act PSA - Public Service Announcement PSC - Public Safety Communications (OES) PSRSPC Public Safety Radio Strategic Planning Committee PSPS - Public Safety Power Shutoff PTAB - Planning and Technological Assistance Branch PTR - Project Time Report PUC - Public Utilities Comission RA - Regional Administrator (OES) RADEF - Radiological Defense (program) RAMP - Regional Assessment of Mitigation Priorities Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-6 RAPID - Railroad Accident Prevention & Immediate Deployment RDD - Radiological Dispersal Device RDMHS - Regional Disaster Medical Health Coordinator RDO - Radiological Defense Officer RDMHC - Regional Disaster Medical Health Coordinator REOC - Regional Emergency Operations Center REPI - Reserve Emergency Public Information RES - Regional Emergency Staff RIMS - Response Information Management System RMP - Risk Management Plan RPU - Radiological Preparedness Unit (OES) RRCC - Regional Response Coordination Center RRT - Regional Response Team RSF - Recovery Support Function RTTAC Regional Terrorism Threat Assessment Center S - W SA - Special Agent SAA State Authorized Agency SAM - State Administrative Manual SAP - Safety Assessment Program SAR - Search & Rescue SARA - Superfund Amendments & Reauthorization Act SAVP - Safety Assessment Volunteer Program SBA - Small Business Administration SCO - SCO State Coordinating Officer SEP - State Emergency Plan SEMS - Standardized Emergency Management System SEPIC - State Emergency Public Information Committee SESC - Senior Emergency Services Coordinator SHSGP State Homeland Security Grant Program SITREP - Situation Report SLA - State and Local Assistance SOC - State Operations Center SONGS - San Onofre Nuclear Generating Station SOP - Standard Operating Procedure SPR - Stakeholder Preparedness Review SSA - Supervisory Special Agent SSA - State Staging Area STAC - State Threat Assessment Center STTAC State Terrorism Threat Assessment Center SWAT - Special Weapons & Tactics SWEPC - Statewide Emergency Planning Committee TA - Technical Assistance Local Hazard Mitigation Plan 2022 Acronyms Appendix B Appendix B-7 T&E Training and Exercise TEC - Travel Expense Claim THIRA - Threat Hazards & Identification Risk Assessment TICP Tactical Interoperable Communications Plan TLO - Terrorism Liaison Officer TRU - Transuranic TTT - Train the Trainer TTX - Tabletop Exercise UASI - Urban Area Security Initiative UC - Unified Command UCG - Unified Coordination Group UOC - Utilities Operations Center UPA - Unified Program Account UPS - Uninterrupted Power Source USA - United States Army USAF - United States Air Force USBP - United States Border Patrol USCG - United States Coast Guard USDOT - United States Department of Transportation USFS - United States Forest Service USGAO - United States Government Accountability Office USMC - United States Marine DCorps USN - United States Navy USAR - Urban Search and Rescue USGS - United States Geological Survey VAL - Volunteer Agency Liasion VOAD - Voluntary Organizations Active in Disasters WAR Week Ahead Report WAN - Wide Area Network WIPP - Waste Isolation Pilot Project WSCA - Western States Contracting Alliance CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX L LOS ANGELES COUNTY ALL-HAZARD MITIGATION PLAN Page 1 of 204 2025 County of Los Angeles All-Hazards Mitigation Plan Chief Executive %SœJN -%SœJN of Emergency Management Page 1 of 204 County of Los Angeles All-Hazards Mitigation Plan Page 1 of 204 Acknowledgement The Los Angeles County Board of Supervisors gratefully acknowledges the following agencies/jurisdictions who contributed to the development of this plan. County Departments Aging and Disabilities UVNSxNJqpVvN%SœJN UVNS1qmpAV_AIV]Vpy%SœJN Beaches and Harbors Economic Opportunity Health Services Human Resources Parks and Recreation Public Health Public Social Services Public Works Regional Planning Fire (LACoFD) Internal Services Sheriff (LASD) Disaster Management Area Coordinators State of California A]VSal_VAavNl_al¯m%SœJNaS^NlTN_Jy1NlvVJNmŸA]%1  California State Council on Developmental Disabilities (SCCD) External Partners Access Services Alzheimer’s Association Catholic Charities City of Beverly Hills City of Long Beach Disability Community Resource Center Eastern Los Angeles Regional Center Emergency Network Los Angeles Habitat for Humanity Harbor Regional Center Lanterman Regional Center !am_TN]Nmaq_py%SœJNaSLqJApVa_ Los Angeles County Sanitation Districts Los Angeles County Metropolitan Transportation Authority Los Angeles Regional Food Bank Neighborhood Legal Services of Los Angeles County Puente Hills Habitat Preservation Authority South Central Los Angeles Regional Center Westside Regional Center Cover Photo Credits: !am_TN]Nmaq_pyUVNSxNJqpVvN%SœJN‘aq_pywVLNa^^q_VJApVa_m lA_JU“ Los Angeles County Department of Public Works County of Los Angeles All-Hazards Mitigation Plan Page 3 of 204 Table of Contents Acknowledgement ................................................................................................................. 1 Letter of Promulgation ........................................................................................................... 2 1 _plaLqJpVa_‘-qliamN‘A_L1JaiN ................................................................................ 6 1.1 Purpose ...................................................................................................................... 7 1.2 Scope ......................................................................................................................... 7 1.3 Legal Authority and Requirements ......................................................................... 7 1.4 Plan Organization ..................................................................................................... 8 2 Planning Process ............................................................................................................. 9 2.1 Overview of the Planning Process ........................................................................ 10 2.2 Stakeholder Engagement ...................................................................................... 13 2.3 Public Involvement and Outreach ........................................................................ 18 2.4 Review and Incorporation of Existing Plans and Reports .................................. 19 3 a^^q_Vpy-laœ]N ........................................................................................................ 22 3.1 Los Angeles County Overview .............................................................................. 23 3.2 Geography and Land Use ..................................................................................... 24 3.3 Social Vulnerability ................................................................................................. 25 3.4 Economy and Critical Infrastructure ..................................................................... 28 3.5 Climate and Environmental Conditions ............................................................... 29 3.6 Regional Collaboration and Planning Efforts ...................................................... 30 3.7 Implications for Hazard Mitigation Planning ....................................................... 31 4 Climate Change ............................................................................................................ 32 4.1 Climate Change Overview .................................................................................... 33 4.2 _pNTlApV_T]V^ApNUA_TNV_paA|AlL-laœ]Nm ............................................... 34 4.3 Climate Mitigation Strategies ................................................................................ 36 4.4 Climate Change Conclusion ................................................................................. 37 County of Los Angeles All-Hazards Mitigation Plan Page 4 of 204 5 Integrating Access and Functional Needs (AFN) into Hazard Mitigation .............. 38 5.1 AFN Introduction .................................................................................................... 39 5.2 Inclusion of AFN and Vulnerable Populations in Planning ................................ 39 5.3 Assessment of AFN Needs .................................................................................... 40 5.4 Coordination with AFN Support Agencies .......................................................... 42 5.5 AFN Conclusion ...................................................................................................... 42 6 A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p ............................................................... 43 6.1 A|AlLLN_pVœJApVa_%vNlvVNw ............................................................................. 44 6.2 :V]LœlN ..................................................................................................................... 49 6.3 Earthquake .............................................................................................................. 57 6.4 Extreme Heat ........................................................................................................... 67 6.5 Drought .................................................................................................................... 74 6.6 Flooding .................................................................................................................. 82 6.7 Dam Failure ............................................................................................................. 92 6.8 Land Movement .................................................................................................... 102 6.9 Tsunami .................................................................................................................. 114 6.10 Severe Wind and Tornado ............................................................................... 120 6.11 Mass Violence .................................................................................................... 130 6.12 Cybersecurity Incidents .................................................................................... 135 6.13 Transportation Incidents ................................................................................... 142 6.14 Public Health Emergencies .............................................................................. 147 7 Mitigation Strategy ...................................................................................................... 152 7.1 Mitigation Strategy Overview .............................................................................. 153 7.2 Mitigation Goals and Objectives ........................................................................ 153 7.3 Existing Mitigation Capabilities .......................................................................... 155 7.4 LN_pVœJApVa_A_L_A]ymVmaS"VpVTApVa_1plApNTVNm ......................................... 172 County of Los Angeles All-Hazards Mitigation Plan Page 5 of 204 7.5 Status of Previous Mitigation Efforts ................................................................... 184 7.6 Prioritization and Implementation of Mitigation Actions ................................. 186 7.7 Integration with Other Plans ............................................................................... 189 7.8 Mitigation Action Plan .......................................................................................... 191 8 Plan Maintenance ........................................................................................................ 196 8.1 Community Participation in Plan Maintenance ................................................. 197 8.2 "a_VpalV_T‘vA]qApVa_‘A_L"AV_pN_A_JN......................................................... 198 8.3 Criteria for Updating the Hazard Mitigation Plan ............................................. 199 8.4 Plan Update ........................................................................................................... 200 8.5 Integration with Other Plans ............................................................................... 201 9 Plan Adoption .............................................................................................................. 202 9.1 Plan Adoption Overview ...................................................................................... 203 Appendices ......................................................................................................................... 204 County of Los Angeles All-Hazards Mitigation Plan Page 6 of 204 1 _plaLqJpVa_‘-qliamN‘ and Scope County of Los Angeles All-Hazards Mitigation Plan Page 7 of 204 1.1 Purpose The 2025 All-Hazard Mitigation Plan (AHMP) was developed in collaboration with a wide range of stakeholders representing County Departments and other external mpA\NUa]LNlmSla^JVpVNm‘]aJA]qpV]VpVNm‘_a_-TavNl_^N_pA] alTA_V|ApVa_m‘ A_L mpApN agencies. The purpose of this AHMP is to form the strategic-level foundation for hazard mitigation efforts undertaken by the County of Los Angeles. The 2025 AHMP is an update to the 2020 version of the plan and seeks to maintain the County’s continuing commitment to hA|AlL^VpVTApVa_AmAJlVpVJA]mpNiV_lNLqJV_TUA|AlLlVm\m‘^A\V_T Ja^^q_VpVNmmASNl‘A_LIqV]LV_TJaq_pywVLNlNmV]VN_JN 1.2 Scope A|AlL^VpVTApVa_VmLNœ_NLV_pUNaLNaSNLNlA]0NTq]ApVa_mŸ0 Am¬A_ymqmpAV_NL action taken to reduce or eliminate the long-term risk to human life and property from UA|AlLm­3UVm"-VLN_pVœNmA_Lilaœ]NmUA|AlLm‘A_A]y|NmpUNiNai]NA_LJlVtical V_SlAmplqJpqlNAplVm\‘A_LilavVLNmAmNlVNmaS^VpVTApVa_mplApNTVNmAV^NLAplNLqJV_T hazard risk. The plan also describes actions to integrate vulnerable communities including people with Access and Functional Needs (AFN) into hazard mitigation planning and other efforts. The AHMP is intended to function as a strategic plan for UA|AlL^VpVTApVa_A_L‘wUV]N_apA_N^NlTN_Jyi]A_‘Ja^i]N^N_pmpUN!am_TN]Nm County Operational Area Emergency Operations Plan. This plan contains mitigation strategies for County-owned facilities or other areas under the jurisdiction of the County of Los Angeles. Hazard mitigation strategies for incorporated cities within Los Angeles County may be found in that city’s hazard mitigation plan. 1.3 Legal Authority and Requirements Historically local hazard mitigation planning has been driven by federal law. The Disaster Mitigation Act (DMA) of 2000 amended the Robert T. Stafford Disaster Relief and Emergency Assistance Act of 1988 with new requirements for hazard mitigation. The DMA aS‚€€€N^iUAmV|NLpUN_NNLSalmpApN‘plVIA]‘A_L]aJA]N_pVpVNmpaJ]amN]y coordinate on hazard mitigation efforts and formed the legal basis for the Federal Emergency Management Agency’s (FEMA) current mitigation plan requirements in order to utilize Hazard Mitigation Assistance grant programs. This plan was prepared County of Los Angeles All-Hazards Mitigation Plan Page 8 of 204 pursuant to the requirements set forth in the DMA of 2000 and other FEMA hazard mitigation policy guidance. 1.4 Plan Organization The AHMP is organized into nine (9) mNJpVa_m‘NxJ]qLV_TpUNiiN_LVJNm‘ including: 1.Introduction: VmJqmmNmpUNiqliamN‘mJaiN‘A_L]NTA]AqpUalVpyaSpUNi]A_ 2.Planning Process: Describes the planning process that was undertaken by the Hazard Mitigation Planning Committee to create this updated 2025 AHMP. 3.a^^q_Vpy-laœ]N’ %vNlvVNwmpUNq_VkqNTNaTlAiUVJ‘J]V^ApVJ‘N_vVla_^N_pA]‘ and socioeconomic factors that make up Los Angeles County and their implications for hazard mitigation planning. 4.Climate Change: Outlines the impacts of climate change in Los Angeles County and potential mitigation and adaptation measures. 5.Integrating AFN into Hazard Mitigation: Discusses strategies for integrating people with Access and Functional Needs (AFN) into prevention and hazard mitigation efforts. 6.A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p’ LN_pVœNmA_Lilaœ]Nmnine (9) natural and four (4) human-caused hazards that may impact Los Angeles County including: wV]LœlN‘NAlpUkqA\N‘NxplN^NUNAp‘LlaqTUp‘ŔaaLV_T‘LA^SAV]qlN‘ ]A_L^avN^N_p‘pmq_A^V‘mNvNlNwV_LA_Lpal_ALa‘^AmmvVa]N_JN‘JyINlmNJqlVpy V_JVLN_pm‘plA_mialpApVa_V_JVLN_pm‘A_LiqI]VJUNA]pUN^NlTN_JVNm 7.Mitigation Strategy: Delineates the overall strategy for the County’s hazard ^VpVTApVa_NSSalpmV_J]qLV_TTaA]mA_LaI[NJpVvNm‘NxVmpV_T^VpVTApVa_JAiAIV]VpVNm‘ and an analysis of mitigation actions. 8.Plan Maintenance: Outlines how the plan will be maintained annually ahead of pUN_NxpSq]]i]A_qiLApNV_œvNyNAlm 9.Plan Adoption: Discusses updates to the plan and implementation following plan adoption. a]]awV_TpUNmNmNJpVa_m‘pUNlNAlNA_ALLVpVa_A]six (6) appendices with supporting ^ApNlVA]mmqJUAmUA|AlL^Aim‘^NNpV_T^V_qpNmSla^i]A__V_T^NNpV_Tm‘ A_L information about the public engagement efforts during the planning process. County of Los Angeles All-Hazards Mitigation Plan Page 9 of 204 2 Planning Process County of Los Angeles All-Hazards Mitigation Plan Page 10 of 204 2.1 Overview of the Planning Process The 2025 Los Angeles County All-Hazard Mitigation Plan (AHMP) update builds upon the robust all-hazard planning framework established by the 2020 All-Hazards "VpVTApVa_-]A_‘wUV]NV_JalialApV_T_Nw^NpUaLa]aTVNm‘mpA\NUa]LNlN_TATN^N_p‘ and compliance requirements. The planning process for this update emphasized V_J]qmVvVpy‘ plA_miAlN_Jy‘ A_L pUN V_pNTlApVa_ aS N^NlTV_T J]V^ApN ALAipApVa_ considerations. 3UVmi]A__V_TilaJNmmSa]]awNLAmplqJpqlNL‘iUAmNLAiilaAJUA]VT_NLwVpU"¯m !aJA]"VpVTApVa_-]A__V_T-a]VJyqVLNŸ‚€‚‚ ‘„„0lNkqVlN^N_pm‘A_LTqVLA_JN Sla^pUNA]VSal_VAavNl_al¯m%SœJNaS^NlTN_Jy1NlvVJNmŸA]%1 3UVmAiilaAJU began witUila[NJpV_VpVApVa_wUNlNpUNmJaiN‘pV^N]V_N‘A_LmpA\NUa]LNlmwNlNLNœ_NL Stakeholder and public engagement were prioritized to ensure representation from LVvNlmN Tlaqim‘ V_J]qLV_T UVmpalVJA]]y q_LNllNilNmN_pNL Ja^^q_VpVNmA_LJ]V^ApN- vulnerable populations. Data Ja]]NJpVa_A_LA_A]ymVm]NvNlATNLqiLApNLUA|AlL‘J]V^ApN‘A_Lvq]_NlAIV]VpyLApA Sla^]aJA]‘mpApN‘A_LSNLNlA]maqlJNm‘ilavVLV_TASaq_LApVa_SalN_UA_JNLlVm\A_L vq]_NlAIV]VpyAmmNmm^N_pmA|AlLilaœ]NmwNlNqiLApNLpaV_J]qLNJ]V^ApNila[NJpVa_m and cascading impact scenarios. Mitigation strategies were revised and prioritized with a renewed focus on climate resilience and nature-based solutions. Strategies were also developed incorporating people with access and functional needs throughout each comia_N_paSpUN"-V_A]]y‘^NpUaLmSal^a_VpalV_TA_LNvA]qApVa_aS^VpVTApVa_ NSSalpmwNlNLNœ_NLV_pUNi]A_^AV_pN_A_JNA_LV^i]N^N_pApVa_mplApNTy3AI]N‚-1 provides a timeline of the major plan update tasks and milestones over the planning process. Table 2-1 AMHP Planning Timeline Date 3Am\m Peo ple Involved February 2025 0NvVNwNLpUN‚€‚€"-A_LVLN_pVœNL components that require update. OEM AHMP Project Team Collected and reviewed existing LaJq^N_pm‘V_J]qLV_TpUN3UlNApA_L A|AlLLN_pVœJApVa_A_L0Vm\ Assessment (THIRA) along with resources for people with access and functional OEM AHMP Project Team County of Los Angeles All-Hazards Mitigation Plan Page 11 of 204 Date 3Am\m People Involved needs and people experiencing homelessness. February 2025 Met with state Hazard Mitigation Planning Team. OEM AHMP Project 3NA^‘A]%1 Mitigation Division LN_pVœNLpUNV_VpVA]]VmpaSmpA\NUa]LNlm and ensured organizations that work with and represent people with access and functional needs were engaged in the planning process. External stakeholders V_J]qLN_NVTUIalV_TJa^^q_VpVNm‘]aJA] A_LlNTVa_A]ATN_JVNm‘A_LapUNlm OEM AHMP Project Team Conducted 2025 AHMP Kickoff Meetings with internal stakeholders. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘A] OES Mitigation Division NpNl^V_NLUA|AlLmpaINilaœ]NL V_J]qLV_TIapU_ApqlA]ŸVN‘wV]L]A_LœlN‘ NAlpUkqA\N‘NpJ A_LUq^A_-JAqmNLŸVN‘ JyINlmNJqlVpy‘pNllalVm^‘NpJ  OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder Group Drafted initial sections of the 2025 AHMP. OEM AHMP Project Team Shared drafts of initial sections with internal and external stakeholders for their review. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division Met with internal and external stakeholders to obtain feedback on draft plan elements. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division County of Los Angeles All-Hazards Mitigation Plan Page 12 of 204 Date 3Am\m Peo ple Involved March 2025 Developed the Public Outreach Engagement Plan to collect feedback from the public on the public draft of the 2025 AHMP. OEM AHMP Project 3NA^‘A]%1 Mitigation Division Drafted subsequent sections of the 2025 AHMP including updating existing mitigation actions and developing new mitigation actions as needed. OEM AHMP Project Team Shared drafts of the subsequent sections with internal and external stakeholders for their review. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division Met with internal and external stakeholders to obtain feedback on subsequent draft plan elements. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division April/May 2025 lASpNLœ_A]mNJpVa_maSpUN‚€‚…"- and produced a Final Draft AHMP. OEM AHMP Project Team Shared Final Draft of the AHMP with internal and external stakeholders for their review. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division Met with internal and external stakeholders to obtain feedback on subsequent Final Draft AHMP. OEM AHMP Project 3NA^‘_pNl_A]aq_py 1pA\NUa]LNllaqi‘ External Stakeholder laqi‘A]%1 Mitigation Division Produced Final AHMP. OEM AHMP Project Team County of Los Angeles All-Hazards Mitigation Plan Page 13 of 204 2.2 Stakeholder Engagement Inclusive stakeholder involvement was essential to the planning process. The County N_mqlNL IlaAL lNilNmN_pApVa_ A_L iAlpVJViApVa_‘ Ja_mVmpN_p wVpUpUN´:Ua]N a^^q_VpyiilaAJU´aqp]V_NLV_pUN‚€‚ƒ%iNlApVa_A]lNA^NlTN_Jy%iNlApVa_m Plan (OAEOP). Key stakeholders that comprised the Hazard Mitigation Advisory Committee included: •aq_pyLNiAlp^N_pmmqJUAm‘Iqp_ap]V^VpNLpa‘-qI]VJ:al\m‘-qI]VJNA]pU‘A_L Regional Planning. • Cities within the operational area (OA) and neighboring communities through Disaster Management Area Coordinators (DMACs) and city representation. •Non-TavNl_^N_pA] alTA_V|ApVa_m Ÿ#%m ‘ V_J]qLV_T N_vVla_^N_pA] A_L disability advocacy groups. • Special District partners managing critical infrastructure. • Representatives of academia and school districts. • Community representatives from Access and Functional Needs (AFN) populations and historically underrepresented populations. 0NTq]Al^NNpV_Tm‘wal\mUaim‘A_LSaJqmTlaqimwNlNUN]LpaTApUNlV_iqpA_LlNœ_N mitigation strategies. Stakeholders were contacted and invited to participate in the 2025 AHMP planning process through email (please see email template in Appendix B-3). Stakeholder SNNLIAJ\wAmLaJq^N_pNLA_LV_JalialApNLV_papUNi]A_‘N_mqlV_T diverse perspectives informed the process. Tables 2-2 and 2-3 includes a list of representatives of each agency that contributed to the planning process. Table 2-2 Hazard Mitigation Advisory Committee – _pNl_A]1pA\NUa]LNllaqi Department/ Agency Name Title Planning Contribution Los Angeles County %SœJNaS Emergency Management (OEM AHMP Project Team) Michael Morin Emergency Management Coordinator q_JpVa_NLAm]NALi]A__Nlm‘ ]NLi]A__V_T^NNpV_Tm‘ LlASpNLi]A_‘lNvVNwNL mitigation actions submitted by departments. Matthew Topoozian Emergency Management Coordinator County of Los Angeles All-Hazards Mitigation Plan Page 14 of 204 Department/ Agency Name Title Planning Contribution Karen Haro Emergency Management Coordinator Girma Wollela Emergency Management Coordinator Los Angeles County Department of Aging and Disabilities Mike Tsao Administrative Deputy ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Henry Lopez Program Manager Carin Anderson Administrative Services Manager Keilah Kelso Administrative Services Manager Los Angeles County Chief Executive %SœJN– Anti- 0AJVm^‘VvNlmVpy‘ and Inclusion Initiative Cesar Sanchez Senior Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Chief Executive %SœJN– Homeless Initiative Onnie Williams III Principal Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Chief Sustainability %SœJN Matthew Gosner Climate Resilience %SœJNl ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. County of Los Angeles All-Hazards Mitigation Plan Page 15 of 204 Department/ Agency Name Title Planning Contribution Los Angeles County Department of Beaches and Harbors Katharine de la Cruz Administrative Services Manager Attended planning ^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Vanessa Huerta 1ASNpy%SœJNl Los Angeles County Department of Economic Opportunity Maritza Dubie Human Services Administrator ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Department of Health Services Elaine Forsyth Senior Nursing Instructor ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Isabel Sanchez Disaster Services Specialist Los Angeles County Department of Human Resources Kevin Halbritter Deputy Compliance %SœJNl ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Department of Parks and Recreation Ramon Bernal Disaster Services Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Department of Public Health Elizabeth Rubin Epidemiologist ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Department of Public Social Services Manuel Gutierrez Disaster Services Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. County of Los Angeles All-Hazards Mitigation Plan Page 16 of 204 Department/ Agency Name Title Planning Contribution Los Angeles County Department of Public Works Joseph Marble Disaster Services Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Loni Eazell Disaster Services Specialist Los Angeles County Department of Regional Planning Thuy Hua Supervising Planner ppN_LNLi]A__V_T^NNpV_Tm‘ reviewed section LlASpm‘A_L provided feedback. Edgar De La Torre Principal Regional Planner Los Angeles County Fire Department Nick Duvally Deputy Fire Chief ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Internal Services Department Juan-Raul Cardenas GIS Analyst ppN_LNLi]A__V_T^NNpV_Tm‘ lNvVNwNLmNJpVa_LlASpm‘A_L provided feedback. Los Angeles County Sheriff’s Department Jordan Kennedy Sergeant ppN_LNLi]A__V_T^NNpV_Tm‘ reviewed section LlASpm‘A_L provided feedback. Table 2-3 Hazard Mitigation Advisory Committee – External 1pA\NUa]LNllaqi Department/Agency Planning Contribution Access Services ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Alzheimer’s Association California ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ A]VSal_VAavNl_al¯m%SœJNof Emergency Services ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Catholic Charities ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ County of Los Angeles All-Hazards Mitigation Plan Page 17 of 204 Department/Agency Planning Contribution City of Beverly Hills Emergency Management Division ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ City of Long Beach Disaster Preparedness & Emergency Communications ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ City of Los Angeles Emergency Management Department ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disability Community Resource Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Disaster Management Area aalLV_Apal‘lNA Attended i]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Eastern Los Angeles Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Emergency Network Los Angeles ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLsection LlASpm‘A_LilavVLNLSNNLIAJ\ Habitat for Humanity ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ County of Los Angeles All-Hazards Mitigation Plan Page 18 of 204 Department/Agency Planning Contribution Harbor Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Lanterman Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ !am_TN]Nmaq_py%SœJNaSEducation ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Los Angeles County Sanitation Districts ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Los Angeles Metropolitan Transportation Authority ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Los Angeles Regional Food Bank ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Neighborhood Legal Services of Los Angeles County ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Puente Hills Habitat Preservation Authority ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ South Central Los Angeles Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_LilavVLNLSNNLIAJ\ Westside Regional Center ppN_LNLi]A__V_T^NNpV_Tm‘lNvVNwNLmNJpVa_LlASpm‘A_Lprovided feedback. 2.3 Public Involvement and Outreach -qI]VJaqplNAJUNSSalpmAV^NLpaSampNlplA_miAlN_Jy‘V_J]qmVvVpy‘A_LSalpVSyiqI]VJplqmp The County engaged the public during the planning process through multiple media formats to share information and collect feedback taking into account language and other access and functional needs. A rolling outreach strategy was used to ensure that AmNAJUmNJpVa_wAmLlASpNLA_LlNvVNwNLIyi]A__V_TmpA\NUa]LNlm‘VpwAmJa_JqllN_p]y ^ALNAvAV]AI]NSaliqI]VJJa^^N_pAly3aAJJa^i]VmUpUVm‘NAJUmNJpVa_wAmiampNL to the Los Angeles County Hazard Mitigation Program website as it was completed by the planning team. A survey designed to gauge community perceptions of hazard risks and mitigation priorities was used on the website (Appendix D). This approach ensured that the public was a key partner in every step of the planning process and had a voice as County of Los Angeles All-Hazards Mitigation Plan Page 19 of 204 each section was being developed by the planning team. A social media campaign using all LA County OEM social media channels was initiated to direct the public to the survey. 3a ALLlNmm NkqVpy‘ pAlTNpNL aqplNAJU NSSalpm SaJqmNL a_ N_TATV_T UVmpalVJA]]y q_LNllNilNmN_pNL Ja^^q_VpVNm A_L # iaiq]ApVa_m‘ qmV_T ^q]pV]V_TqA] A_L AJJNmmVI]N^ApNlVA]mA_LJq]pqlA]]yAiilailVApNpNJU_VkqNmmVLNSla^iqI]VJaqplNAJU‘ stakeholders that wal\wVpUallNilNmN_piNai]NwVpUAJJNmmA_LSq_JpVa_A]_NNLm‘ iNai]N NxiNlVN_JV_T Ua^N]Nmm_Nmm‘ A_L A LVvNlmN AllAy aS Jq]pqlA] Tlaqim wNlN targeted to participate in the Hazard Mitigation Advisory Committee. These measures ensured that the public had meaningful opportunities to participate in shaping the plan. 2.4 Review and Incorporation of Existing Plans and Reports The planning process included a comprehensive review of existing documents and protocols to ensure consistency and alignment. The 2020 All-Hazards Mitigation Plan mNlvNLAmpUNSaq_LApVa_A]LaJq^N_pSalpUVmqiLApNLLVpVa_A]]y‘\NyJa_JNipmSla^ the 2023 Operational Area Emergency Operations Plan (OA%- ‘mqJUAm^NlTN_Jy 1qiialpq_JpVa_mŸ1m A_LLVmAmpNl^A_ATN^N_pAlNAm‘wNlNV_pNTlApNL3UN!am Angeles County Climate Vulnerability Assessment provided valuable insights into J]V^ApNlVm\mA_LmaJVA]mN_mVpVvVpy‘wUV]N]aJA]]V^ApNJpVa_-]A_mN_mqlNLA]VT_^N_p with mq_VJViA]J]V^ApNALAipApVa_V_VpVApVvNmqlpUNl^alN‘pUN‚€‚4130Ÿ3UlNAp A_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p ilavVLNLJlVpVJA]LApASalVLN_pVSyV_T Nva]vV_TpUlNApmA_LJAiAIV]VpypAlTNpm‘N_UA_JV_TpUNAJJqlAJyA_LlN]NvA_JNaSpUN plan. The demographic data from the 2020 U.S. Census was utilized to ensure an AJJqlApNlNilNmN_pApVa_aS!am_TN]Nmaq_pyµmiaiq]ApVa_‘_awNmpV^ApNLApavNl€ ^V]]Va_lNmVLN_pm3UNLN^aTlAiUVJIlNA\Law_V_J]qLNm„ˆÈVmiA_VJal!ApV_a‘‚†È :UVpN‘ …ÈmVA_‘ ˆÈSlVJA_^NlVJA_‘ A_L ƒÈ apUNl‘ wVpU avNl„€È miNA\V_T A ]A_TqATN apUNl pUA_ _T]VmU Ap Ua^N‘ N^iUAmV|V_T pUN _NNL Sal ^q]pV]V_TqA] A_L culturally appropriate outreach. County of Los Angeles All-Hazards Mitigation Plan Page 20 of 204 Table 2-4 xVmpV_T-]A_m‘"Aim‘A_L0Nialpm -]A_‘"Ai‘al0Nialp Information to be Incorporated into the 2025 Updated AHMP Los Angeles County Operational Area Emergency Operations Plan (2023) Used to inform Section 6’A|AlLLN_pVœJApVa_A_LRisk Assessment and Section 7: Mitigation Strategy Los Angeles County 2035 General Plan (2024) Safety element mitigation policies used to inform Section 7 – Mitigation Strategy Los Angeles County Comprehensive Floodplain Management Plan (2021) Used to inform Section 6’A|AlLLN_pVœJApVa_A_LRisk Assessment and Section 7: Mitigation Strategy SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm County of Los Angeles Floodplain Management Plan Progress Report from (2024) Used to inform Section 6’A|AlLLN_pVœJApVa_A_LRisk Assessment and Section 7: Mitigation Strategy SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm County of Los Angeles Repetitive Loss Area Analysis Progress Report (2021) Used to inform Section 6’A|AlLLN_pVœJApVa_A_LRisk Assessment and Section 7: Mitigation Strategy SalN]N^N_pmlN]ApNLpaŔaaLUA|AlLm Los Angeles County 2045 Climate Action Plan (2024) Used to inform Section 6’A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p‘1NJpVa_7’"VpVTApVa_1plApNTy‘A_LSection 4: Climate Change for elements related to hazard risk posed by climate change Los Angeles County Fire Department Fire Plan (2023) Used to inform Section 6’A|AlLLN_pVœJApVa_A_LRisk Assessment and Section 7: Mitigation Strategy SalN]N^N_pmlN]ApNLpawV]L]A_LœlNUA|AlLm Our County: Los Angeles Countywide Sustainability Plan (2019) Used to inform Section 6’A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p‘1NJpVa_7’"VpVTApVa_1plApNTy‘A_LSection 4: Climate Change for elements related to hazard risk posed by climate change Los Angeles County Homeless Initiative Strategy Plan (2022) Used to inform vulnerable populations information across all sections of the plan. Disability Among Adults in Los Angeles County (2019) Used to inform vulnerable populations information across all sections of the plan. Southern California Earthquake Data Center’s Earthquake Catalogs (Current as of 2025) Historical seismic information used in Section 6: A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p County of Los Angeles All-Hazards Mitigation Plan Page 21 of 204 -]A_‘"Ai‘al0Nialp Information to be Incorporated into the 2025 Updated AHMP Maritime Tsunami Response Playbooks: Background Information and Guidance for Response and Hazard Mitigation Use (2016) Historical tsunami information used in Section 6: A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p FEMA Flood Insurance 1pqLy‘!am_TN]Nmaq_py‘A]VSal_VAŸ‚€‚€  VmpalVJA]ŔaaLV_Sal^ApVa_qmNLV_1NJpVa_6: A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p U.S. Geological Survey (USGS): Rainfall and Landslides in Southern California (2015) Historical landslide information used in Section 6: A|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p Burn Scar Information and Maps VmpalVJA]œlNV_Sal^ApVa_qmNLV_1NJpVa_6: Hazard LN_pVœJApVa_A_L0Vm\mmNmm^N_p County of Los Angeles All-Hazards Mitigation Plan Page 22 of 204 3 Community -laœ]N County of Los Angeles All-Hazards Mitigation Plan Page 23 of 204 3.1 Los Angeles County Overview Los Angeles County is the most populous county in pUN 4_VpNL 1pApNm‘ encompassing a diverse AllAy aS Ja^^q_VpVNm‘ ]A_LmJAiNm‘ A_L infrastructure. According to the most recent census LApA‘ !am _TN]Nm aq_py has a population of approximately 10 million residents of which more than 1 million reside in unincorporated areas. The County’s LN^aTlAiUVJm‘ TNaTlAiUVJ SNApqlNm‘ A_L NJa_a^VJ AJpVvVpVNm ilNmN_p IapU q_VkqN aiialpq_VpVNmA_LmVT_VœJA_pJUA]]N_TNmSalUA|AlL^VpVTApVa_i]A__V_T3UVmqiLApNL communipy ilaœ]N V_pNTlApNm V_mVTUpm Sla^ pUN ‚€‚ƒ %iNlApVa_al Area Emergency Operations Plan (OA%- A_LlNŔNJpmJUA_TNmV_iaiq]ApVa_plN_Lm‘V_SlAmplqJpqlN LNvN]ai^N_p‘A_LJ]V^ApNlVm\m The County Operational Area (OA) consists of all political subdivisions within the TNaTlAiUVJA]Iaq_LAlVNmaS!am_TN]Nmaq_pypN_Ja^iAmmNmœvNmqiNlvVmalVA] LVmplVJpm‘NVTUpVmAmpNl"A_ATN^N_plNAmŸ"m ‘ˆˆV_JalialApNLJVpVNm‘ˆ€mJUaa] districpm‘A_LAiilaxV^ApN]y„‚miNJVA]LVmplVJpm County of Los Angeles All-Hazards Mitigation Plan Page 24 of 204 3.2 Geography and Land Use 1iA__V_TavNl„‘€€€mkqAlN ^V]Nm‘ !am _TN]Nm aq_py SNApqlNm LVvNlmN pNllAV_‘ including coastal plains‘ vA]]Nym‘ ^aq_pAV_m‘ Vm]A_Lm‘ and deserts. The County’s varied geography includes multiple microclimates that V_ŔqN_JNVpmNxiamqlNpa _ApqlA] UA|AlLm‘ mqJU Am NAlpUkqA\Nm‘pmq_A^Vm‘wV]LœlNm‘ŔaaLm‘A_L]A_Lm]VLNm4lIA_AlNAm‘iAlpVJq]Al]ypUN VpyaS!am_TN]NmA_LVpmmqllaq_LV_T^Nplaia]VpA_lNTVa_‘AlNLN_mN]yiaiq]ApNL A_LUNAvV]yLNvN]aiNL_Ja_plAmp‘lqlA]A_Lq_V_JalialApNLAlNAm often face unique vulnerabilities due to limited infrastructure and resources. Rural areas include the _TN]Nm A_L !am -ALlNm #ApVa_A] alNmpm‘ wUVJU UAvN m^A]] Ja^^q_VpVNm‘ JA^iTlaq_Lm‘A_LLAyqmNAlNAm3UNlNAlNA]mapwaVm]A_LmwVpUV_pUNaq_py‘1A_pA ApA]V_AA_L1A_]N^N_pN3UNaq_pyA]maV_J]qLNmAmVT_VœJA_pA^aq_paSWildland Urban Interface (WUI) areas where residential and commercial development meets underdeveloped wildland with vegetative fuels. Land use within the County is equally LVvNlmN‘wVpUA^VxaSlNmVLN_pVA]‘Ja^^NlJVA]‘V_LqmplVA]‘ATlVJq]pqlA]‘A_LaiN_spaces. Recent urban development in densely populated areas has increased impervious mqlSAJNm]V\NJa_JlNpNA_LAmiUA]p‘wUVJUlNpAV_UNApA_LJlNAp NqlIA_UNApVm]A_Lm (UHI) that are much hotter than nearby rural areas3UVmiUN_a^N_a_N]NvApNmpN^iNlApqlNm‘ especially in low-V_Ja^NJa^^q_VpVNm]AJ\V_TTlNN_miAJNmSalJaa]V_TLLVpVa_A]]y‘ urbanization affects stormwater management by reducing natural drainage and NxAJNlIApV_TŔaaLV_TlVm\mV_]aw-lying areas. 3UNmN plN_Lm q_LNlmJalN pUN _NNL Sal mqmpAV_AI]N i]A__V_T mplApNTVNm‘ mqJU Am ila^apV_TTlNN_V_SlAmplqJpqlN‘N_UA_JV_Tmpal^wApNlmympN^m‘A_L^VpVTApV_TUNAp Vm]A_LmpUlaqTUplNNi]A_pV_TA_LlNŔNJpVvN^ApNlVA]m3UNaq_py¯mLVvNlmN]A_LqmN must be carefully managed to reduce vulnerabilities while supporting economic growth and environmental sustainability. County of Los Angeles All-Hazards Mitigation Plan Page 25 of 204 3.3 Social Vulnerability Social vulnerability is a crucial component to Los Angeles County’s hazard mitigation i]A__V_T3UN aq_py Vm Ua^N pa A LVvNlmN iaiq]ApVa_ wVpU LVmiAlVpVNm V_ V_Ja^N‘ UaqmV_T mpAIV]Vpy‘ A_L AJJNmm pa lNmaqlJNmThe Los Angeles County Anti-0AJVm^‘ VvNlmVpy‘A_L_J]qmVa_Ÿ0 _VpVApVvNJlNApNLAJa^ilNUN_mVvN kqVpy xi]alNl‘ which is a geospatial tool that explores multiple equity data points across Los Angeles County. The ARDI Equity Explorer includes varioum]AyNlmpUApvVmqA]V|NmaJVA]NkqVpy‘ economVJaiialpq_Vpy‘UaqmV_TA_LUa^N]Nmm_Nmm‘UNA]pU‘[qmpVJN‘IqV]pN_vVla_^N_p‘ and disaster recovery data. The public can access this data at ceo.lacounty.gov/ardi/tools. Maps created using data from the ARDI Equity Explorer are in Appendix A-8. The US Centers for Disease Control and -lNvN_pVa_ Ÿ  LNœ_Nm maJVA] vulnerability as a community’s capacity to prepare for and respond to the stress of hazardous events ranging from natural disasters to human caused threats. The CDC’s Social Vulnerability Index (Figure 3.1) is designed to identify and quantify communities experiencing social vulnerability. The most recent CDC Social Vulnerability Index score from 2022 for Los Angeles County indicated a high level of vulnerability across four themes: maJVaNJa_a^VJ mpApqm‘ UaqmNUa]L JUAlAJpNlVmpVJm‘lAJVA]A_LNpU_VJ^V_alVpy mpApqm‘A_LUaqmV_TpyiNplA_mialpApVa_ Vulnerable populations VLN_pVœNLSal!am_TN]Nmaq_pypUApwV]]INJa_mVLNlNLV_pUN AHMP include: Figure 3.1 CDC Social Vulnerability Index (CDC 2022) County of Los Angeles All-Hazards Mitigation Plan Page 26 of 204 x Low-_Ja^N 0NmVLN_pm: Individuals living below or near the poverty line are often disproportionately affected by LVmAmpNlmLqNpa]V^VpNLœ_A_JVA] resources for emergency ilNiAlNL_Nmm‘ lNmia_mN‘ A_L recovery. x People with Access and Functional Needs (AFN): Individuals with Access and Functional needs have increased challenges in ilNiAlNL_Nmm‘ NvAJqApVa_‘ mUN]pNlV_T‘ AJJNmmV_T emergency services and recovery. Access and Functional Needs include but are not limited to people who have any combination in varying degree of: physical disabilities‘ V_pN]]NJpqA]disabilities‘ developmental disabilities‘ ^N_pA] health-lN]ApNL VmmqNm‘ vVmqA] V^iAVl^N_pm‘ UNAlV_T impairments/deaf‘ ^aIV]Vpy impairments‘or chronic conditions. AFN also include a]LNl ALq]pm‘ V_SA_pm A_L JUV]LlN_‘people ]VvV_T V_ V_mpVpqpVa_A]V|NL mNppV_Tm‘ people living below tUNiavNlpy]V_NalNxiNlVN_JV_TUa^N]Nmm_Nmm‘people with ]V^VpNL _T]VmU ilaœJVN_Jy al AlN _a_-_T]VmU miNA\Nlm‘ alpeople who are transportation disadvantaged. x People Experiencing Homelessness (PEH): With an estimated over ‡…‘€€€ individuals NxiNlVN_JV_T Ua^N]Nmm_Nmm‘ pUVm iaiq]ApVa_ Vm iAlpVJq]Al]y Ap lVm\ during extreme weather events and other disasters. x Immigration Status: Fear of engaging with government services based on immigration status can prevent residents from accessing critical resources. Figure 3. 3 Breakdown of Language at Home in Los Angeles County (OAEOP 2023) Figure 3.2 ŝƐĂďŝůŝƚLJ^ƚĂƟƐƟĐƐŝŶ>ŽƐŶŐĞůĞƐŽƵŶƚLJ (OAEOP 2023) County of Los Angeles All-Hazards Mitigation Plan Page 27 of 204 x !V^VpNL_T]VmU-laœJVN_Jy’Over 40% of residents speak a language other pUA__T]VmUApUa^N‘UVTU]VTUpV_TpUN_NNLSal^q]pV]V_TqA]A_L Jq]pqlA]]y appropriate outreach efforts. Language accessibility is critical to ensure all residents and visitors can obtain information and services during a disaster. See Figure 3.3 for a breakdown of languages spoken at home in Los Angeles County not including American Sign Language. 3UNœTqlNIN]awUVTU]VTUpmJNlpAV_vAlVAI]NmV_!am_TN]Nmaq_pypUAp^AyV_JlNAmN vq]_NlAIV]Vpy pa N^NlTN_JVNm A_L LVmAmpNlm 3a ALLlNmm pUNmN vq]_NlAIV]VpVNm‘ pUN County’s mitigation planning includes equitable strategies designed to reduce risk and e_UA_JNlNmV]VN_JNA^a_TpUNmNiaiq]ApVa_m3AlTNpNLaqplNAJU‘V^ilavNLAJJNmmpa lNmaqlJNm‘ ilNiAlNL_Nmm NLqJApVa_ NvN_pm‘ A_L Ja]]AIalApVa_ wVpU Ja^^q_Vpy organizations are integral to these efforts. Figure 3.4 Los Angeles County Vulnerability Variables (OAEOP 2023) County of Los Angeles All-Hazards Mitigation Plan Page 28 of 204 The Federal Emergency Management Agency (FEMA) maintains the National Risk _LNx‘A^AiiV_Tpaa]pUApAmmNmmNmˆiammVI]NUA|AlLmA[qlVmLVJpVa_VmmqmJNipVI]Npa in combination with the amount of loss that could result from those hazards. Los Angeles County ranks as the community with the most risk in the United States AJJalLV_T pa pUN " #ApVa_A] 0Vm\ _LNxJJalLV_T pa pUN #ApVa_A] 0Vm\ _LNx‘ UA|AlLmwVpUpUNUVTUNmplVm\Sal!am_TN]Nmaq_pyV_J]qLNNAlpUkqA\N‘wV]LœlNm‘ NxplN^NUNAp‘ŔaaLV_T‘UVTUwV_Lm‘A_L]A_Lm]VLNm 3.4 Economy and Critical Infrastructure !am _TN]Nm aq_py Vm A T]aIA] NJa_a^VJ UqI‘ UampV_T V_LqmplVNmmqJUAm N_pNlpAV_^N_p‘ pNJU_a]aTy‘ ^A_qSAJpqlV_T‘ A_L V_pNl_ApVa_A] plALN3UN -alp aS !am Angeles and the Port of Long Beach collectively form one of the world’s busiest trade TApNwAym‘ q_LNlscoring the importance of protecting critical infrastructure from hazards including those exacerbated by climate change. Critical facilities provide mNlvVJNmA_LSq_JpVa_mNmmN_pVA]paAJa^^q_Vpy‘NmiNJVA]]yLqlV_TA_LASpNlALVmAmpNl Common types of crVpVJA]SAJV]VpVNmV_J]qLNIqpAlN_ap]V^VpNLpaœlNmpApVa_m‘ia]VJN mpApVa_m‘UamiVpA]m‘mJUaa]m‘A_LqpV]VpVNmlVpVJA]SAJV]VpVNm^AyA]maV_J]qLNi]AJNmpUAp JA_INqmNLSalmUN]pNlV_T‘Jaa]V_TJN_pNlm‘mpATV_TiqliamNm‘alapUNl]AlTNiqI]VJ gathering spots such as community centers and libraries. Critical facilities include those operated by non-governmental and business partners vital for redevelopment or Figure 3.5 &DEĂƟŽŶĂůZŝƐŬ/ŶĚĞdž (2025) County of Los Angeles All-Hazards Mitigation Plan Page 29 of 204 NJa_a^VJmNJqlVpy:UN_pUNmNAlNASSNJpNLIyALVmAmpNl‘pUNaq_py ilavVLNm businesses and workers impacted by the disaster with vital information and resources. This allows them to maneuver effectively through disaster response toward recovery using its network of job centers and business hubs. Other critical infrastructure includes the facilities and industries that enable all facets of maJVNpypaSq_JpVa_‘V_J]qLV_TIqp_ap]V^VpNLpapUNSa]]awV_TJa^^q_Vpy]VSN]V_Nm’ x Safety and Security’3UN ^ylVAL aS ]aJA] ]Aw N_SalJN^N_p‘ œlN A_L lNmJqN‘ N^NlTN_Jy^A_ATN^N_p‘mJUaa]m‘A_LapUNlTavNl_^N_pmNlvVJNmpUAp^AV_pAV_ public safety and security. x Communications: The interconnected network of infrastructure owners and aiNlApalmaSJa^^q_VJApVa_mmympN^mmqJUAmV_pNl_Np‘pN]NiUa_N‘JN]]q]AlA_L apUNlJa^^q_VJApVa_mpawNlm‘JAI]N‘mApN]]VpN‘A_L^alN x 3lA_mialpApVa_ #Npwal\m: The County’s extensive network of laALwAym‘ UVTUwAym‘lAV]wAym‘plA_mVpmympN^m‘and airports is essential for daily operations and disaster response. x Energy Systems: -awNlTN_NlApVa_SAJV]VpVNm‘N_NlTyLVmplVIqpVa__Npwal\m‘A_L pipelines are vulnerable to multiple types of hazards and threats. x Water and Wastewater Systems: Drought conditions and aging infrastructure at the over 220 different water agencies in Los Angeles County pose risks to water availability and quality. x Healthcare Facilities: Over 100 hospitals and numerous clinics serve the aq_py‘ lNkqVlV_T laIqmp Ja_pV_TN_Jy i]A_m pa ^AV_pAV_ aiNlApVa_m LqlV_T disasters. x Food and Shelter: 3UNvAmpmympN^aSSaaLilaLqJpVa_ŸVN‘ATlVJq]pqlN ‘ LVmplVIqpVa_‘A_LlNpAV]A]a_TwVpUJa^^q_VpyUaqmV_TalmUN]pNlV_T 3.5 Climate and Environmental Conditions !am_TN]Nmaq_pySAJNmNmJA]ApV_TlVm\mSla^J]V^ApNJUA_TN‘mVT_VœJA_p]yV^iAJpV_T Vpm N_vVla_^N_p‘ NJa_a^y‘ A_L Ja^^q_VpVNm 3UNmN JUA]]N_TNm V_J]qLN lVmV_T pN^iNlApqlNm‘ila]a_TNLLlaqTUpm‘^alNSlNkqN_pA_LmNvNlNNxplN^NwNApUNlNvN_pm‘ and their cascading effects. These risks highlight the critical need for adaptive planning pailapNJpvq]_NlAI]Niaiq]ApVa_m‘V_SlAmplqJpqlN‘A_L_ApqlA]lNmaqlJNm NyJ]V^ApN- County of Los Angeles All-Hazards Mitigation Plan Page 30 of 204 related considerations referenced in the Los Angeles County Climate Action Plan that will be addressed in this AHMP include‘IqpAlN_ap]V^VpNLpa: x Extreme Weather Events: Extreme temperatures in the Los Angeles region are NxiNJpNLpaV_JlNAmN apULlyA_LwNpNxplN^NmAlNila[NJpNLpaV_pN_mVSy‘]NALV_T to longer dry periods than historically experienced. These dry periods are expected paINSa]]awNLIymVT_VœJA_p]ywNppNlJa_LVpVa_m‘V_J]qLV_TAp^amiUNlVJ lVvNlm IlV_TV_T^alNV_pN_mNlAV_SA]]3UVmiAppNl_^AylNmq]pV_V_JlNAmNLwApNlmJAlJVpy‘ ^qLm]VLNm‘A_LŔaaLV_T x Sea-!NvN] 0VmN: Coasta]Ja^^q_VpVNmAlNApUNVTUpN_NLlVm\aSŔaaLV_TA_L NlamVa_‘pUlNApN_V_TUa^Nm‘IqmV_NmmNm‘A_LJlVpVJA]V_SlAmplqJpqlN Sea level rise can NxAJNlIApNpUNV^iAJpmaSUVTUpVLNm‘mpal^mqlTNm‘A_LUNAvyilNJViVpApVa_‘A_L JA_]NALpaV_JlNAmNLJaAmpA]ŔaaLV_TA_LmUalN]V_NNlamVa_ x _JlNAmV_T :V]LœlN 0Vm\’ ]V^ApN JUA_TN UAm V_pN_mVœNL wV]LœlN mNAma_m‘ particularly in the County’s mountainous‘wV]L]A_LqlIA_V_pNlSAJNŸ:4 ‘ and new and undeveloped regions. :V]LœlNmAlNila[NJpNLpaV_JlNAmNV_SlNkqN_JyA_L V_pN_mVpyV_J]qLV_TV_ma^NAlNAm_apUVmpalVJA]]yV^iAJpNLIywV]LœlN _lNmia_mN‘pUNaq_pyUAmilValVpV|NLV_pNTlApV_TJ]V^ApNALAipApVa_mplApNTVNmV_pa VpmUA|AlL^VpVTApVa_i]A__V_T‘Amaqp]V_NLV_pUN]V^ApN9q]_NlAIV]VpymmNmm^N_pA_L the OAEOP. 3.6 Regional Collaboration and Planning Efforts Los Angeles County’s size and complexity necessitates collaboration with numerous [qlVmLVJpVa_m‘ATN_JVNm‘A_LJa^^q_VpyalTA_V|ApVa_m3UNaq_pyVmLNmVT_ApNLAmpUN Operational Area Coordinator and functions as an intermediate level in the State of California’s Standardized Emergency Management System (SEMS). In accordance with 1"1‘pUNaq_pymNlvNmAmpUNJa^^q_VJApVa_mA_LJaalLV_ApVa_]V_\INpwNN_]aJA] governments within Los Angeles County and the state government. Partnerships with AJALN^VJ V_mpVpqpVa_m‘ _a_-ilaœpm‘ A_L ilVvApN mNJpal mpA\NUa]LNlm support data Ja]]NJpVa_‘iqI]VJN_TATN^N_p‘A_LV__avApVvN^VpVTApVa_mplApNTVNmLLVpVa_A]]y‘pUN County has also adopted Emergency Support Functions (ESFs) as the primary emergency management coordination structure. ESFs group function-miNJVœJ stakeho]LNlmwUawV]]JaalLV_ApNpUlaqTUaqpA]]iUAmNmaSN^NlTN_Jy^A_ATN^N_p‘ County of Los Angeles All-Hazards Mitigation Plan Page 31 of 204 including function-miNJVœJ ^VpVTApVa_ AJpVvVpVNm al ^alN V_Sal^ApVa_ a_ lNTVa_A] N^NlTN_Jy^A_ATN^N_pJa]]AIalApVa_A_Li]A__V_T‘lNSNlN_JNpUNOAEOP. 3.7 Implications for Hazard Mitigation Planning Understanding the community is a critical aspect in hazard mitigation planning. This Ja^^q_Vpyilaœ]NwV]]V_Sal^\NyJa_mVLNlApVa_mV_mqImNkqN_pmNJpVa_maSpUN"- including but not limited to the following: x Targeted Outreach: Include vulnerable populations and the business community in the planning process through equitable public outreach. x _SlAmplqJpqlN 0NmV]VN_JN’ -lValVpV|N pUN ilapNJpVa_ aS JlVpVJA] V_SlAmplqJpqlN‘ V_J]qLV_TialpmA_LplA_mialpApVa__Npwal\m‘N_NlTymympN^m‘A_LwApNlA_L wAmpNwApNlmympN^m‘A^a_TapUNlm x Climate Adaptation: Develop strategies to mitigate the impacts of climate JUA_TN‘SaJqmV_Ta_qlIA_UNApVm]A_Lm‘mNA-]NvN]lVmN‘A_LwV]LœlNlVm\m x 0NTVa_A]aalLV_ApVa_’ Strengthen direct collaboration within the OA between pUN aq_py‘ ]aJA] [qlVmLVJpVa_m‘ miNJVA] LVmplVJpm‘ q_VœNL mJUaa] LVmplVJpm‘ pUN business community and cross-sector non-governmental partners to enhance AwAlN_Nmm‘ilNiAlNL_Nmm‘A_LlNmia_mNJAiAIV]Vties. x Transparent & Open Communication: _mqlNJa^^q_VJApVa_mAlNAJJNmmVI]N‘ and clear to advance public trust and safety. Develop dashboards to demonstrate progress. County of Los Angeles All-Hazards Mitigation Plan Page 32 of 204 4 Climate Change County of Los Angeles All-Hazards Mitigation Plan Page 33 of 204 4.1 Climate Change Overview Climate change refers to the changing effect of the Earth's J]V^ApNmympN^avNlpV^N‘ V_J]qLV_TJUA_TNmV_pN^iNlApqlN‘ilNJViVpApVa_‘A_LwV_LiAppNl_m]V^ApNJUA_TN had mVT_VœJA_pV^iAJpma_!am_TN]Nmaq_py‘ASSNJpV_TvAlVaqmAmiNJpm aS ]VSN‘ N_vVla_^N_p‘ V_SlAmplqJpqlN‘ A_L mqmpAV_AI]N LNvN]ai^N_p‘ A_L ilNmN_pmincreasing lVm\mSla^A^i]VœNLUA|AlLmA_LJUA_TV_TIAmN]V_NmŸNT‘mNA]NvN] V_papUNSqpqlN. The lApNaSJ]V^ApNJUA_TNUAmmVT_VœJA_p]yAJJN]NlApNLavNlpUNlast three decades and trends continues. This plan addresses the effects of climate change related to disasters wVpUV_pUNaq_pyA_LmplApNTVNmpa^VpVTApNlVm\m‘SaJqmV_Ta_ilNiAlNL_Nmm‘lNmV]VN_JN and equity. ]V^ApNJUA_TNJa_plVIqpNmpa^alNSlNkqN_pA_LV_pN_mNLVmAmpNlm‘mqJUAmŔaaLm‘ wV]LœlNm‘ LlaqTUp A_L NxJNmmVvN UNAp 0VmV_T pN^iNlApqlNm A_L JUA_TV_T wNApUNl patterns pose UNA]pUlVm\m‘]V\NUNAp-lN]ApNLV]]_NmmNm‘lNmiVlApalyVmmqNm‘A_LpUNmilNAL of diseases. Hazard mitigation efforts aim to reduce the impacts and effects of greater hazards due to climate change. The economic impact of climate change has been mqImpA_pVA]‘ ASSNJpV_T V_LqmplVNm mqJU Am ATlVJq]pqlN‘ paqlVm^‘ A_L V_mqlA_JN with increasing risks due to accelerating climate changes. Greenhouse Gas (GHG) emissions are the main driver of J]V^ApNJUA_TN‘wUVJUJAqmNm V_JlNAmNLSlNkqN_Jy‘LqlApVa_‘A_LmNvNlVpyaSNxplN^NwNApUNlA_LJ]V^ApN-related LVmAmpNlm]V^ApNJUA_TNNxAJNlIApNmAVlia]]qpVa_‘]NALV_TpaiaalAVlkqA]VpyA_L health issues. GHG emissions from lNmVLN_pVA]IqV]LV_Tm‘Ja^^NlJVA]A_Linstitutional SAJV]VpVNm‘^A_qSAJpqlV_TV_LqmplVNmA_LJa_mplqJpVa_‘N_NlTyV_LqmplVNm‘ oil and natural gas systems. plA_mialpApVa_‘fossil N_NlTy‘wV]LœlNmA_LapUNlsources contribute to increased particulate matter and other pollutants in the air. County of Los Angeles All-Hazards Mitigation Plan Page 34 of 204 4.2 _pNTlApV_T]V^ApNUA_TNV_paA|AlL-laœ]Nm Integrating climate change into UA|AlLilaœ]NmV_va]vNmAmmNmmV_TpUN current and future impacts of climate change on various hazards and incorporating this information into planning and mitigation strategies. This section highlights how climate change relates to these hazards and how the county is addressing climate change through hazard mitigation efforts which help protect the county’s residents and economies from the adverse effects of climate changes and climate-A^i]VœNLevents. 4.2.1 Extreme Heat Increasing temperatures and high heat events is one of the most conspicuous results of and a direct correlation between GHG pollution and climate change. Excessive pN^iNlApqlNmV_pUN!am_TN]NmlNTVa_AlNNxiNJpNLpaV_JlNAmNmVT_VœJA_p]y^alN very hot days and warm nights. In addition to increasing baseline temperatures and NxplN^NUNApLqNpaJ]V^ApNJUA_TN‘UNApVm]A_LmNxAJNlIApNpN^iNlApqlNmA_LUVTU heat events. As development occurs and darker paved surfaces replace open land and vNTNpApVa_‘ pUNmN AlNAm INJa^N wAl^Nl Sal^V_T A_ ¬Vm]A_L­ aS UNAp !am_TN]Nm County experiences more frequent and excessive heat due to climate change. This is currently a major risk and with unmitigated GHG emissions increasing heat will lead to even greater health issqNm‘V_JlNAmNLN_NlTyLN^A_LSalJaa]V_T‘A_LapUNlmplAV_ma_ infrastructure. 4.2.2 Flooding ]aaLV_TV_!am_TN]Nmaq_pyaJJqlmLqNpaNxplN^NlAV_SA]]NvN_pmJAqmV_TŔAmU ŔaaLm‘lVvNlV_NŔaaLV_T‘A_LV_JlNAmNLmqlSAJNwApNlaAmpA]AlNAmV_!am_TN]Nm County are vulnerable to sea-]NvN]lVmNŸ1!0 ‘wUVJUNxAJNlIApNmJaAmpA]UA|AlLm]V\N ŔaaLm‘mpal^mqlTNm‘A_LJUla_VJNlamVa_%pUNllN]ApNLUA|AlLmV_J]qLNŔaaLV_T_NAl Figure 4.1 Sources of GHG Emissions from within Los Angeles County (LA County ϮϬϮϰ͖ϮϬϰϱůŝŵĂƚĞĐƟŽŶWůĂŶͿ County of Los Angeles All-Hazards Mitigation Plan Page 35 of 204 pUN ^aqpUm aS mplNA^m A_L JUA__N]m‘ ]A_Lm]VLNm‘ A_L mNAwApNl wN]] V_plqmVa_ 1!0 NxAJNlIApNmpUNV^iAJpmaSUVTUpVLNm‘mpal^mqlTNm‘A_LUNAvyilNJViVpApVa_ŔaaLV_T‘ and continued SLR will lead to more life safety concerns and increased damage to property and infrastructure. 4.2.3 Drought -la]a_TNLLlaqTUpmUAvNINJa^N^alNJa^^a_‘ASSNJpV_TpUNwApNlmqii]y‘ ATlVJq]pqlN‘A_LNJamympN^maS!am_TN]Nmaq_pylyA_LwNpNxplN^Nm AlN projected to increase and are likely to cause drier periods than what the region has historically experienced. 1aqpUNl_A]VSal_VAila[NJpNLpaTNpLlVNl‘wUV]N#alpUNl_A]VSal_VAwV]]V_JlNAmNV_ temperature. This will result in loss of snowpack within the Sierra Nevada Mountain lA_TN‘^NA_V_T]NmmwApNlSalA]]A]VSal_VA_mV_J]qLV_TSAl^Nlm‘lNmVLN_pm‘A_LqpV]ities. The State Water Resource Control Board proclaimed several water conservation N^NlTN_JylNTq]ApVa_mLqNpamNvNlNLlaqTUpJa_LVpVa_mpUAplNkqVlNmJa^^NlJVA]‘ V_LqmplVA]‘A_LlNmVLN_pVA]Ja_mNlvApVa_NSSalpm-laJ]A^ApVa_mV_J]qLN’ x January 4, 2022:State Water Board adopted the prohibited wasteful water uses emergency regulation x May 24, 2022:the State Water Board adopted the emergency regulation to ban decorative grass watering like non-functional turf irrigation x December 7, 2022:the State Water Board readopted the prohibited wAmpNSq]wApNlqmNmN^NlTN_JylNTq]ApVa_‘ x May 26, 2023:the State Water Board readopted the emergency regulation to ban decorative grass watering. 4.2.4 :V]LœlN wV]LœlNVmA_q_i]A__NLA_Lq_Ja_pla]]NLœlNV_A_AlNAaSJa^IqmpVI]NvNTNpApVa_ 3UNmNœlNmJA_NAmV]ymilNALINya_LpUN_ApqlA]AlNAmilV^AlV]yV_va]vV_TA_LUAvNA iapN_pVA]paJAqmNLA^ATNmaqpmVLNaSpUNiNlV^NpNl:V]LœlNilaIAIV]VpyLNiN_Lman ]aJA]wNApUNlJa_LVpVa_m‘aqpLaalAJpVvVpVNmA_LA_yilNJNLV_TJa_LVpVa_mŸNT‘]apmaS lAV_]NALV_TpavNTNpApVa_TlawpUA_LpUN_LlyV_TJa_LVpVa_m ‘A_LAiapN_pVA]VT_VpVa_ ŸNT‘]VTUp_V_TmplV\N‘Alma_‘LNIlVmIql_V_T‘N]NJplVJA]NkqVi^N_pSAV]qlN‘ JAlpAV]iViN‘ NpJ 3UNSlNkqN_JyA_LV_pN_mVpyaSwV]LœlNmUAmV_JlNAmNLLlVvN_ Iy UVTUNl County of Los Angeles All-Hazards Mitigation Plan Page 36 of 204 pN^iNlApqlNm‘]awNlilNJViVpApVa_‘]awNllN]ApVvNUq^VLVpy‘A_Lila]a_TNLLlaqTUpm 3UNmN NvN_pm UAvN JAqmNL ]amm aS ]VSN‘ LNmplay A_Lal LA^ATN pailaiNlpy‘ V_SlAmplqJpqlN‘pUNN_vVla_^N_pA_LiamNTlNApNllVm\mLqNpaUVmpalVJA]LNvN]ai^N_p patterns. The pV^N]V_NaS^A[alwV]LœlNNvN_pmA_LAJlNATNIql_NLV_!am_TN]Nm County is listed at Section 6.2 of the plan. 4.3 Climate Mitigation Strategies Los Angeles County is actively addressing climate change and implementing hazard mitigation strategies to reduce its impacts and build long-term resilience. The County SAJNmV_JlNAmV_TlVm\mSla^NxJNmmVvNUNAp‘wV]LœlNm‘LlaqTUpm‘ŔaaLm‘A_LmNA-level rVmN‘ A]]aSwUVJUpUlNApN_Ja^^q_VpVNm‘V_SlAmplqJpqlN‘A_L_ApqlA]lNmaqlJNm 3a ALLlNmm ^A_y aS pUNmN JUA]]N_TNm‘ pUN aq_py UAm LNvN]aiNL Ja^ilNUN_mVvN J]V^ApNi]A_mA_LmplApNTVNmpUApV_pNTlApNJ]V^ApNALAipApVa_‘mqmpAV_AI]N]A_LqmN‘ N^NlTN_JyilNiAlNL_Nmm‘A_LN_vVla_^N_pA]Ja_mNlvApVa_ yN_SalJV_T IqV]LV_T JaLNm‘V_vNmpV_T V_TlNN_V_SlAmplqJpqlN‘A_LmplN_TpUN_V_TJa^^q_VpyilNiAlNL_Nmm‘ Los Angeles County aims to minimize risks and enhance disaster resilience. These efforts align with state and federal climate policies and are designed to protect both current and future generations while encouraging a more sustainable and livable environment for all. 4.3.1 Climate Resilience Plans and Actions x Los Angeles County 2045 Climate Action Plan (2045 CAP): Establishes aggressive targets to reduce greenhouse gas emissions and achieve carbon neutrality by 2045. x :ApNla_mNlvApVa_ËlaqTUp0NmV]VN_JN"NAmqlNm’ Implements mandatory wApNllNmplVJpVa_m‘ila^apNmlAV_wApNl UAlvNmpV_T‘A_LNxiA_LmTlaq_LwApNl recharge and water recycling projects. x :V]LœlN"VpVTApVa_Ë9NTNpApVa_"A_ATN^N_p-laTlA^m’ Enforces Wildland 4lIA__pNlSAJNŸ:4 JaLNm‘V_JlNAmNmSalNmp^A_ATN^N_ppNJU_VkqNm‘aligned with Traditional Ecological Knowledge (TEK) principles and practices of our native indigenous communities‘ A_L mplN_TpUN_m œlN-resistant building and landscape requirements. County of Los Angeles All-Hazards Mitigation Plan Page 37 of 204 x lNN_ _SlAmplqJpqlN Ë 4lIA_ aa]V_T _VpVApVvNm’ Expands tree planting aligned with TEK principles and practices‘V_vNmpVTApNmlN^avV_TUAlLŸiAvNL  mqlSAJNm‘ A_L i]A_pV_T Tlaq_LJavNl‘ qpV]V|Nm A_L ila^apNm iqI]VJ Jaa]V_T JN_pNlmA_LUa^NUNApilNiAlNL_Nmm‘A_LN_JaqlATNmpUNqmN aSlNŔNJpVvN ¬Jaa]­laaœ_TA_LmqlSAJNmpa^VpVTApNpUNqlIA_UNApVm]A_LŸ4 NSSNJt. x Heat Action Plan: Develops strategies to reduce the adverse health impacts of NxJNmmVvNUNAppUlaqTUiqI]VJmUALNmplqJpqlNm‘Jaa]V_TJN_pNlm‘IqV]LV_TJaLNm‘ and increased public awareness campaigns for all susceptible to extreme heat. 3UNmNmplApNTVJAJpVa_mlNŔNJp!am_TN]Nmaq_py¯mJa^^Vp^N_ppapAJ\]V_TJ]V^ApN JUA_TN yV_pNTlApV_TilaAJpVvNia]VJVNm‘indigenous-V_Sal^NLilAJpVJNm‘community- LlVvN_ma]qpVa_m‘A_LlNmV]VN_pV_SlAmplqJpqlN‘!am_TN]Nmaq_py‘Vm_apa_]y^VpVTApV_T current risks but also preparing for a future where communities can thrive in an ever- changing dynamic environment. 4.4 Climate Change Conclusion 3UlaqTUilaAJpVvNia]VJVNmA_LJa^^q_VpyN_TATN^N_p‘!am_TN]Nmaq_pymplVvNm pa _AvVTApN pUN Ja^i]NxVpVNm aS A JUA_TV_T J]V^ApN A_L mASNTqAlL Vpm iNai]N‘ N_vVla_^N_p‘V_SlAmplqJpqlNA_LNJa_a^VNm3UVmAiilaAJUUN]im^V_V^V|NpUNlVm\mA_L impacts associated with climate-related hazards. Addressing climate change in hazard ^VpVTApVa_UN]iN_UA_JNmASNl‘UNA]pUVNl‘A_L^alNmqmpAV_AI]NJa^^q_VpVNm County of Los Angeles All-Hazards Mitigation Plan Page 38 of 204 5 Integrating Access and Functional Needs (AFN) into Hazard Mitigation County of Los Angeles All-Hazards Mitigation Plan Page 39 of 204 5.1 AFN Introduction Modern hazard mitigation planning increasingly recognizes that resilient communities must address the needs of all residents —including those with access and functional _NNLmŸ# VmpalVJA]]y‘V_LVvVLqA]mwVpULVmAIV]VpVNm ŸVNV_J]qLV_TIqp_ap]V^VpNLpa‘ yaqpU‘ pUamN NJa_a^VJA]]y LNilNmmNL‘ ilNT_A_p‘ NpJ ‘ JUla_VJ UNA]pU Ja_LVpVa_m‘ ]A_TqATNIAllVNlm‘alplA_mialpApVa_LVmALvA_pATNmUAvNbeen underrepresented in emergency planning. As evidenced by the best practices for stakeholder inclusion and furpUNl mqiialpNL Iy _ApVa_A] ilNiAlNL_Nmm SlA^Nwal\m‘ V_pNTlApV_T# considerations leads to plans that are more inclusive and effective. By proactively N_TATV_T#iaiq]ApVa_mA_LmqiialpATN_JVNmV_NvNlyiUAmN‘Sla^preparedness pUlaqTUlNJavNly‘AUA|AlL^VpVTApVa_i]A_JA_lNLqJN]ammNm‘V^ilavNNvAJqApVa_A_L mUN]pNlV_TaqpJa^Nm‘A_LIqV]LplqmpINpwNN_N^NlTN_Jy^A_ATN^N_pATN_JVNmA_L the communities they serve. 5.2 Inclusion of AFN and Vulnerable Populations in Planning ^A[alJa^ia_N_paSNSSNJpVvN^VpVTApVa_i]A__V_TVmA¬wUa]NJa^^q_Vpy­AiilaAJU Incorporating AFN voices into the planning process is crucial because these stakeholders offer real-world insights into the challenges they face during emergencies. Key stNimpapUVmilaJNmmV_J]qLN‘IqpAlN_ap]V^VpNLpa’ x 1pA\NUa]LNl _TATN^N_p’ Ensure that representatives from disability ALvaJAJyTlaqim‘Ja^^q_Vpy-IAmNLalTA_V|ApVa_m‘A_LmNlvVJNilavVLNlmŸmqJU as local health departments and transportation agencies) are engaged early in pUNi]A__V_TilaJNmm3UNVlœlmpUA_LNxiNlVN_JNmUN]iVLentify practical barriers that might otherwise be overlooked. x Public Participation: _JalialApV_T iqI]VJ mpA\NUa]LNlm pUlaqTU ^NNpV_Tm‘ mqlvNym‘A_LapUNlaqplNAJUpaJAipqlNpUNLVvNlmN_NNLmaS#iaiq]ApVa_m This input is vital to overcoming historical marginalization and ensuring that mitigation actions are relevant and equitable to the entire population. x Ongoing Interagency Collaboration: Develop a hazard mitigation planning advisory committee and interagency working groups that include AFN stakeholders. These groups can guide both the planning process and the review aSNxVmpV_Ti]A_m‘N_mqlV_TpUAp#VmmqNmAlNSq]]yV_pNTlApNLSla^pUN outset. County of Los Angeles All-Hazards Mitigation Plan Page 40 of 204 5.2.1 Integrating AFN into the Overall AHMP Integrating AFN considerations is not a stand-A]a_N pAm\“ Vp ^qmp IN V_pNl]AJNL throughout the entire hazard mitigation planning process. This includes: x 0Vm\mmNmm^N_pm’Incorporate AFN data into all risk assessments to ensure that pUNmiNJVœJvq]_NlAIV]VpVNmaSpUNmNiaiq]ApVa_mAlNlNŔNJpNLV_UA|AlL^AimA_L vulnerability index data. x Mitigation Strategy Development:Ensure that every mitigation action is NxA^V_NLSalVpmV^iAJpa_#iaiq]ApVa_malNxA^i]N‘wUN_i]A__V_TSal ŔaaLJa_pla]alwV]LœlNilNvN_pVa_ila[NJpm‘lNvVNwUawpUNmNila[NJpmJA_IN improved to meet the needs of people with access and functional needs. x -]A_ 0NvVNw A_L 4iLApN’Ensure planning processes include regular AFN review and updates. Includes but not limited to: o Surveys of community needs o Consultations with AFN advisory groups o Integration of new technological or infrastructural solutions x q_LV_T A_L 0NmaqlJN ]]aJApVa_’Clearly identify funding streams and resource commitments for AFN-miNJVœJila[NJpm3UVmJaq]LV_va]vNpAlTNpNL TlA_pmSla^SNLNlA]ilaTlA^mŸNT‘A|AlL"VpVTApVa_mmVmpA_JN ‘mpApNSq_LV_T LNLVJApNLpaAJJNmmVI]NV_SlAmplqJpqlNV^ilavN^N_pm‘A_L]aJAl resources such as the Productivity Investment Fund that can be accessed to improve the NSSNJpVvN_NmmA_LNSœJVN_JyaSaq_pyaiNlApVa_m 5.3 Assessment of AFN Needs Understanding the specific needs of AFN populations requires both quantitative and qualitative approaches: x ApAa]]NJpVa_A_L0Vm\mmNmm^N_p’Use existing resources‘Ja^^q_Vpy mqlvNym‘outreach and risk assessments to help identify the number and types of individuals with AFN at the local community level. Evaluate the regional TNaTlAiUVJLVmplVIqpVa_‘vq]_NlAIV]VpVNm‘A_LmiNJVSVJlNkqVlN^N_pmbefore and after emergencies. County of Los Angeles All-Hazards Mitigation Plan Page 41 of 204 x lA^Nwal\mSal_A]ymVm’Adopt structured methodologies such as C-MIST Ÿa^^q_VJApVa_‘"AV_pAV_V_TNA]pU‘_LNiN_LN_JN‘1qiialp‘1ASNpy‘A_L Transportation) to assess/ document AFN requirements. x C-MIST Explanation o Communication’_LVvVLqA]mwVpUUNAlV_T‘vVmVa_‘JaT_VpVvN‘almiNNJU limitations may require alternative communication methods to receive or express information during emergencies. o Medical / Health Needs: People with complex medical conditions rely a_^NLVJApVa_m‘^NLVJA]NkqVi^N_p‘almiNJVA]V|NLJAlNpa^AV_pAV_ their health and prevent complications. o Independence’3UamNwUaqmN^aIV]VpyLNvVJNm‘AmmVmpVvNpNJU_a]aTy‘ or service animals need uninterrupted access to maintain their independence and daily functions. o Supervision & Safety: Some individuals require continuous support for mASNpy‘Ja^Salp‘alN^apVa_A]wN]]-INV_T‘V_J]qLV_TpUamNwVpU^N^aly VmmqNm‘imyJUVAplVJJa_LVpVa_m‘alV_pN]]NJpqA]LVmAIV]VpVNm o Transportation: Individuals without personal transportation or with ^aIV]Vpy]V^VpApVa_m_NNLAJJNmmVI]NA_LlN]VAI]NaipVa_m‘NmiNJVA]]yV_ emergencies and evacuations. x _pNTlApV_T9q]_NlAIV]VpymmNmm^N_pm’Leverage tools from local climate vulnerability assessments and hazard mitigation plan reviews to identify areas where AFN populations overlap with high-lVm\|a_NmŸNT‘S]aaLi]AV_m‘ County of Los Angeles All-Hazards Mitigation Plan Page 42 of 204 wildfire-prone areas). This integration helps prioritize mitigation actions in regions where vulnerable populations are most exposed. 5.4 Coordination with AFN Support Agencies Effective mitigation planning requires robust coordination with both governmental and nongovernmental agencies that serve AFN populations. Best practices include: x Formal Partnerships: Establish relationships and partnerships with agencies mqJUAmiqI]VJUNA]pULNiAlp^N_pm‘maJVA]mNlvVJNm‘plA_mialpApVa_AqpUalVpVNm‘ community-IAmNLalTA_V|ApVa_m‘A_LLVmAIV]VpyALvaJAJyalTA_V|ApVa_m3UNmN iAlp_NlmUVimN_mqlNpUAppUNlNVmJ]NAl‘a_Toing communication and that roles A_LlNmia_mVIV]VpVNmAlNLN]V_NApNLINSalN‘LqlV_T‘A_LASpNlLVmAmpNlm x Joint Training and Exercises: a_LqJplNTq]Al[aV_p^NNpV_Tm‘A_LNxNlJVmNm that include AFN components and identify additional resources to support the needs of the AFN community. These actions will help prepare all stakeholders to work together during a crisis and help identify gaps in current plans. x Outreach and Information Dissemination: _mqlNpUApA]]V_Sal^ApVa_‘IapU pre-V_JVLN_p ilNiAlNL_Nmm ^NmmATNm‘ lNmia_mN ^NAmqlNm A_L iamp-incident recovery plans are accessible to all audiences. This includes using multiple ]A_TqATNm‘ vAlVaqm Ja^^q_VJApVa_ Sal^Apm ŸNT‘ ]AlTN-ilV_p‘ AqLVa‘ mVT_- ]A_TqATN‘A_LLVTVpA]Sal^Apm ‘A_LJq]pqlA]]yAiilailVApN^NmmATV_TpalNAJUA]] segments of the community. 5.5 AFN Conclusion UA|AlL^VpVTApVa_i]A_IqV]LmASaq_LApVa_SalAlNmV]VN_p‘V_J]qmVvNJa^^q_Vpy y ensuring that AFN and other vulnerable populations are included in every phase of i]A__V_T‘Sla^V_VpVA]mpA\NUa]LNlN_TATN^N_ppapUNLNvN]ai^N_p aS pAV]alNL mitigation AJpVa_mA_LJaalLV_ApNLlNmia_mNmplApNTVNm‘Ja^^q_VpVNmJA_^V_V^V|N disaster impacts and foster long-term resilience. Drawing on best practices from _ApVa_A]SlA^Nwal\mA_L]aJA]i]A__V_TTqVLNm‘A_LIyV^i]N^N_pV_T-compliant shelter operations‘ emergency managers can create a plan that truly serves every member of the community. This inclusive approach not only saves lives and property during disasters but also strengthens community trust and the overall effectiveness of emergency management efforts. County of Los Angeles All-Hazards Mitigation Plan Page 43 of 204 6 A|AlLLN_pVœJApVa_A_L Risk Assessment County of Los Angeles All-Hazards Mitigation Plan Page 44 of 204 6.1 A|AlLLN_pVœJApVa_%vNlvVNw 3UNUA|AlLVLN_pVœJApVa_A_LlVm\AmmNmm^N_pilaJNmmprovide a foundation for Los _TN]Nmaq_py¯mUA|AlL^VpVTApVa_i]A__V_TNSSalpmIyVLN_pVSyV_T‘ ilaœ]V_T‘ A_L AmmNmmV_TpUNlVm\mAmmaJVApNLwVpU_ApqlA]‘pNJU_a]aTVJA]‘A_LUq^A_-caused hazards. This section builds on the framework established in the 2020 HazalL"VpVTApVa_-]A_‘ incorporating insights from the 2023 Operational Area Emergency Operations Plan (OA%- ‘pUN‚€‚4 Los Angeles 3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_p (THIRA)‘ pUN Los Angeles County Climate Vulnerability Assessment‘the State of A]VSal_VAA|AlL"VpVTApVa_-]A_Ÿ1"- ‘ and the Federal Emergency Management Agency (FEMA) National Risk Index. Based on these sources hazards were included and addressed in the 2025 AHMP AJJalLV_TpapUNVlSlNkqN_Jy‘mNvNlVpyA_LV^iAJppa!am_TN]Nmaq_py‘mNNIN]aw Table 6-1. Hazards that did not meet the threshold of moderate risk will not be prioritized within the plan. LLVpVa_A]]y‘ pUlNN _Nw _ApqlA] UA|AlLm ŸxplN^N NAp‘ laqTUp‘A_L1NvNlN:V_L3al_ALa  and four human-caused hazards Ÿ"Amm9Va]N_JN‘ yINl_JVLN_pm‘3lA_mialpApVa__JVLN_pm‘A_L-qI]VJNA]pU^NlTN_JVNm  are included in the 2025 AHMP. Table 6-1 Hazard Inclusion/ Omission Hazard Comment Earthquake Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py :V]LœlN Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Heat Wave Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Tornado Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘ A_L V^iAJp pa !am _TN]Nm aq_py Tornado is incorporated with the Severe Wind/ Tornado hazard ilaœ]N. Land Movement Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py County of Los Angeles All-Hazards Mitigation Plan Page 45 of 204 Hazard Comment Lightning Hazard is included in the plan due to its high SlNkqN_Jy‘ mNvNlVpy‘ A_L V^iAJp pa !am _TN]Nm aq_py Lightening is incorporated wVpUpUN:V]LœlNand Flooding hazard ilaœ]Nm. Flooding HazAlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L  impact to Los Angeles County. 3UN ]aaLV_T UA|AlL ilaœ]N incorporates both Riverine and Coastal Flooding. Drought HazAlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L  impact to Los Angeles County. Strong Wind Hazard is included in the i]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L impact to Los Angeles County. Strong Wind is incorporated with the Severe Wind and 3al_ALaUA|AlLilaœ]N Tsunami HazAlLVmV_J]qLNLV_pUNi]A_LqNpaVpmSlNkqN_Jy‘mNvNlVpy‘A_L  impact to Los Angeles County. Winter Weather Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Hail Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Avalanche Hazard is omitted from the plan due to its minimal SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Cold Wave Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Hurricane Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Ice Storm Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py Volcanic Activity Hazard is omitted from the plan due to its lack of SlNkqN_Jy‘ mNvNlVpy‘A_LV^iAJppa!am_TN]Nmaq_py County of Los Angeles All-Hazards Mitigation Plan Page 46 of 204 !am_TN]Nmaq_pySAJNmAwVLNlA_TNaSUA|AlLmLqNpaVpmTNaTlAiUVJLVvNlmVpy‘ iaiq]ApVa_LN_mVpy‘A_LNJa_a^VJmVT_VœJA_JN3UNSa]]awV_TUA|AlLmwNlNVLN_pVœNL A_LilValVpV|NLSla^pUNilNvVaqm]y^N_pVa_NLmaqlJNmIAmNLa_UVmpalVJA]aJJqllN_JNm‘ popN_pVA]V^iAJpm‘A_LSqpqlNlVm\m’ 1.:V]LœlN 2. Earthquake 3. Extreme Heat 4. Drought 5. Flooding 6. Dam Failure 7. Land Movement 8. Tsunami 9. Severe Wind and Tornado 10. Mass Violence 11. Cybersecurity Incidents 12. Transportation Incidents 13. Public Health Emergencies ^a_TpUNmNUA|AlLm‘six wNlNVLN_pVœNLpaINiapN_pVA]]yNxAJNlIApNLIyJ]V^ApN change V_J]qLV_TwV]LœlN‘NxplN^NUNAp‘LlaqTUp‘ŔaaLV_T‘]A_L^avN^N_p‘A_LmNvNlN wind and tornadoes. Additional human-caused hazards were included based on the ‚€‚„30V_J]qLV_T^AmmvVa]N_JN‘JyINlmNJqlVpyV_JVLN_pm‘plA_mialpApVa_V_JVLN_pm‘ and public health emergencies. The results of the public Personal Disaster Impact 1qlvNyvA]VLApNLpUAppUNmNUA|AlLmAlNaSmVT_VœJA_pJa_JNl_paJaq_pylNmVLN_pmA risk assessment table comparing hazards to critical infrastructure is in Appendix C. Table 6-2 UA_TNmV_NvN]ai^N_pA_L9q]_NlAIV]Vpy Hazard Change (Increase/ Decrease) 0NAma_ Earthquake No Change While new construction adheres to modern seismic codes aging infrastructure in high seismic zones remain vulnerable. Continued population growth in older neighborhoods with limited County of Los Angeles All-Hazards Mitigation Plan Page 47 of 204 Hazard Change (Increase/ Decrease) 0NAma_ lNplaœppV_TV_JlNAmNmavNlA]] exposure. :V]LœlN (Lightning) Increase in Vulnerability Urban expansion into Wildland- Urban Interface (WUI) areas has increased the number of homes at risk. Post 2020 development in UVTUœlNmNvNlVpy|a_NmUAm Ja_pV_qNL‘pUaqTULNSN_mVI]N miAJNlNTq]ApVa_mA_L_NwœlN- safe planning are improving resilience for new builds. Extreme Heat Increase in Vulnerability -aiq]ApVa_LN_mVpy‘urban heat islands‘ and development in inland valleys increases exposure. Older multi-family units without air conditioning remain a concern. More outdoor workers and people experiencing homelessness (PEH) add to vulnerable population. Land Movement Stable to Slight Increase Most new development avoids known landslide-prone areas due to zoning and geotechnical review. awNvNl‘ climate-driven precipitation variability and wV]LœlNmJa_pV_qNpaLNmpAIV]V|N slopes in developed areas. Flooding (Lightning) Increase in Vulnerability New impervious surfaces from development increase stormwater lq_aSS%]LNlŔaaLJa_pla] infrastructure is strained under UNAvVNl‘^alNSlNkqN_plAV_NvN_pm. County of Los Angeles All-Hazards Mitigation Plan Page 48 of 204 Hazard Change (Increase/ Decrease)0NAma_ Drought Increase in Vulnerability Continued population growth and water demand in arid and semi- arid zones has outpaced gains in conservation. Agricultural vulnerability persists in high desert areas. Severe Wind and Tornado Increase in Vulnerability Los Angeles County is experiencing more frequent and V_pN_mNwV_LNvN_pm‘V_J]qLV_T tornadoes. As urban development NxiA_Lm‘plNNJA_aiVNmA_L overhead utilities in densely developed areas continue to contribute to cascading hazards. In lNmia_mN‘NSSalpmAlNq_LNlwAypa underground utility lines in high- risk areas. Tsunami Stable Revised tsunami inundation maps UAvNlNœ_NLpUNAp-risk zones. New developments in coastal areas are largely outside the updated hazard areas or comply with stricter coastal building codes. Dam Failure Stable/ Slight Increase While no new major dams have INN_Ja_mplqJpNLV_lNJN_pyNAlm‘ downstream development continues to increase population and critical infrastructure exposure within inundation zones. County of Los Angeles All-Hazards Mitigation Plan Page 49 of 204 Countytytytyyyytyyyyyyyyyyyyyyyyyy ooofofofofooofofoffofofofoooofooffoofofoffooffofofofooffofffofffoooooooofooooooofooooooooooooooooooooooooooooooofooooooooooooooooooooo LoLos As Angengelesles AllAAllAAAAAAAAAAA-HazHaazHazazazazazazzzazazzzHazazzzaazazazaazazzzzzzazzzazaazaazzaaaaaaaaarararardardrdrdaarardardrdarardardardardararararaaaardrrardrdrrrrrrrrrddrrrrrrrrss Msititigatgationon PlaPlan 6.2 :V]LœlN 6.2.1 Nature :V]LœlNmAlNSAmp-^avV_T‘ q_Ja_pla]]NL œlNmpUApJa_mq^NvNTNpApVa_A_LlAiVL]y milNAL‘aSpN_pUlNApN_V_T]VvNm‘mplqJpqlNm‘ A_L V_SlAmplqJpqlN 3UNmN œlNm JA_ IN VT_VpNL Iy _ApqlA] JAqmNm‘ mqJU Am ]VTUp_V_T‘ al Uq^A_ AJpVvVpVNm‘ V_J]qLV_T unattended ca^iœlNm‘ Law_NL iawNl ]V_Nm‘A_LAlma_3UNV_JlNAmV_TSlNkqN_Jy‘ LqlApVa_‘A_LV_pN_mVpyaSwV]LœlNmV_!am Angeles County are possibly linked to the JUA_TV_T J]V^ApN‘ wVpU UappNl pN^iNlApqlNm‘ ila]a_TNL LlaqTUpm‘ A_L reduced humidity levels making the rNTVa_UVTU]ymqmJNipVI]NpaœlNm AJpalm_ŔqN_JV_T:V]LœlN NUAvVal x Topography: Fires spread more rapidly on steep slopes and are often driven by the Santa Ana winds. x Fuel Load’N_mN‘Lly vegetation and high tree mortality increase fire intensity. x Weather Conditions’VTUpN^iNlApqlNm‘mpla_TwV_Lm‘A_L]awUq^VLVpy N]NvApNSVlNlVm\‘wVpUpUNJUA_TV_TJ]V^ApNJa_plVIqpV_TpaA]N_TpUN_NLSVlN season. County of Los Angeles All-Hazards Mitigation Plan Page 50 of 204 :V]LœlNmA]maJlNApNmNJa_LAlyUA|AlLmmqJUAmiaalAVlkqA]Vpy‘]A_Lm]VLNm‘ŔaaLV_T‘ A_L LNIlVm Ŕawm—especially in areas with recent burn scars where vegetation loss increases soil instability. 6.2.2 Location !am_TN]Nmaq_pyVma_NaSpUN^ampwV]LœlN-prone regions in the United States. Based on the Department of Forestry and Fire Protection (CAL FIRE) Fire Hazard 1NvNlVpy ?a_N Ÿ1?  ^Aim‘ mVT_VœJA_p wV]LœlN lVm\ NxVmpm V_ pUN 1A_pA "a_VJA "aq_pAV_m‘1A_AIlVN]"aq_pAV_m‘-A]am9NlLNmV]]m‘A_LPuente Hills. The 2024 THIRA and Los Angeles County Climate Vulnerability Assessment identify an increasing risk to communities located in or near these high-risk areas. !am_TN]Nmaq_pyUAmpUlNNilV^AlywV]LœlN^A_ATN^N_p|a_Nm’ x NLNlA]0Nmia_mVIV]VpylNAmŸ0m ’Lands administered or controlled by the federal government where federal agencies have administrative and protection responsibility for wildfires. x 1pApN0Nmia_mVIV]VpylNAmŸ10m ’Wildland areas where CAL FIRE is responsible for suppression efforts. x !aJA]0Nmia_mVIV]VpylNAmŸ!0m ’Developed regions where local ATN_JVNm‘mqJUAm!am_TN]Nmaq_pyVlNNiAlp^N_pŸ!a ‘ilavVLN fire protection. alAINppNlvVmqA]lNilNmN_pApVa_aSpUVm:V]LœlNA|AlLwVpUV_pUN!aq_pyi]A__V_T AlNA‘i]NAmNlNSNlN_JNiiN_LVx_J]qLNLV_iiN_LVxAlNmNvNlA]VlNA|AlL Severity Zone maps for reference. 6.2.3 Extent JJalLV_Tpa!0¯mVlNA|AlL1NvNlVpy?a_NŸ1? ^Aim‘!am_TN]Nmaq_py contains: x 386.06 square miles (8.11%) classified as Very High Fire Hazard Severity ?a_NŸ1? V_!aJA]0Nmia_mVIV]VpylNAm‘!0m x 625.01 square miles (13.13%) classified as Very High (FHSZ) in State 0Nmia_mVIV]VpylNAm‘10m. :V]LœlNmiamNAmVT_VœJA_ppUlNAp_apa_]ypUlaqTUpUNV^^NLVApNLA^ATNpUNyJAqmN pa]VvNm‘ilaiNlpy‘A_L_ApqlA]lNmaqlJNm‘IqpA]mapUlaqTUpUNmNJa_LAlyUA|AlLmpUAp Ja_pV_qNASpNlpUNŔA^NmAlNNxpV_TqVmUNL _pUNASpNl^ApUaSAœlN‘Ja^^q_VpVNmaSpN_SAJNV_JlNAmNLlVm\maSŔAmUŔaaLm‘LNIlVm Ŕawm‘ A_L LNTlALNL AVl kqA]Vpy3UNmN iamp-œlN V^iAJpm JA_ Ja^iaq_L pUN V_VpVA] LNmplqJpVa_‘i]AJV_TALLVpVa_A]mplAV_a_V_SlAmplqJpqlN‘UNA]pUmympN^m‘A_LlNJavery efforts. County of Los Angeles All-Hazards Mitigation Plan Page 51 of 204 6.2.4 History !am _TN]Nm aq_py UAm NxiNlVN_JNL _q^Nlaqm LNvAmpApV_T wV]LœlNm V_ lNJN_p LNJALNm‘V_J]qLV_T’ x Canyon Fire (1968) – ql_NL‚‚‘€€€AJlNm‘LNmplayNL„‡Ua^Nm‘A_L]NL to mass evacuations. x Old Topanga Fire (1993) – a_mq^NL†‘…†AJlNm‘LNmplayV_Tƒˆˆ structures and causing three fatalities. x Sayre Fire (2008) – NmplayNL„ˆ‰mplqJpqlNm‘V_J]qLV_TavNl†€€^aIV]N homes. x Station Fire (2009) – 3UN]AlTNmpSVlNV_!am_TN]Nmaq_pyUVmpaly‘ Iql_V_T†€‘…‡‡AJlNm‘LNmplayV_T‚€‰mplqJpqlNm‘A_LJAqmV_Tpwa firefighter fatalities. x Woolsey Fire (2018) – ql_NL‰†‘‰„‰AJlNm‘LNmplayNL‘†„ƒmplqJpqlNm‘ and resulted in three fatalities. x Bobcat Fire (2020) – 1JalJUNL…‘‡‰†AJlNm‘LNmplayV_T‡mplqJpqlNm and damaging numerous infrastructures in the Angeles National Forest. x Palisades Fire (2025) – 0Nmq]pNLV_mVT_VSVJA_pLNmplqJpVa_A_L]ammaS]VSN‘ Iql_V_T‚ƒ‘‡€‡AJlNm‘LNmplayNLAiilaxV^ApN]y†‘ˆƒƒmplqJpqlNm‘A_L causing 12 civilian fatalities. x Eaton Fire (2025) – 0Nmq]pNLV_mVT_VSVJA_pLNmplqJpVa_A_L]ammaS]VSN‘ Iql_V_T„‘€‚AJlNm‘LNmplayV_TAiilaxV^ApN]y‰‘„ˆmplqJpqlNm‘A_L causing 17 civilian fatalities. 3UNmNœlNmUVTU]VTUppUNV_JlNAmV_TSlNkqN_JyA_LV_pN_mVpyaSwV]LœlNm‘N^iUAmV|V_T the urgent need for stronger mitigation and preparedness efforts. 3UN!am_TN]Nmaq_pyAlNAUAmNxiNlVN_JNLSNLNlA]]yLNJ]AlNLwV]LœlNmA_LAlN shown in the table below. 3UNlNUAvNINN__ampApNilaJ]A^ApVa_mSalwV]LœlNmV_pUN ]AmpœvNyNAlm NLNlA]]yNJ]AlNL:V]LœlNVlN"A_ATN^N_pmmVmpA_JNNJ]AlApVa_V_!amAngeles County from 1/1/2020 to 3/28/2025 Date Incident Name No. Category 1/8/2025 A]VSal_VA:V]LœlNmA_L Winds 4856 Federal Declaration 1/8/2025 California Eaton Fire 5550 Fire Management Assistance Declaration 1/8/2025 California Hurst Fire 5551 Fire Management Assistance Declaration 1/7/2025 California Palisades Fire 5549 Fire Management Assistance Declaration 12/10/2024 California Franklin Fire 5548 Fire Management Assistance Declaration 9/11/2024 California Bridge Fire 5537 Fire Management Assistance Declaration 10/16/2020 A]VSal_VA:V]LœlNm 4569 Federal Declaration 9/13/2020 California Bobcat Fire 5374 Fire Management Assistance Declaration County of Los Angeles All-Hazards Mitigation Plan Page 52 of 204 6.2.5 Probability :VpUmNvNlA]TqAlA_pNNLwV]LœlNmNAJUyNAl‘pUNilaIAIV]VpyaSwV]LœlNVT_VpVa_V_!am _TN]Nmaq_pyVmTlALqA]]yV_JlNAmV_T‘LlVvN_]AlTN]yIyJ]V^ApNJUA_TNThere is a €€È JUA_JN aS A œlN aJJqllV_T NAJU yNAl wVpUV_ pUN TNaTlAiUVJi]A__V_T AlNA VmpalVJA]]y‘wV]LœlNmaJJqllNLINpwNN_q_NA_L#avN^INl‘IqplNJN_pyNAlmUAvN shown a year-laq_LœlNmNAma_LqNpaUappNl‘LlVNlJa_LVpVa_mA_L^alNV_pN_mN weather variability. !a_TNl Lly iNlVaLm‘ lNLqJNL Uq^VLVpy‘ A_L V_JlNAmNL pN^iNlApqlNm‘Jaqi]NLwVpU historic drought and vegetation die-aSS‘UAvNJlNApNLJlVpVJA]]yLlySqN]INLm3UNmN NvN_pm^A\NNvN_m^A]]VT_VpVa_maqlJNmJAiAI]NaSTN_NlApV_T^A[alwV]LœlNm Santa Ana wV_LmJa_pV_qNpamNlvNAmA^A[alAJJN]NlA_p‘Ja_plVIqpV_TpalAiVLœlN milNALA_LmNvNlNœlNINUAvVal:UN_Ja^IV_NLwVpUqlIA_N_JlaAJU^N_pV_paœlN- ila_N AlNAm‘ pUNmN Ja_LVpVa_m N]NvApN IapU pUN SlNkqN_Jy A_L LNmplqJpVvN_Nmm aS wV]LœlNm Projections from the 2024 THIRA and the LA County Climate Vulnerability Assessment Ja_œl^pUApwV]LœlNilaIAIV]VpywV]]Ja_pV_qNpalVmNq_]NmmmVT_VœJA_pSqN]lNLqJpVa_‘ ]A_L qmN i]A__V_T‘ A_L J]V^ApN ALAipApVa_ mplApNTVNm AlN V^i]N^N_pNL AJlamm A]] jurisdictions. The 2024 THIRA estimates that: x Over 1.2 million residents live in high-risk wildfire zones. x Communities near the Wildland-Urban Interface (WUI) are at the greatest lVm\‘NmiNJVA]]ypUamNwVpU]V^VpNLNvAJqApVa_laqpNm‘A_LpUNJJNmmA_L Functional Needs community. x 9q]_NlAI]Niaiq]ApVa_m‘V_J]qLV_TmN_Valm‘]aw-V_Ja^NUaqmNUa]Lm‘A_L iNai]NwVpULVmAIV]VpVNm‘SAJNUNVTUpN_NLJUA]]N_TNmLqlV_TNvAJqApVa_m. 6.2.6 Vulnerability !am_TN]Nmaq_pySAJNmUVTUwV]LœlNvq]_NlAIV]VpyLqNpaVpmNxpN_mVvN:V]L]A_L- 4lIA__pNlSAJNŸ:4 ‘wVpUavNl‚^V]]Va_lNmVLN_pmpUAp]VvNV_9NlyHigh Fire Hazard Severity Zones (FHSZs). These communities are particularly susceptible because many Ua^Nm ]AJ\ LNSN_mVI]N miAJN‘ œlN-lNmVmpA_p Ja_mplqJpVa_‘ al ALNkqApN N^NlTN_Jy access. 9q]_NlAI]N iaiq]ApVa_m V_J]qLV_T ŸIqp _ap ]V^VpNL pa ’ mN_Valm‘ V_LVvVLqA]m wVpU LVmAIV]VpVNm‘ ]aw-V_Ja^NUaqmNUa]Lm‘A_LpUamNLNiN_LN_pa_N]NJplVJA]^NLVJA] NkqVi^N_p‘ SAJN mVT_VœJA_p NvAJqApVa_ A_L UNA]pU lVm\m LqlV_T wV]LœlN NvN_pm‘ especially in WUI communities with limited ingress/egress and high fuel loads. County of Los Angeles All-Hazards Mitigation Plan Page 53 of 204 Contextual Overview Very High FHSZ in LRA jurisdiction includes dense hillside residential areas under local œlNAqpUalVpylNmia_mVIV]Vpy3UNmNAlNma^NaSpUN^ampvq]_NlAI]NJa^^q_VpVNmLqN papNllAV_‘vNTNpApVa_‘A_LJa_mplAV_NLN^NlTN_JyAJJNmm lVpVJA]V_SlAmplqJpqlNVmA]maAplVm\‘wVpUwV]LœlNNxiamqlNpUlNApN_V_TœlNmpApVa_m‘]Aw N_SalJN^N_p SAJV]VpVNm‘ UamiVpA]m‘ qpV]VpVNm‘ plA_mialpApVa_ JallVLalm‘ A_L N^NlTN_Jy Ja^^q_VJApVa_mympN^mVmlqipVa_papUNmNNmmN_pVA]mNlvVJNmLqlV_TwV]Lœre events can compound vulnerabilities and delay response and recovery. For a better understanding of critical infrastructure at risk please see Appendix C. Total Facilities Affected: x 9NlyVTU!0: 120 x VTU10: 8 x 9NlyVTU10: 76 :VpUpUNJa_pV_qNLNxiA_mVa_aSLNvN]ai^N_pmV_paœlN-ila_NAlNAmUAmmVT_VœJA_p]y V_JlNAmNLwV]LœlNlVm\"A_yUa^NmV_pUN:4]AJ\ilaiNlLNSN_mVI]NmiAJNA_LœlN- lNmVmpA_pIqV]LV_T^ApNlVA]m‘^A\V_TpUN^iAlpVJq]Al]yvq]_NlAI]NLLVpVa_A]]y‘]V^Vped evacuation routes in some WUI communities create challenges for emergency lNmia_mNA_LNvAJqApVa_m1plVJpNl|a_V_T]Awm‘IqV]LV_TlNTq]ApVa_m‘A_LvNTNpApVa_ management policies are the best practices to reduce risk. 14-091%0!1303 0 %:# Supervisorial District Population in High-0Vm\ Wildfire Zones Percentage of District Population District 1 150,000 12% District 2 75,000 6% District 3 425,000 30% District 4 250,000 20% District 5 500,000 32% County of Los Angeles All-Hazards Mitigation Plan Page 54 of 204 Department/ Agency 9NlyVTU1? Ÿ!0  VTU1?Ÿ10  9NlyVTU1? Ÿ10  Animal Care and Control 1 0 1 Fire Department 39 1 14 Health Services 1 0 0 Library 7 1 2 LACMA / NHM 1 0 0 %SœJNaS Education 3 0 3 Other County %SœJNm 0 0 0 -Al\mË 0NJlNApVa_ 13 1 12 Public Health 52 4 41 Public :al\m 0 0 0 Sheriff’s Department 3 1 3 :V]LœlNmpUlNApN_NmmN_pVA]V_SlAmplqJpqlN‘V_J]qLV_T’ x Transportation: Damage to roads and bridges affects evacuation and emergency response. x Utilities’-awNl]V_Nm‘TAmiViN]V_Nm‘A_LwApNlV_SlAmplqJpqlN‘V_J]qLV_T LA^m‘AlNvq]_NlAI]NpaSVlNLA^ATN x Emergency Services: Public safety and healthcare facilities near wildfire- prone areas face operational disruptions. x Public Services’-Al\m‘]VIlAlVNm‘mJUaa]m‘A_LapUNliqI]VJAlNAmJaq]LIN lost or damaged. County of Los Angeles All-Hazards Mitigation Plan Page 55 of 204 #NwN^NlTV_TiAppNl_mmqTTNmppUApJ]V^ApNJUA_TN^AyINV_ŔqN_JV_TwV]LœlNlVm\m in Los Angeles County through: x Extending fire seasons: VmpalVJA]]y‘iNA\SVlNmNAma_aJJqllNLSla^q_N pa#avN^INl‘IqpSVlNmAlN_awmpAlpV_TA_Lburning year-round. x Increasing fuel dryness: Higher temperatures and prolonged droughts lNLqJNvNTNpApVa_^aVmpqlN]NvN]m‘^A\V_TSVlNm^alNV_pN_mN x 0AVmV_TSVlNSlNkqN_Jy’appNl‘LlVNlJa_LVpVa_mJa_plVIqpNpa^alN SlNkqN_pVT_VpVa_m‘iAlpVJq]Al]yV_:4AlNAm. Extent of Exposure x Total Area Exposed : 243.72 sq mi x Supervisorial Districts (SD) Impacted: o SD3: 117.95 sq mi (27.29%) o SD5: 95.61 sq mi (3.36%) o SD1: 16.23 sq mi (4.60%) o SD4: 9.10 sq mi (4.27%) o SD2: 4.83 sq mi (1.33%) alAINppNlvVmqA]lNilNmN_pApVa_aSpUVm:V]LœlNA|AlLwVpUV_pUN!aq_pyi]A__V_T AlNA‘i]NAmNlNSNlN_JNiiN_LVx for several Fire Hazard Severity Zone maps. 6.2.7 Impacts ^iAJpmSaliAmpœlNmvAlyLNiN_LV_Ta_ scope and severity‘V_J]qLV_TpUNA_qAly ‚€‚…œlNm‘V_J]qLV_TpUN-A]VmALNmA_LApa_VlNm‘lNmq]pNLV_wVLNmilNALLNmplqJpVa_ AJlamm !am_TN]Nm aq_py‘ Iql_V_T avNl ƒ‡‘€€€ AJlNm A_L LNmplayV_T ^alN pUA_ †‘€€€ mplqJpqlNm Ja^IV_NL‘ wVpU _NAl]y ƒ€ JVvV]VA_ SApA]VpVNm3UNmN NvN_pm JAqmNL cascading impacts mqJU Am ila]a_TNL iawNl aqpATNm‘ LNTlALNL wApNl ilNmmqlN ASSNJpV_TœlNœTUpV_TA_LlNmVLN_pVA]mqii]y‘A_LavNlwUN]^NLN^NlTN_JymNlvVJNm Transportation routes and communications infrastructure were disrupted. a^^q_VpVNm‘NmiNJVA]]yV_pUN:V]L]A_L-Urba__pNlSAJNŸ:4 ‘NxiNlVN_JNL^A[al NJa_a^VJ]ammNmLqNpapUNLNmplqJpVa_aSUa^Nm‘IqmV_NmmNm‘A_LiqI]VJSAJV]VpVNm Post-œlN UA|AlLm ]V\N LNIlVm Ŕawm A_L ]A_Lm]VLNm SqlpUNl Ja^iaq_LNLlNJavNly JUA]]N_TNm‘ wVpU wApNl V_SlAmplqJpqlN Ja_pA^V_ApVa_ A_Lsedimentation requiring N^NlTN_Jy lN^NLVApVa_ 3UN mJaiN A_L mNvNlVpy aS pUNmN œlNm q_LNlmJalN pUN increasing vulnerability of critical infrastructure and the urgent need for enhanced mitigation strategies across high-risk zones. County of Los Angeles All-Hazards Mitigation Plan Page 56 of 204 Problem Statement Many hillside communities within LRA Very High FHSZ zones face critical access and wApNlmqii]yVmmqNmLqlV_TœlNm3UNmNAlNAmaSpN_V_J]qLNATV_TmplqJpqlNmA_L_Allaw laALm‘Ja^i]VJApV_TœlNœTUpV_TA_LNvAJqApVa__vNmp^N_pmV_LNSN_mVI]NmiAJN‘]aJal JaLNN_SalJN^N_p‘A_LJa^^q_VpywV]LœlNilapNJpVa_i]A__V_TAlNvVpA]pamAvV_T]VvNm and minimizing losses. 6.2.8 Mitigation and Preparedness Los Angeles County is implementing a multi-ATN_JyAiilaAJUpa^VpVTApNwV]LœlNlVm\m Key strategies include: x Community Wildfire Protection Plans (CWPPs): Strengthening fire prevention measures in high-risk areas. x Community Preparedness: Educating residents on wildfire readiness pUlaqTUaqplNAJUJA^iAVT_m‘N^NlTN_JyA]NlpmympN^m‘A_L_NVTUIalUaaL preparedness programs. x NSN_mVI]N1iAJN0NkqVlN^N_pm’Enforcing brush clearance around structures. x Enhanced Building Codes: Promoting fire-resistant materials for new developments. x 9NTNpApVa_"A_ATN^N_p’Reducing fuel loads through prescribed burns and hazardous tree removal. x Evacuation Planning: ^ilavV_TJaalLV_ApVa_INpwNN_%"‘!1‘ !a‘A_LapUNl[qlVmLVJpVa_mpaN_mqlNJ]NAlNvAJqApVa_ia]VJVNmA_L procedures. LLVpVa_A]LNpAV]ma_pUNaq_py¯milaAJpVvNA_La_TaV_TNSSalpmpalNLqJNwV]LœlNlVm\‘ including long-pNl^ i]A__V_T‘ V_SlAmplqJpqlN UAlLN_V_T‘ A_L Ja^^q_Vpy-based V_VpVApVvNm‘Vm]aJApNLV_pUNLNLVJApNLmNJpVa_pVp]NL¬"VpVTApVa_1plApNTVNm­ 6.2.9 Summary :V]LœlNmlN^AV_a_NaSpUN^ampmVT_VœJA_pUA|AlLmV_!am_TN]Nmaq_py‘iamV_TlVm\m pa]VSN‘ilaiNlpy‘A_LJlVpVJA]V_SlAmplqJpqlN3UNNxiA_mVa_aSLNvN]ai^N_pV_pa:4 AlNAm‘V_JlNAmV_TœlNmNvNlVpyLqNpaJ]V^ApNJUA_TN‘A_La_TaV_TJUA]]N_TNmwVph NvAJqApVa_ A_L ^VpVTApVa_ lNkqVlN ilaAJpVvN‘ JaalLV_ApNL NSSalpm AJlamm ATN_JVNm 1plN_TpUN_V_TœlNilNvN_pVa_ia]VJVNm‘V^ilavV_TN^NlTN_JylNmia_mNJaalLV_ApVa_‘ A_L V_pNTlApV_T J]V^ApN ALAipApVa_ ^NAmqlNm AlN NmmN_pVA] pa N_UA_JV_T wV]LœlN resilience for Los Angeles County. County of Los Angeles All-Hazards Mitigation Plan Page 57 of 204 6.3 Earthquake 6.3.1 Nature Earthquakes occur due to the sudden release aSN_NlTyV_pUNAlpUµmJlqmp‘TN_NlApV_T seismic waves that cause ground shaking. 3UNmNNvN_pm‘aSpN_plVTTNlNLIy^avN^N_p A]a_TSAq]p]V_Nm‘vAlyV_V_pN_mVpyLNiN_LV_T a_SAJpalmmqJUAm^AT_VpqLN‘LNipU‘A_L proximity to populated areas. In addition to pUNV_VpVA]mUA\V_T‘mNJa_LAlyUA|AlLmmqJUAm mqlSAJN SAq]pV_T‘ ]VkqNSAJpVa_‘ ]A_Lm]VLNm‘ tsunamis‘ A_L ASpNlmUaJ\m JA_ walmN_ pUN LA^ATN !am _TN]Nm aq_py‘ ]aJApNL V_ A UVTU]yAJpVvNmNVm^VJlNTVa_‘SAJNmmVT_VœJA_p risks from thNmN_ApqlA]NvN_pm‘_NJNmmVpApV_T extensive mitigation efforts and preparedness planning. x The most common effects of NAlpUkqA\Nm V_J]qLN vVa]N_p mUA\V_T‘ mplqJpqlA]LA^ATN‘A_LLVmlqipVa_mpaV_SlAmplqJpqlN x 1NJa_LAlyNSSNJpmJA_V_J]qLN‘IqpAlN_ap]V^VpNLpa‘qpV]VpVNmaqpATNm‘plASSVJ Ja_TNmpVa_A_LplA_mialpApVa_mympN^mINV_TV^iAmmAI]N‘A_LA_V_JlNAmNaSSVlN lVm\m‘Sla^Ila\N_TAmA_LwApNl]V_Nm CouCCCCouCouCouCouCouCououououCouCoCooouCuntnntntyntytytyntynnnnnnnnn ofoffoffof LoLoLos As As As As A AAAAs AsAs As As Angengengengeeeengengegengengengengengegengegengeeeegeengengeengengeggengngennnglesleslesesleslesesleslesleslesleslesslesesleslesslesessesleseseslsseseeesees AllAllAAllAllAllAllAllAllAlllAllAlAlAlllAllAAAllAllAlAlAAl------------HazazHazHazHazHazHazazzHazHazHazazHazHazazHaHaHazHazHazazazHazazHazHazazzzzzHaardardardardardardardardardardardardrdardardardardrdardarddarddardaaardaardaarddardarddrdrdardardrdaa MsMsMsMsMsMsMsMsMsMMsMMsMsMMsMsMsMsMsMsMsMMsMs MMMs MMs Ms MsMsMs MssMsss Msitiitiiiitiititiiiitiiititiitiitititiitttttitittiititittitiiitiitiggatgatttgatattgattgatgatggagatgatgatgatttgggatgagatttgattataggagiiiionionnioniononiononionioniononniiononnnioonnnooonioonniioionnio aPlaPlalaPlaPlaaPlaPlaaPllPlPlaPlalPPlaPlaPlaPllPlPlPlPlPlPlPlaPlaPlaaPPlaPlaPlPaaPlaPllaPlnnnnnnnnnnnnnnnnn County of Los Angeles All-Hazards Mitigation Plan Page 58 of 204 x AlpUkqA\NmaJJqlwVpU]Vpp]Npa_awAl_V_T‘^A\V_TilNiAlNL_NmmNmmN_pVA]Sal minimizing loss of life and property. 6.3.2 Location !am_TN]Nmaq_pyVma_NaSpUN^ampmNVm^VJA]]yAJpVvNlNTVa_mV_pUN4_VpNL1pApNm‘ with multiple active fault systems capable of generating destructive earthquakes. Major faults include: x San Andreas Fault – Capable of M 8.0+ x Newport-Inglewood Fault – M 7.4 x Malibu Coast Fault System – M 6.7 x San Fernando Fault – M 6.6 x Santa Monica Fault – M 7.0 x Whittier Fault – M 7.2 x Sierra Madre Fault – M 6.0-7.0 For a better visual representation of this Earthquake Hazard within LA County planning AlNA‘i]NAmNlNSNlN_JNiiN_LVxfor earthquake fault maps. 6.3.3 Extent JJalLV_Tpa41Na]aTVJA]1qlvNy‘pUNlNAlNpwapyiNmaSNAlpUkqA\N^NAmqlN^N_pm‘ magnitude (Mw) and intensity (i). Magnitude is a measure of the energy released at the source of the earthquake. Intensity scale help measure impact on people and structures. AlpUkqA\NV^iAJpVmIAmNLa_^AT_VpqLNmJA]NVmAmSa]]awm: x Great—"wÁˆ‘ x Major—Mw = 7.0 – 7.9 x Strong—Mw = 6.0 – 6.9 x Moderate—Mw = 5.0 – 5.9 x Light—Mw = 4.0 – 4.9 x Minor—Mw = 3.0 – 3.9 x Micro—Mw < 3 County of Los Angeles All-Hazards Mitigation Plan Page 59 of 204 "aLVœNL"Nlcalli Intensity 1JA]NVmSla^pa;‘wUVJUlNSNlm‘Am_apSN]pA_L;Am extreme. Figure 6.3.1 "aLVœNL"Nlcalli Intensity Scale Over 75% of unincorporated Los Angeles County is at risk for severe to extreme shaking in a future earthquake. 3UNlNTVa_µmLN_mNqlIA_N_vVla_^N_p‘Ja^IV_NLwVpUATV_TV_SlAmplqJpqlN‘V_JlNAmNm the likelihood of extensive damage and prolonged recovery times. Faults running beneath critical V_SlAmplqJpqlNJallVLalm‘V_J]qLV_TSlNNwAymA_LiawNl TlVLm‘iamNAmVT_VœJA_ppUlNAppaiqI]VJmASNpyA_LNJa_a^VJmpAIV]Vpy of the planning area. County of Los Angeles All-Hazards Mitigation Plan Page 60 of 204 6.3.4 History !am_TN]Nmaq_pyUAmA]a_TUVmpalyaSLNmplqJpVvNNAlpUkqA\Nm‘wVpUma^NaSpUN earliest recorded events dating back to the early 19th century. The San Juan Capistrano AlpUkqA\N aS ˆ‚ Ÿ" ‡…  wAm A^a_T pUN œlmp pa IN LaJq^N_pNL‘JAqmV_TpUN collapse aS"VmmVa_1A_qA_AiVmplA_aA_LlNmq]pV_TV_„€SApA]VpVNm%vNlpUNyNAlm‘ pUNJaq_pyUAmNxiNlVN_JNL_q^NlaqmmVT_VœJA_pkqA\Nm‘V_J]qLV_TpUNLNvAmpApV_T ˆ…‡alp3N[a_AlpUkqA\NŸ"‡‰ ‘pUN‰‡1A_Nl_A_LaAlpUkqA\NŸ"†† ‘A_L the infamous ‰‰„#alpUlVLTNAlpUkqA\NŸ"†‡ ‘wUVJUJAqmNLIV]]Va_mV_LA^ATNm and led to widespread infrastructure failures. There have been no federal declarations or state proclamations for earthquakes V_pUN]AmpœvNyNAlm "A[alAlpUkqA\NmV_!am_TN]Nmaq_pyŸˆ‚– Present) Date Magnitude Name / Location Notable Impact NJN^INlˆ‘ 1812 7.5 San Juan Capistrano Earthquake Destroyed Mission San Juan AiVmplA_a‘\V]]NL„€iNai]N NJN^INl‚‘ 1812 7.1 West Ventura Earthquake AqmNLmVT_VœJA_pmUA\V_TV_ Southern California. A_qAly‰‘ˆ…‡ 7.9 Fort Tejon Earthquake Largest earthquake on the San _LlNAmAq]p“lqipqlNL‚‚… miles. q]y‚‘‰…‚ 7.5 Kern County Earthquake Strong shaking felt in Los _TN]Nm“^A[alLA^ATNpa A\NlmœN]L NIlqAly‰‘‰‡ 6.6 San Fernando Earthquake †…LNApUm‘¸……ƒ^V]]Va_V_ LA^ATNm‘Ja]]AimNaS9NpNlA_m Hospital. %JpaINl‘‰ˆ‡ 5.9 Whittier Narrows Earthquake ˆLNApUm‘‚€€V_[qlVNm‘¸ƒ…ˆ million in damages. NIlqAly‚ˆ‘ 1990 5.7 Upland Earthquake ƒ€V_[qlVNm‘¸‚‡^V]]Va_V_ damages. County of Los Angeles All-Hazards Mitigation Plan Page 61 of 204 6.3.5 Probability Trends in Seismic Activity Over 163 earthquakes of M 5.0 or greater have been recorded in Southern California since 1812. 3UN1A__LlNAmAq]plN^AV_mpUNTlNApNmpmNVm^VJUA|AlL‘wVpUA…‰ÈJUA_JNaSA_" 6.7+ event in the next 30 years. qpqlNAlpUkqA\N%JJqllN_JN The U.S. Geological Survey (USGS) estimates the following probabilities for a major earthquake in Los Angeles County in the next 30 years: x 60% chance of an M 6.7+ earthquake x 46% chance of an M 7.0+ earthquake x 31% chance of an M 7.5+ earthquake 6.3.6 Vulnerability 3UN Jaq_py¯m vq]_NlAIV]Vpy pa NAlpUkqA\Nm NxpN_Lm INya_L iUymVJA] V_SlAmplqJpqlN‘ ASSNJpV_TVpmlNmVLN_pmA_LNmmN_pVA]mNlvVJNm%]LNlIqV]LV_Tm‘iAlpVJq]Al]yq_lNV_SalJNL masonry and soft-mpaly mplqJpqlNm‘ AlN Ap UVTU lVm\ aS Ja]]AimN‘ iamV_T mVT_VœJA_p q_N‚ˆ‘‰‰ 5.6 Sierra Madre Earthquake LNApU‘€€½V_[qlVNm‘¸„€ million in damages. A_qAly‡‘‰‰„ 6.7 Northridge Earthquake …‡LNApUm‘ˆ‘‡€€V_[qlVNm‘¸„€ IV]]Va_V_LA^ATNm‘SlNNwAym collapsed. q]y‚‰‘‚€€ˆ 5.5 Chino Hills Earthquake ˆV_[qlVNm‘^V_almplqJpqlA] damage. "AlJU‚ˆ‘‚€„ 5.1 La Habra Earthquake NwV_[qlVNm‘¸€^V]]Va_V_ damages. q]y†‘‚€‰ 7.1 Ridgecrest Earthquake Widespread damage in 1aqpUNl_A]VSal_VA‘ infrastructure impacts. County of Los Angeles All-Hazards Mitigation Plan Page 62 of 204 dangers to residents and businesses. 1NVm^VJlNplaœppV_T‘NAl]ywAl_V_TmympN^m‘A_L mplVJpNlIqV]LV_TJaLNmUAvNV^ilavNLlNmV]VN_JN‘Iqp vulnerabilities remain in older structures and critical infrastructure. lVpVJA]_SlAmplqJpqlNAp0Vm\ x Highways, bridges, and transportation routes: A major earthquake could mNvNlN]yLVmlqip^aIV]Vpy‘shipment of goods and services while also delaying emergency response and evacuations. "A[alUVTUwAymmqJUAm‘Iqp_ap]V^VpNL to the I-…‘-€‘41-€‘-†€‘-„‘-„€…‘-‡€‘A_L-105 could be impacted. x Energy grids and water system: Disruptions could leave millions without power and clean water. x Hospitals and emergency services: ƒ‚…UamiVpA]mA_L‘‚‰‰œlNmpApVa_mV_pUN Los Angeles County could suffer functional impairments. x Unreinforced masonry and soft-story buildings: Many older structures are highly susceptible to collapse during strong ground shaking. aq_py1iNJVœJlVpVJA]AJV]VpVNmSSNJpNL’ x Fire Department: 314 facilities (93.18%) x Public Works: 201 facilities (87.39%) x Health Services: 56 facilities (85.71%) x Public Health: 37 facilities (92.50%) x Libraries: 78 branches (89.66%) x Parks: 179 (97.79%) x Education: 70 (85.37%) !am_TN]Nmaq_py]VNmAppUNV_pNlmNJpVa_aS^q]pVi]N^A[alSAq]p]V_Nm‘V_J]qLV_TpUN 1A__LlNAmAq]pJJalLV_TpapUNUA|AlL^AplVx‘pUNlVm\aSvVa]N_pTlaq_LmUA\V_TVm ilNvA]N_p Jaq_pywVLN‘ iAlpVJq]Al]y V_ qlIA_ JN_pNlm A_L lNTVa_m wVpU JlVpVJA] infrastructure. The potential consequences of violent seismic shaking include wVLNmilNALmplqJpqlA]LA^ATN‘LVmlqipVa_aSmNlvVJNm‘NJa_a^VJ]ammNm‘A_LUq^A_ casualties. -aiq]ApVa_mAp0Vm\ x The THIRA estimates over 2 ^V]]Va_lNmVLN_pmJaq]LINmVT_VœJA_p]yV^iAJpNLV_ A^A[almNVm^VJNvN_p‘iAlpVJq]Al]ypUamNV_UVTU-risk seismic zones. County of Los Angeles All-Hazards Mitigation Plan Page 63 of 204 x People Experiencing Homelessness (PEH) populations: ‡…‘€€€½ unhoused individuals in Los Angeles County live in areas at risk of violent shaking. x Low-income and individuals with access and functional needs (AFN): For more details on impacted population please see Section 5. Extent of Exposure x Total Area Exposed ’ƒ‘€„‰mk^V x Supervisorial Districts (SD) Impacted: o SD5’‘‰…€‡ˆmk^VŸ†‰…€È  o SD3: 379.41 sq mi (87.99%) o SD1: 349.17 sq mi (98.95%) o SD2: 362.95 sq mi (99.99%) o SD4: 210.92 sq mi (99.10%) 6.3.7 Impacts Los Angeles County has a long history of experiencing damaging earthquakes due to Vpm]aJApVa_A]a_T^q]pVi]NAJpVvNSAq]pmympN^m‘V_J]qLV_TpUN1A__LlNAm‘#Nwialp- _T]NwaaL‘A_L:UVppVNlSAq]pmVmpalVJNAlpUkqA\NmmqJUAmpUN‰‡1A_Nl_A_La (M6.6) and 1994 Northridge (M6.7) events caused catastrophic losses. The San Nl_A_LaNAlpUkqA\NlNmq]pNLV_†…LNApUm‘pUNJa]]AimNaSUamiVpA]mplqJpqlNm‘A_L avNl¸……€^V]]Va_V_LA^ATNm‘wUV]NpUN#alpUlVLTNNAlpUkqA\NJAqmNL…‡LNApUm‘ ^alNpUA_ˆ‘‡€€V_[qlVNm‘A_LA_NmpV^ApNL¸„€IV]]Va_V_NJa_a^VJ]ammNm‘V_J]qLV_T widespread infrastructure failures such as collapsed freeways and damaged utility systems. Impacts from future major seismic events are projected to be even more severe due to iaiq]ApVa_LN_mVpy‘ATV_TV_SlAmplqJpqlN‘A_LV_JlNAmV_TLNvN]ai^N_pV_mNVm^VJA]]y vulnerable areas. Over 75% of unincorporated Los Angeles County is at risk of severe to extreme ground shaking. Current estimates suggest that a large-magnitude NAlpUkqA\NJaq]LLVmi]AJNqipa‚‚^V]]Va_iNai]N‘V_[qlNal\V]]pUaqmA_Lm‘A_LlNmq]p V_avNl¸‚€€IV]]Va_V_Ja^IV_NLNJa_a^VJ]ammNm‘V_J]qLV_T¸ƒIV]]Va_V_ilaiNlpy LA^ATNA_L¸†ˆIV]]Va_V_IqmV_NmmV_pNllqipVa_m County of Los Angeles All-Hazards Mitigation Plan Page 64 of 204 3UN aq_py¯m JlVpVJA] mympN^m“ iawNl‘ wApNl‘ plA_mialpApVa_‘ UNA]pUJAlN‘ A_L Ja^^q_VJApVa_m‘AlNNmiNJVA]]yvq]_NlAI]N^A[alNAlpUkqA\NJaq]LV^iAVlqipaƒ‚… UamiVpA]m A_L ‘‚‰‰ œlN mpApVa_m A_L LVmlqip JlVpVJA] V_SlAmplqJpqlN Sal ^V]]Va_m Population mwVpUUNVTUpN_NLvq]_NlAIV]VpyV_J]qLNpUN‡…‘€€€½iNai]NNxiNlVN_JV_T Ua^N]Nmm_Nmm‘ pUamN wVpU AJJNmm A_L Sq_JpVa_A] _NNLm‘ A_L lNmVLN_pm aS a]LNl‘ unreinforced masonry and soft-story structures. :VpUaqpmqSœJVN_p^VpVTApVa_‘ASqpqlNNAlpUkqA\NJaq]LlNmq]pV_JAmJALV_TSAV]qlNm across multiple sectors and prolong the County’s recovery for years. These risks UVTU]VTUp pUN qlTN_Jy Sal Ja_pV_qNL V_vNmp^N_p V_ mNVm^VJ lNplaœppV_T‘ mplVJpNl enforcemN_paSIqV]LV_TJaLNm‘NxiA_LV_TmpApNwVLNNAl]ywAl_V_TmympN^m‘ A_L equitable preparedness programs targeting at-risk vulnerable populations. x Casualties and injuries: NiN_LV_Ta_pUNpV^NaSLAyA_L]aJApVa_‘pUaqmA_Lm could be injured or killed in a severe earthquake. x Economic disruption: mVT_VœJA_pNAlpUkqA\NJaq]LUA]pIqmV_NmmaiNlApVa_m‘ LA^ATNmqii]yJUAV_m‘A_LSalJNpUaqmA_LmV_paq_N^i]ay^N_p x Housing displacement: _NmpV^ApNL‚‚^V]]Va_lNmVLN_pmJaq]LINLVmi]AJNL‘ with tens of thousands requiring emergency sheltering. Economic Impact A major earthquake in Los Angeles County Jaq]LlNmq]pV_avNl¸‚€€IV]]Va_V_NJa_a^VJ ]ammNm‘ wVpUApapA]aS¸ˆplV]]Va_-dollar exposure. Losses can include: x ¸†ˆIV]]Va_V_IqmV_NmmV_pNllqipVa_m x ¸…IV]]Va_V_]ampNJa_a^VJAJpVvVpy x ¸ƒIV]]Va_V_ilaiNlpyLA^ATNm Problem Statement The pervasive exposure of Los Angeles County to violent earthquake shaking presents AmympN^VJpUlNAppaiqI]VJmASNpy‘NJa_a^VJmpAIV]Vpy‘A_LNmmN_pVA]mNlvVJNm#NAl]yA]] major departments and infrastructure elements are located within high-shaking hazard |a_Nm3UN NxpN_mVvN lNAJU AJlamm A]] œvN 1qiNlvVmalVA] VmplVJpm Ÿ1  A^i]VœNm pUN JUA]]N_TN‘ UVTU]VTUpV_T pUN qlTN_p _NNL Sal lNplaœppV_T‘ iqI]VJNLqJApVa_‘ ilNiAlNL_NmmilaTlA^m‘A_LlNmV]VN_pLNmVT_ia]VJVNmAV]qlNpaALLlNmmpUVmUA|AlL could lead to catastrophic loss of life and functionality in the event of a major seismic event. County of Los Angeles All-Hazards Mitigation Plan Page 65 of 204 6.3.8 Mitigation and Preparedness Efforts to reduce earthquake risks in Los Angeles County include strengthening IqV]LV_T JaLNm‘ N_UA_JV_T N^NlTN_Jy ilNiAlNL_Nmm‘ A_L lNplaœppV_T vq]_NlAI]N structures. NyNSSalpmpa^VpVTApNNAlpUkqA\NlVm\mV_J]qLN’ x 1plN_TpUN_V_TIqV]LV_TJaLNmA_LN_SalJV_TlNplaœppV_T]Awm x Upgrading critical infrastructure x Expanding public education and early warning systems x Enhancing emergency response planning y ilaAJpVvN]y V^i]N^N_pV_T pUNmN ^NAmqlNm‘ !am_TN]Nm aq_pyAV^m pa lNLqJN JAmqA]pVNm‘V_SlAmplqJpqlNLA^ATN‘A_LNJa_a^VJ]ammNmV_SqpqlNmNVm^VJNvN_pm 1NVm^VJ0NplaœppV_T-laTlA^m x 1aSpmpalylNplaœpilaTlA^: Mandates seismic upgrades for older apartment buildings. x Non-LqJpV]NJa_JlNpNIqV]LV_TlNplaœpm: Strengthens older commercial and residential structures. x amiVpA]m A_L N^NlTN_Jy SAJV]VpVNm lNplaœppV_T: Ensures critical services remain operational post-earthquake. -a]VJyA_L0NTq]Apaly"NAmqlNm x Assembly Bill (AB) 1857: Strengthens building standards for multi-story structures. x AB 2681: Requires cities and counties to inventory vulnerable buildings. x Updated California Building Code (CBC): Enforces stricter seismic design criteria for new construction. x Public Education: 3NAJUV_Tpalai‘avNlA_La]L%_“pUNUaqmNUa]L ilNiAlNL_NmmJUNJ\]Vmp‘NLqJApNlNmVLN_pma_N^NlTN_JylNmia_mN‘lNplaœppV_T‘ and disaster preparedness. x Early Warning/ ShakeAlert System: Provides real-time earthquake early warnings to residents via mobile alerts and public messaging. x Public earthquake drills: Annual Great California ShakeOut encourages preparedness. County of Los Angeles All-Hazards Mitigation Plan Page 66 of 204 6.3.9 Summary !am_TN]Nmaq_pylN^AV_mApUVTUlVm\SalLNvAmpApV_TNAlpUkqA\Nm‘wVpUmJVN_pVœJ ila[NJpVa_mV_LVJApV_TAmpla_T]V\N]VUaaLaSAmVT_VœJA_pmNVm^VJNvN_pV_pUNJa^V_T LNJALNm 3UN lNTVa_ UAm NxiNlVN_JNL _q^Nlaqm UVmpalVJ NAlpUkqA\Nm‘ A_L pUN potential for future large-scale disasters remains ever-present. While advances in N_TV_NNlV_T‘ N^NlTN_Jy ilNiAlNL_Nmm‘ A_L ^VpVTApVa_ NSSalpm UAvN V^ilavNL lNmV]VN_JN‘ JUA]]N_TNm iNlmVmp‘ iAlpVJq]Al]y lNTAlLV_T ATV_T V_SlAmplqJpqlN A_L vulnerable communities. ConpV_qNLV_vNmp^N_pmV_lNplaœppV_T‘iqI]VJNLqJApVa_‘A_L NAl]ywAl_V_TmympN^mwV]]INJlVpVJA]V_^V_V^V|V_TJAmqA]pVNm‘NJa_a^VJ]ammNm‘A_L recovery challenges in future earthquakes. County of Los Angeles All-Hazards Mitigation Plan Page 67 of 204 CouCouCouCouCCouCouCouCououCoCouCouCouCououCououCouCouCouCouCouCouCouCououCouuCCooCouCouCouCououCoCoCouCoCoCouCCCouCCoouuCCoooCoCoCCounnntntyntynntyntyntntyntyntytyntyntyntyntytyntyntyntyntyynnntyntyntynntytyntyntyntytnntynntntyntyntntyyntntnntyyntntytyyntyntyynntynnnnntynnynnttyttyyyyyyyy ofofofofofofoffofofofofoffofofofoofoofofofofofoofofofoffofofofofofofffofofofoffofofoooofooooofofofofoffofffofofooooof LoLoLoLLoLoLoLoLoLoLoLoLLoLoLLooLoLoLoLLoLoLoLLoLLoLLoLoLoLoLoLoLoLooLooLoLLoLoLooLoLooLLLooLooooLoLLLoLoLoLLLLooLooLoooLLLoLLoooLooooLLoLoooLLooLLLooLoLLLLLoLLLs As As Ass s As AAs As As As As As AsAsAsAsAsAsAAs As s As AAAAsAs AAs As As As As A As As As As As AsAAs As As Ass sAs As AAsAsAss AsAs AssAAs AssAsAsAss AssAss AssAAAAAss AAAnnggeengnnnnnnnnnnnnnnnnnnnnnles AlAlAlAlAAAlAllAAlAllAllAlAlAllAllAAlAllAAllAAAAllAllAAAAAllAllAAAAAlAlAllAlAllAllAllAllAllAAAAAlAlAlAlAAAllAllAAAAAlAllAAAAllAAlAAAAAAAAAlAAlAAllAAAllAAAlAllAAlAAlAAllA-------------HaHaHHHazHHHazHaHaazHazHazHazHazHazHazHazzHazHazHazHazHazHazHazHazHazzzHaHHazazHazHHaHazazHHazHHHHzHazHazzzzzHaHazzHHHHHazHazHHHaaHHaazzzHHazzHHHHzHHaHHazzazHHHHHHHHaazHHaaazzardardardardardardardardardarardaraardardardardardaardardrdardardrdardarddardardaardardardardardardrardarrrarardarrarrddardardrrdardardrrrrrrdddrdrdarddrdrardardaaaaaraaaadaas Ms Ms MMs Ms Ms Ms Ms sMsMsMsMsMsMsMs MssMs MMsMsMsMsMs MsMsMssMsMsMsMs Ms MMs Ms MMsMsMsMMsMMMMMs MMMMMMMs MMMMMMMMMMMMMMMMMMMMMMsMMMMMMMMMMMsMMMsMMMMMsMMMMMMMMMiitiititiitiitiiitiitittitiittitttitittitittittttitititiiititiiititittitiitttiitttiittitittttittttiiitiitgagatgatgatattgatgagaggionionon PlaPln 6.4 Extreme Heat 6.4.1 Nature Extreme heat refers to prolonged periods of UVTU pN^iNlApqlNm‘ aSpN_ AJJa^iA_VNL Iy UVTUUq^VLVpy‘iamV_TmVT_VœJA_pUNA]pUlVm\m such as heat exhaustion and heat stroke. The urban heat island (UHI)NSSNJp‘ ilNvA]N_p V_ LN_mN]yIqV]pAlNAm]V\N!am_TN]Nmaq_py‘ V_pN_mVœNmpUNmNJa_LVpVa_mIyAImalIV_T and retaining heat. The changing climate conditions through time in the region exacerbate for the rising of daily temperature and for the increasing of extreme heat days in the County. This leads pa UNA]pU VmmqNm‘ inJlNAmN N_NlTy LN^A_L‘ A_L mplAV_ a_ infrastructure. 6.4.2 Location Los Angeles County is particularly susceptible to extreme heat due to its diverse geography and urban density. ]]aS!am_TN]Nmaq_py^AyNxiNlVN_JNNxplN^NUNAp‘ nonetheless i_]A_LlNTVa_m‘V_J]qLV_TpUNvA]]NymA_LUVTULNmNlpAlNAmNxiNlVN_JN County of Los Angeles All-Hazards Mitigation Plan Page 68 of 204 higher temperatures compared to coastal areas.The urban heat island (UHI) effect can increase temperatures in cities and developed areas than the less developed areas. Urban centers with extensive concrete and asphalt surfaces further amplify heat lNpN_pVa_‘Ja_plVIqpV_TpaN]NvApNLpN^iNlApqlNm and increased UHI effect in the county. 6.4.3 Extent The severity of heat events in Los Angeles County has been increasing. Projections V_LVJApNAmVT_VœJA_plVmNV_pUNSlNkqN_JyA_LV_pN_mVpyaSUNApwAvNm‘wVpUV_]A_LAlNAm potentially experiencing temperatures exceeding 110°F. The urban heat island effect JA_JAqmNqlIA_AlNAmpaINmNvNlA]LNTlNNmwAl^NlpUA_pUNVllqlA]Jaq_pNliAlpm‘ exacerbating the impact of heat waves. The chart below shows the levels of heat wave impacts qmNL pa ^NAmqlN UNApwAvN mNvNlVpy NAp0Vm\‘ A_ NxiNlV^N_pA] ^NAmqlN developeLIypUN#:1V_Ja]]AIalApVa_wVpUpUN‘J]AmmVœNmUNApNvN_pmIypUNVl impact on human health. It ranges from Green (0) which is little or no risk to Magenta Ÿ„ ‘wUVJU^NA_mNxplN^NUNApwVpU_aavNl_VTUplN]VNS Category Figure 6.4.1 0Vm\aSNAp-0N]ApNL^iAJpm lNN_ 0 Little to no risk from expected heat. Yellow 1 Minor - This level of heat affects primarily those individuals extremely mN_mVpVvNpaUNAp‘NmiNJVA]]ywUN_aqpLaalmwVpUaqpNSSNJpVvNJaa]V_TA_Lal adequate hydration. Orange 2 Moderate - This level of heat ASSNJpm ^amp V_LVvVLqA]m mN_mVpVvN pa UNAp‘ especially those without effective cooling and/or adequate hydration. Impacts possible in some health systems and in heat-sensitive industries. 0NL 3 Major - This level of heat affects anyone without effective cooling and/or ALNkqApNUyLlApVa_^iAJpm]V\N]yV_ ma^NUNA]pUmympN^m‘UNAp-sensitive industries and infrastructure. Magenta 4 Extreme - This level of rare and/or long-duration extreme heat with little to no overnight relief affects anyone without effective cooling and/or adequate UyLlApVa_^iAJpm]V\N]yV_^ampUNA]pUmympN^m‘UNAp-sensitive industries and infrastructure. EĂƟŽŶĂůtĞĂƚŚĞƌ^ĞƌǀŝĐĞ ;Et^Ϳ, 2024 County of Los Angeles All-Hazards Mitigation Plan Page 69 of 204 qTqmp‘INV_TpUNUappNmp^a_pUaSpUNyNAlpUAppUNi]A__V_TAlNANxiNlVN_JNmpUN Figure 6.4.2 IN]awmUawm‘pUNAvNlATNUVTUpN^iNlApqlNSalqTqmp‚€‚„V_!am _TN]Nmaq_pymmUaw_‘pUNpN^iNlApqlNvAlVNmIy]aJApVa_IqplN^AV_mUVTUNl than average monthly temperature. Figure 6.4.2͕DĞĂŶDĂdždĞŵƉĞƌĂƚƵƌĞĨŽƌƵŐƵƐƚϮϬϮϰ͕EĂƟŽŶĂůtĞĂƚŚĞƌ^ĞƌǀŝĐĞ 6.4.4 History NJAqmN aS pUN JUA_TV_T J]V^ApN Ja_LVpVa_m A_L pUN TNaTlAiUVJA]]aJApVa_‘!am Angeles County has been experiencing extreme heat waves in the past years. It has a UVmpalyaSNxplN^NUNApNvN_pm‘wVpUpN^iNlApqlNmSlNkqN_p]ylNAJUV_T€€LNTlNNmal ^alN‘NmiNJVA]]yLqlV_TpUNmq^^Nl^a_pUm_ma^NJAmNm‘pUNmNNxplN^NUNApNvN_pm are record-breaking heat waves surpassing their all-time highs. Extreme Heat events include: x August 2020:mNvNlNUNApwAvN]NLpawVLNmilNALiawNlaqpATNm‘ASSNJpV_T _NAl]y…€€‘€€€lNmVLN_pm County of Los Angeles All-Hazards Mitigation Plan Page 70 of 204 x September 2020:The San Fernando Valley recorded a record high temperature of 121°F. x August 2022:A record-breaking heatwave in late summer exceeded 100°F x September 2024:A severe September heatwave pushed temperatures 10- ‚€ÑAIavN_al^A]‘UVppV_T€‰ÑV_!a_T NAJU The History of Extreme heat events highlight the increasing trend of extreme heat occurrences in the region. There have been no federal declarations or state ilaJ]A^ApVa_m Sal NxplN^N UNAp V_ pUN ]Amp œvN yNAlmEven though there were no LNJ]AlNLNxplN^NUNApN^NlTN_JVNm‘pUNJaq_pyUAmVmmqNLmNvNlA]UNApA]NlpmA_L taken measures to protect residents from the impacts of heat waves during these periods. 6.4.5 Probability xplN^NUNApNvN_pmAlNA_A__qA]aJJqllN_JNV_!am_TN]Nmaq_py‘pUaqTUmNvNlVpy aSmqJUNvN_pmvAlyiNlyNAlIAmNLa_apUNlJa_LVpVa_m‘mqJUAm]#V ño. Climate models project a substantial increase in the likelihood of extreme heat events in Los Angeles County. By mid-JN_pqly‘pUNJaq_pyJaq]LNxiNlVN_JN^alNpUA_œvN^A[alUNApwAvNm A__qA]]y‘ wVpU ma^N ^aLN]m mqTTNmpV_T qi pa pN_Sa]L V_JlNAmNm V_ SlNkqN_Jy3UVm heightened probability necessitates proactive mitigation and adaptation strategies. Figure 6.4.3,ǀĞƌĂŐĞdĞŵƉĞƌĂƚƵƌĞϭϵϬϬ-2025, NOAA, NCEI, 2025. 6.4.6 Vulnerability xplN^NUNApiamNmAmVT_VœJA_pA_LTlawV_TpUlNAppa!am_TN]Nmaq_py‘wUNlN lVmV_TpN^iNlApqlNm‘qlIA_UNApVm]A_Lm‘A_LwVLNmilNALmaJVA]vq]_NlAIV]VpyV_pNlmNJp 3UamN^ampAplVm\V_J]qLNpUNN]LNl]y‘]aw-V_Ja^NUaqmNUa]Lm]AJ\V_TAVlJa_LVpVa_V_T‘ County of Los Angeles All-Hazards Mitigation Plan Page 71 of 204 iNai]NNxiNlVN_JV_TUa^N]Nmm_NmmŸ- ‘V_LVvVLqA]mwVpUAJJNmmA_LSq_JpVa_A]_NNLm Ÿ# ‘A_LpUNaq_py¯m]AlTNiaiq]ApVa_aSaqpLaalA_L_a_-air-conditioned indoor workers. Infrastructure is also strained“N]NJplVJVpyLN^A_LmiV\NmLqlV_TUNApwAvNm‘ often overwhelming the power grid and triggering outages. Water systems experience V_JlNAmNLLN^A_LA_LNvAialApVa_]ammNm‘wUV]NlaALwAymA_LlAV]]V_NmAlNmqI[NJppa buckling or operational delays. In recent yNAlm‘!am_TN]Nmaq_pyUAmNxiNlVN_JNL severNJa_mNkqN_JNmSla^ila]a_TNLUNApNvN_pm‘lNV_SalJV_TpUNqlTN_p_NNLSalUNAp resilience strategies targeting both people and critical services. Los Angeles County–1iNJVœJ^iAJpmA_LApA x „‰‘†€€ lNmVLN_pm NxiNlVN_JNL iawNl aqpATNm LqlV_T pUN qTqmp ‚€‚€ heatwave. x ‰†ÈaSpUNaq_py¯m‘€€€^V]NmaSUVTU-voltage transmission lines are exposed to moderate to high extreme heat risk. x ‡ ^V]]Va_ lNmVLN_pm AlN Ja_mVLNlNL UVTU]y vq]_NlAI]N LqN pa ATN‘ V_Ja^N‘ LVmAIV]Vpy‘alJUla_VJUNA]pUJa_LVpVa_m x %vNlƒ€€‘€€€aqpLaalwal\NlmAlNApN]NvApNLlVm\SalUNAp-related illness and injury. x Thousands of heat-related emergency visits occurred during multi-day heat events in 2020 and 2022“especially in neighborhoods with limited shade and high surface temperatures. x 50+ cooling centers have been activated across the County during recent heatwaves to support at-risk populations. x VTU UNAp Ja_plVIqpNm pa walmN_NL AVl kqA]Vpy‘ V_JlNAmNL wV]LœlN m^a\N NxiamqlN‘ A_L NJa_a^VJ ]ammNm LqN pa V_SlAmplqJpqlN LA^ATN‘ ilaLqJpVvVpy LNJ]V_N‘A_LlVmV_TUNA]pUJAlNJampm 6.4.7 Impacts !am_TN]Nmaq_pyUAmSAJNLmVT_VœJA_pA_LTlawV_TV^iAJpmSla^ NxplN^N UNApwAvNmavNlpUNiAmppwaLNJALNm_qTqmp‚€‚€‘Aila]a_TNLUNApwAvNJAqmNL la]]V_T I]AJ\aqpm ASSNJpV_T _NAl]y …€€‘€€€ Jqmpa^Nlm‘ avNlwUN]^NLpUNmpApN¯m N]NJplVJA]TlVL‘A_LSarced the activation of emergency conservation protocols. That mA^Nmq^^Nl‘pUN1A_Nl_A_La9A]]NyUVp‚Ñ‘]NALV_TpawVLNmilNALmplAV_a_ County of Los Angeles All-Hazards Mitigation Plan Page 72 of 204 HVAC systems and increased emergency room visits for heat-related illnesses. The 2022 and 2024 heatwaves brought similar conditions—temperatures over 100°F across pUNlNTVa_]NLpa]aJA]V|NLplA_mSal^NlSAV]qlNm‘AmiUA]pIqJ\]V_T‘A_LmplAV_a_wApNl delivNlymympN^mLqNpaN]NvApNLLN^A_LqlV_TpUNmNNvN_pm‘aqpLaalwal\Nlm‘pUN N]LNl]y‘A_L]aw-income residents without access to cooling systems were among the ^ampASSNJpNLJa_a^VJAJpVvVpywAmLVmlqipNL‘wVpUlNialpmaS IqmV_Nmm J]amqlNm‘ service delaym‘A_LV_JlNAmNLUNA]pUJAlNJampm_‚€‚„‘!a_T NAJUlNAJUNLAlNJalL €‰Ñ‘JAqmV_TAmiV\NV_N]NJplVJVpyLN^A_LA_LplVTTNlV_TN^NlTN_JyN_NlTyA]Nlpm across Southern California. Heat-related deaths and hospitalizations have also trended qiwAlL‘ iAlpicularly in neighborhoods with low tree canopy and high impervious surfaces. These impacts underscore the need for resilient infrastructure and targeted adaptation strategies to safeguard health and essential services. 6.4.8 Mitigation and Preparedness The most effective way to reduce the negative impacts of an extreme heat event is to develop a comprehensive heat response plan that has individual strategies to effectively manage heat waves during peak seasons of the year. The plan might include SalNJAmpV_TA_L^a_VpalV_T‘NLqJApVa_A_LAwAlN_Nmm‘A_LUNApwAvNlNmia_mN. To address extreme heat‘!am_TN]Nmaq_pyUAmV^i]N^N_pNLmNvNlA]^NAmqlNm’ x Cooling Centers: Establishment of air-conditioned public spaces where residents can seek relief during heatwaves. These centers are facilities such as ]VIlAlVNm‘ Ja^^q_Vpy JN_pNlm‘ A_L mN_Val JN_pNlm 0NmVLN_pm JA_]aJApNpUN nearest cooling center using resources provided by the county. Additional resources can be found at ŚƚƚƉƐ͗ͬͬƌĞĂĚLJ͘ůĂĐŽƵŶƚLJ͘ŐŽǀͬŚĞĂƚͬ x 4lIA_ lNN_V_T _VpVApVvNm’ -laTlA^mAV^NLApV_JlNAmV_TTlNN_miAJNm‘ i]A_pV_T plNNm‘ A_L JlNApV_T iAl\m pa ilavVLN mUALN A_L lNLqJNA^IVN_p temperatures. These efforts help mitigate the urban heat island effect. x Public Awareness Campaigns: Educational initiatives to inform residents about UNAplVm\m‘ilNvN_pVa_mplApNTVNm‘A_LlNmaqlJNmAvAV]AI]NLqlV_TNxplN^NUNAp NvN_pm3UNmNJA^iAVT_mN^iUAmV|NpUNV^ialpA_JNaSUyLlApVa_‘lNJaT_V|V_T heat-lN]ApNLV]]_Nmmmy^ipa^m‘A_LqpV]V|V_TJaa]V_g centers. x qV]LV_TaLNmA_L0NTq]ApVa_m’ Incorporation of heat-mitigating designs and ^ApNlVA]mV__NwJa_mplqJpVa_mA_LlNplaœpm‘mqJUAmJaa]laaSmA_LlNŔNJpVvN County of Los Angeles All-Hazards Mitigation Plan Page 73 of 204 iAvN^N_pm‘palNLqJNUNApAImalipVa_3UNmN^NAmqlNmAV^pa]awNlV_Laal temperatures and decrease reliance on air conditioning. 3UNmN mplApNTVNm AlN LNmVT_NL pa lNLqJN UNAp NxiamqlN‘ ilapNJpvq]_NlAI]N iaiq]ApVa_m‘A_LN_UA_JNJa^^q_VpylNmV]VN_JNATAV_mpNxplN^NUNApNvN_pm 6.4.9 Summary Extreme heat iamNmATlawV_TpUlNAppa!am_TN]Nmaq_py‘wVpUV_JlNAmV_TSlNkqN_Jy and intensity of heat waves exacerbated by urban heat island (UHI) effects. Understanding these impacts of extreme heat A_LpA\V_TAiilailVApNilNJAqpVa_m‘ residents of Los Angeles County can protect themselves and their communities from this growing climate hazard. 3UN Jaq_py UAm q_LNlpA\N_ vAlVaqm ^VpVTApVa_ NSSalpm‘ V_J]qLV_T pUN NmpAI]VmU^N_p aS Jaa]V_T JN_pNlm‘ qlIA_ TlNN_V_Tila[NJpm‘ iqI]VJ NLqJApVa_JA^iAVT_m‘A_Lthe implementation of heat-conscious building practices. %_TaV_TALAipApVa_A_LilaAJpVvNi]A__V_TAlNNmmN_pVA]pamASNTqAlLiqI]VJUNA]pU‘ V_SlAmplqJpqlN‘A_LpUNN_vVla_^N_pSla^pUNALvNlmNNSSNJpmaSNxplN^NUNAp County of Los Angeles All-Hazards Mitigation Plan Page 74 of 204 6.5 Drought 6.5.1 Nature Drought is a prolonged period of below- average precipitation that leads to water mUalpATNm‘ V^iAJpV_T ATlVJq]pqlN‘ NJamympN^m‘ and urban water supplies. Unlike other natural LVmAmpNlm‘LlaqTUpLNvN]aimTlALqA]]y‘^A\V_T Vp LVSœJq]p pa ilNLVJp A_L ^VpVTApN _ !am _TN]Nmaq_py‘LlaqTUpmAlNAlNJqllV_TVmmqN due to the region’s arid climate and dependence on imported water supplies. laqTUpmNvNlVpyVmLNpNl^V_NLIyVpmLqlApVa_‘ V_pN_mVpy‘ TNaTlAiUVJ NxpN_p‘ A_L wApNl demand. Climate change is exacerbating these SAJpalm‘]NALV_TpaUappNlpN^iNlApqlNm‘ lNLqJNL ilNJViVpApVa_‘ A_L V_JlNAmNL evaporation rates.:V]LœlNmAlNalso projected to increase in frequency and intensity during drought season. 3UNlNAlNSaqlJa^^a_J]AmmVœJApVa_maSLlaqTUp’ x Meteorological Drought: A prolonged period of below-normal precipitation. CCouCouuCouuntyntyntntyntynty offofofofofo LLoLLoLo AsAs As Asngenggeengelesesleslelles AAlAllAllAAAll-HazHHazHazardardardardddardardsMMs Ms Mss Miitiitiitiitigatgatggatiionoion PlPlPlPlPlaPlaPlalaannnnn County of Los Angeles All-Hazards Mitigation Plan Page 75 of 204 x Hydrological Drought: A reduction in surface and groundwater levels due to ila]a_TNLilNJViVpApVa_LNœJVpm x Agricultural Drought: A lack of soil moisture that affects crop growth and livestock sustainability. x Socioeconomic Drought:When water shortages impact drinking water mqii]VNm‘mA_VpApVa_‘iqI]VJmNlvVJNm‘A_LNJa_a^VJAJpVvVpVNm 6.5.2 Location Drought is regional in nature and typically affects the entire Los Angeles County planning area. Given the county’s reliance on imported water from the Sierra Nevada m_awiAJ\A_LpUNa]alALa0VvNl‘lNLqJNLAvAV]AIV]VpyaSpUNmNmaqlJNmmVT_VœJA_p]y increases vulnerability. 6.5.3 Extent laqTUpVmAlNJqllV_T_ApqlA]UA|AlLpUApJA_mNvNlN]yV^iAJpATlVJq]pqlN‘wApNlmqii]y‘ NJamympN^m‘ A_L Ja^^q_VpVNm 3a ^a_Vpal A_L Ja^^q_VJApN LlaqTUpJa_LVpVa_m AJlammpUN4_VpNL1pApNm‘pUN#ApVa_A]laqTUp"VpVTApVa_N_pNl Ÿ#" ‘ V_ partnership with the U.S. Department of Agriculture (USDA) and the National Oceanic A_L p^amiUNlVJ L^V_VmplApVa_ Ÿ#% ‘ ilaLqJNm wNN\]y 41 laqTUp "a_Vpal ^Aim3UNmN^AimJApNTalV|NLlaqTUpJa_LVpVa_mV_paœvN]NvN]mIAmNLa_V_pN_mVpy‘ LqlApVa_‘A_LV^iAJpa_vAlVaqmmNJpalm‘V_J]qLV_TATlVJq]pqlN‘wApNllNmaqlJNm‘A_L public health. AJU LlaqTUp JApNTaly lNŔNJpm A LVSSNlN_p ]NvN] aS mNvNlVpy‘ Sla^ mUalp-term dry Ja_LVpVa_mpUAp^Aym]awJlaiTlawpU‘pa]a_T-pNl^‘wVLNmilNALwApNlmUalpATNmpUAp lNkqVlNN^NlTN_JylNmia_mN3UNmNJ]AmmVœJApVa_mUN]iLNJVmVa_-^A\Nlm‘SAl^Nlm‘A_L water managers respond appropriately to emerging or ongoing drought conditions. See Figure 6.5.1 below for more information. County of Los Angeles All-Hazards Mitigation Plan Page 76 of 204 Drought Categories and Associated Impacts: CATEGORY DESCRIPTION POSSIBLE IMPACTS D4 EXCEPTIONAL DROUGHT x džĐĞƉƟŽŶĂůĂŶĚǁŝĚĞƐƉƌĞĂĚĐƌŽƉͬƉĂƐƚƵƌĞůŽƐƐĞƐ x ƌŝƟĐĂůƐŚŽƌƚĂŐĞƐŽĨǁĂƚĞƌŝŶƌĞƐĞƌǀŽŝƌƐ͕ƐƚƌĞĂŵƐ͕ĂŶĚ ǁĞůůƐ x tĂƚĞƌĞŵĞƌŐĞŶĐŝĞƐĂŶĚƉŽƐƐŝďůĞŵĂŶĚĂƚŽƌLJƌĂƟŽŶŝŶŐ x ^ĞǀĞƌĞŝŵƉĂĐƚƐŽŶĞĐŽƐLJƐƚĞŵƐĂŶĚǁŝůĚůŝĨĞŚĂďŝƚĂƚƐ D3 EXTREME DROUGHT x DĂũŽƌĂŐƌŝĐƵůƚƵƌĂůůŽƐƐĞƐĂŶĚƉĂƐƚƵƌĞĨĂŝůƵƌĞ x tŝĚĞƐƉƌĞĂĚǁĂƚĞƌƐŚŽƌƚĂŐĞƐ x tĂƚĞƌƵƐĞƌĞƐƚƌŝĐƟŽŶƐůŝŬĞůLJĞŶĨŽƌĐĞĚ x /ŶĐƌĞĂƐĞĚƌŝƐŬŽĨǁŝůĚĮƌĞƐĂŶĚŚĞĂƚ-ƌĞůĂƚĞĚƐƚƌĞƐƐ D2 SEVERE DROUGHT x ƌŽƉĂŶĚƉĂƐƚƵƌĞůŽƐƐĞƐďĞĐŽŵŝŶŐůŝŬĞůLJ x tĂƚĞƌƐŚŽƌƚĂŐĞƐďĞĐŽŵŝŶŐĐŽŵŵŽŶ x >ŽĐĂůŐŽǀĞƌŶŵĞŶƚƐŵĂLJŝŵƉůĞŵĞŶƚǁĂƚĞƌƌĞƐƚƌŝĐƟŽŶƐ x ,LJĚƌŽƉŽǁĞƌŐĞŶĞƌĂƟŽŶĂŶĚŝƌƌŝŐĂƟŽŶƉŽƚĞŶƟĂůůLJ ŝŵƉĂĐƚĞĚ D1 MODERATE DROUGHT x EŽƟĐĞĂďůĞĚĂŵĂŐĞƚŽĐƌŽƉƐĂŶĚƉĂƐƚƵƌĞƐ x tĂƚĞƌůĞǀĞůƐŝŶƐƚƌĞĂŵƐĂŶĚƌĞƐĞƌǀŽŝƌƐďĞŐŝŶƚŽĚĞĐůŝŶĞ x sŽůƵŶƚĂƌLJǁĂƚĞƌ-ƵƐĞƌĞƐƚƌŝĐƟŽŶƐŵĂLJďĞƌĞƋƵĞƐƚĞĚ x ^ŽŵĞƐƚƌĞƐƐŽŶĮƐŚĂŶĚǁŝůĚůŝĨĞƉŽƉƵůĂƟŽŶƐ D0 ABNORMALLY DRY x ĂƌůLJƐŝŐŶƐŽĨĚƌŽƵŐŚƚ͕ǁŝƚŚƐŚŽƌƚ-ƚĞƌŵĚƌLJŶĞƐƐƐůŽǁŝŶŐ ƉůĂŶƟŶŐĂŶĚĐƌŽƉŐƌŽǁƚŚ x /ĨŝŵƉƌŽǀŝŶŐůŝŶŐĞƌŝŶŐǁĂƚĞƌĚĞĮĐŝƚƐĂƐĂƌĞĂƌĞĐŽǀĞƌƐ ĨƌŽŵĚƌŽƵŐŚƚ x WĂƐƚƵƌĞƐŽƌǀĞŐĞƚĂƟŽŶŵĂLJƐŚŽǁƐŝŐŶƐŽĨĚĞůĂLJĞĚ ƌĞĐŽǀĞƌLJ Figure 6.5.1 Drought Categories and Associated Impacts 3UNmN J]AmmVœJApVa_m _ap a_]y help guide resources and planning but also raise awareness about the broader consequences of prolonged dryness. Understanding the extent and severity of drought helps ensure timely response and mitigation efforts at ]aJA]‘mpApN‘A_LSNLNlA]]NvN]m County of Los Angeles All-Hazards Mitigation Plan Page 77 of 204 6.5.4 History !am_TN]Nmaq_pyUAmNxiNlVN_JNL^q]pVi]NmVT_VœJA_pLlaqTUpm‘wVpUma^N]AmpV_T several years. There have been no federal declarations or state proclamations for LlaqTUpV_pUN]AmpœvNyNAlm Figure 6.5.2, U.S. Drought Monitor, 2025 County of Los Angeles All-Hazards Mitigation Plan Page 78 of 204 Notable historical drought periods include: 1. 1917-1921 – A widespread drought affecting most of California. 2. 1976-1977 – One of the driest two-year periods in recorded history. 3. 1987-1992 – A six-year drought that severely impacted water supplies and agriculture. 4. 2007-2009 – A prolonged drought leading to state-imposed water restrictions. 5. 2011-2017 –3UN ^amp mNvNlN LlaqTUp V_ ^aLNl_ UVmpaly‘ lNmq]pV_T V_ groundwater depletion and mandatory conservation measures. 6. 2020-2022 –A]VSal_VA NxiNlVN_JNL A mVT_VœJA_p LlaqTUp‘ wVpU !am _TN]Nm aq_pyNxiNlVN_JV_T´AI_al^A]]yLly´Ja_LVpVa_m 7. 2024-2025 – Los Angeles County is continuing to experience abnormally dry Ja_LVpVa_m‘wVpU]awNlAverage rainfalls and arid conditions. 3UNJUAlpAIavN‘pUNPalmer Drought Severity Index‘shows how drought conditions have been changing since 1895. The Palmer Drought Severity Index measures how dry or wet an area is by comparing rainfall and temperature to long-term averages. It gives a number (positive or negative) showing drought severity or excess moisture. Los Angeles County was in some form of drought for 376 consecutive weeks from NJN^INl‚€‘‚€‘q_pV]"AlJU„‘‚€‰The State and the County passed several resolutions and regulations at different times to mitigate drought impacts like water Figure 6͘ϱ͘ϯ͕EKƌŽƵŐŚƚ^ĞǀĞƌŝƚLJ/ŶĚĞdž͕ϮϬϮϰ County of Los Angeles All-Hazards Mitigation Plan Page 79 of 204 conservation regulations. There were no federally declared drought disasters in the AlNAV_pUNiAmpœvNyNAlmV_pUNi]A__V_TAlNA 6.5.5 Probability Climate scientists predict that Los Angeles County and the rest of Southern California wV]]TNpLlVNl‘wUV]NNorthern California will get hotter. Rising temperatures contribute paUVTUNlNvAialApVa_lApNmA_LLNJ]V_V_Tm_awiAJ\V_pUN1VNllA#NvALA‘AJlVpVJA] source of water for Southern California. The frequency of extreme droughts is expected paV_JlNAmN‘lNLqJing available water resources and heightening competition between qlIA_‘ATlVJq]pqlA]‘A_LN_vVla_^N_pA]_NNLmLong-term droughts have a 100% of occurring every ten-years‘ wVpU iapN_pVA] Sal ]a_TNl A_L ^alN LNmplqJpVvN LlaqTUp events due to climate change. 6.5.6 Vulnerability Los Angeles County’s 10 million residents face growing vulnerabilities during ila]a_TNLLlaqTUpm‘wVpUavNl‡…ÈaSJa^^q_VpywApNlmympN^mNxUVIVpV_TAp]NAmpa_N drought-lN]ApNLlVm\‘mqJUAmlN]VA_JNa_AmV_T]NmaqlJNalATV_TV_SlAmplqJpqlN3UN County’s dependence on imported water—serving over 60% of residents—increases exposure to supply disruptions from reduced Sierra Nevada snowpack and Colorado River allocations. ]]lNmVLN_pm‘A_LvVmVpalmaS Los Angeles County areaffected by water shortages during a prolonged drought conditions. Vulnerabilities include: x Low-income households‘aSpN_]AJ\V_TwApNl-NSœJVN_pAii]VA_JNmA_LJaa]V_T systems. x Agricultural industry wVpU avNl „€‘€€€ AJlNm aS VllVTApNL SAl^]A_L V_ pUN County is at risk of reduced water allocation and drying pastures for livestock. x Wildland-urban interface (WUI) communities‘wUNlNavNl^V]]Va_lNmVLN_pm SAJNUNVTUpN_NLwV]LœlNlVm\LqNpaLlyvNTNpApVa_A_L]V^VpNLœlNœTUpV_TwApNl supply. x Critical infrastructure operations may be impacted by a range of factors from reduced hydropower availability when reservoir levels decrease to power station cooling challenges. County of Los Angeles All-Hazards Mitigation Plan Page 80 of 204 These vulnerabilities illustrate the far-lNAJUV_T‘Jlamm-sector impacts of drought on the aq_py¯mNJa_a^y‘N_vVla_^N_p‘A_L^ampAp-risk communities. 6.5.7 Impacts %vNlpUNiAmpœvNyNAlm‘!am_TN]Nmaq_pyUAmNxiNlVN_JNLV_pN_mVSyV_TLlaqTUp Ja_LVpVa_m^Al\NLIylVmV_TpN^iNlApqlNm‘lNLqJNLm_awiAJ\‘A_Lpersistent water mUalpATNm y‚€‚‚‘‡…ÈaSpUNaq_py¯mJa^^q_VpywApNlmympN^mmUawNLAp]NAmpa_N LlaqTUp vq]_NlAIV]Vpy‘ V_J]qLV_T lN]VA_JN a_ A mV_T]N wApNl maqlJN al ATV_T V_SlAmplqJpqlN-qI]VJUNA]pUV^iAJpmUAvNA]maN^NlTNL‘wVpU‘ƒJAmNmaS9A lley fever lNialpNLV_‚€‚€‘]V_\NLpaLlymaV]A_LLqmpNxiamqlNyLlaiawNllNLqJpVa_mLqlV_T LlaqTUpiNlVaLmV_JlNAmNLlN]VA_JNa__ApqlA]TAm‘Ja_plVIqpV_TpaN]NvApNLN_NlTy JampmSallNmVLN_pm3UNmNJa^iaq_LV_TV^iAJpmUAvNmplAV_NLwApNlmqii]y‘UNalth mympN^m‘A_LV_SlAmplqJpqlN‘lNV_SalJV_TLlaqTUpAmA^A[alA_LTlawV_TUA|AlLSal!am Angeles County. 6.5.8 Mitigation and Preparedness 3aJa^IApV_JlNAmV_TLlaqTUplVm\m‘!am_TN]Nmaq_pyUAmV^i]N^N_pNL wApNl Ja_mNlvApVa_ia]VJVNm‘V_SlAmplqJpqlNV_vNmp^N_pm‘A_LN^NlTN_JylNmia_mN^NAmqlNm Key strategies include: Water Management and Conservation x Expanding water recycling and desalination programs to reduce reliance on imported water. x Implementing drought-tolerant landscaping initiatives to lower residential and commercial water use. x _SalJV_TwApNlNSœJVN_JylNTq]ApVa_mSal_NwLNvN]ai^N_pmA_Lupgrading older properties with water-saving strategies. Infrastructure Improvements x Enhancing groundwater recharge projects to increase local water storage. x Upgrading stormwater capture systems to maximize water retention during rainy seasons. x Developing new water storage facilities to provide additional supply resilience. Community Preparedness and Public Awareness County of Los Angeles All-Hazards Mitigation Plan Page 81 of 204 x Launching county-wide conservation campaigns to encourage sustainable water use. x _JlNAmV_Tœ_A_JVA]V_JN_pVvNmSalwApNl-NSœJVN_pAii]VA_JNmA_LVllVTApVa_mympN^m x Strengthening emergency drought response plans to ensure equitable water distribution during crises. 6.5.9 Summary Drought remains a persistent and growing threat to Los Angeles County’s water security and economic stability. Climate change projections indicate more frequent A_LmNvNlNLlaqTUpm‘i]AJV_TTlNApNlmplAV_a_wApNlmqii]ymympN^m‘iqI]VJUNA]pU‘A_L agriculture. By implementing proactive water management mplApNTVNm‘ V_vNmpV_T V_ V_SlAmplqJpqlN lNmV]VN_JN‘ A_L ila^apV_T Ja^^q_Vpy AwAlN_Nmm‘ pUN aq_py JA_ mitigate the long-term impacts of drought and ensure sustainable water resources for future generations. County of Los Angeles All-Hazards Mitigation Plan Page 82 of 204 Couountyty ofo Lo AAAAAAAAAAAAAAAs AsAAAAAAAAAAAAAAAAAAngengnngngnnnnngengegegegegegeengengngengnngngegggegggggggeegeggggegeeggeeeeeeeeeeeeeelesleslesllleslessesesleslesleleleslesleseseslesleseeseseselesleseseleseslleleeeeessleseeseleslessssssssessssssss AllllAlllAlAlA-Hazazzardardardardddrdrddddrdddrdddrddrddddddddrdddddddddrddrddddds MMMMMMMMMMitiitiitiitiitittitititititttitgatgatgationnionionnn PlaPPllllaPlaPPllaaPlaPPPlaPnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6.6 Flooding 6.6.1 Nature Flooding is a persistent and increasingly severe UA|AlL V_ !am _TN]Nm aq_py‘ LlVvN_ Iy UNAvy lAV_SA]]‘mpal^mqlTN‘mpal^wApNlLlAV_ATN‘A_LlVmV_T mNA ]NvN]m 3UN Jaq_py¯m Ja^i]Nx UyLla]aTy‘ wUVJU V_J]qLNmlVvNlm‘JlNN\m‘A_LA_NxpN_mVvNqlIA_ŔaaL co_pla] mympN^‘ Vm UVTU]y mqmJNipVI]N pa avNlŔaw events when precipitation exceeds drainage capacity. 3UNNSSNJpmaSJ]V^ApNJUA_TNAlNNxAJNlIApV_TŔaaL lVm\m Iy V_pN_mVSyV_T mpal^m‘ A]pNlV_T ilNJViVpApVa_ iAppNl_m‘A_LV_JlNAmV_TmNA]NvN]m‘]NALV_TpaTreater JaAmpA]V_q_LApVa_A_LV_]A_LŔAmUŔaaLm Unlike other regions that experience seasonal ŔaaLV_TLqNpam_aw^N]p‘ŔaaLV_TV_!am_TN]Nm County primarily occurs during winter storms and Ap^amiUNlVJlVvNlNvN_pm‘wUVJUIlV_TV_pN_mNlAV_SA]] and lightning over short periods. x 3UNlNTVa_¯mUVTULNTlNNaSqlIA_V|ApVa_Ja_plVIqpNmpaŔAmUŔaaLV_T‘AmiAvNL mqlSAJNmilNvN_p_ApqlA]AImalipVa_aSwApNl‘]NALV_TpalAiVLlq_aSSA_LmplNNp ŔaaLV_T County of Los Angeles All-Hazards Mitigation Plan Page 83 of 204 x ql_mJAlmSla^lNJN_pwV]LœlNmSqlpUNlJa^iaq_LŔaaLlVm\mIylNLqJV_T vNTNpApVa_ JavNl‘ LNmpAIV]V|V_T UV]]mVLNm‘ A_L V_JlNAmV_T pUN ]V\N]VUaaL aS ]A_L movement. ]aaLV_TA]maJlNApNmmNJa_LAlyUA|AlLm‘V_J]qLV_TNlamVa_‘V_SlAmplqJpqlNLA^ATN‘ wApNlJa_pA^V_ApVa_‘A_LplA_mialpApVa_LVmlqipVa_m1pal^wApNllq_aSSJA_avNlwUN]^ wAmpNwApNlplNAp^N_pSAJV]VpVNm‘]NALV_TpaUA|AlLaqmmiV]]m!A_Lm]VLNmA_L^qLŔawm in post-wV]LœlNAlNAmiamNALLVpVa_A]lVm\mpaUa^Nm‘laALm‘A_LJlVpVJA]V_SlAmplqJpqlN 3UNmN Ja^iaq_LV_T pUlNApm UVTU]VTUp pUN qlTN_p _NNL Sal Ja^ilNUN_mVvN ŔaaL ^VpVTApVa_NSSalpmpailapNJpJa^^q_VpVNm‘V_SlAmplqJpqlN‘A_LpUNN_vVla_^N_p 6.6.2 Location ]aaLUA|AlLmAlNTNaTlAiUVJA]]ywVLNmilNAL‘wVpU^alNpUA_‚„€mkqAlN^V]NmaS]A_L located within the 100- and 500-yNAlŔaaLi]AV_mVmpalVJA]]ymVT_VœJA_pNvN_pm‘mqJUAm pUN‰ƒˆA_L‰†‰ŔaaLm‘AmwN]]Am^alNlNJN_pmpal^mV_‚€‚ƒA_L‚€‚„‘UAvNJAqmNL mqImpA_pVA]LA^ATNpaV_SlAmplqJpqlN‘plVTTNlNLNvAJqApVa_m‘A_LJUA]]N_TNL]a_T-term recovery efforts. SocVA]]yvq]_NlAI]Niaiq]ApVa_m‘V_J]qLV_Ta]LNlALq]pm‘V_LVvVLqA]m wVpUAJJNmmA_LSq_JpVa_A]_NNLm‘A_L]aw-V_Ja^NUaqmNUa]Lm‘SAJNLVmilaialpVa_ApN V^iAJpm LqN pa ]V^VpNL œ_A_JVA] lNmaqlJNm‘ V_ALNkqApN V_mqlA_JN JavNlATN‘ A_L reduced access to services. 3UNaq_py¯mŔaaLJa_pla]mympN^V_J]qLNmJa_JlNpNlVvNl JUA__N]m‘]NvNNm‘mpal^LlAV_m‘LNIlVmIAmV_mA_LlNmNlvaVlm“UAmUN]iNL^VpVTApNma^N ŔaaL lVm\m Iqp lN^AV_m vq]_NlAI]N pa UVTU-intensity storms that exceed design capacities. Major Flood-Prone Areas: x !am_TN]Nm0VvNl‘1A_AIlVN]0VvNl‘A_L1A_pA]AlA0VvNl’3UNmN^A[alwApNlwAym AlNila_NpaavNlŔawLqlV_TNxplN^Nmpal^NvN_pm‘iAlpVJq]Al]yLqlV_T]#V`a years. x Ballona Creek and Malibu Creek: These urban watersheds experience rapid runoff A_LŔAmUŔaaLV_T‘NmiNJVA]]yV_LNvN]aiNLAlNAm x aapUV]]m‘9A]]Nym‘A_L0NJN_p ql_1JAllNAm’-amp-wV]LœlNlNTVa_mSAJNUNVTUpN_NL lVm\aSŔAmUŔaaLmA_LLNIlVmŔawmSa]]awV_Tmpal^m x _pN]aiN9A]]Ny’_LNmNlplNTVa_m‘mpal^wApNliaa]mV_papN^ialAly]A\Nm‘JAqmV_T ŔaaLNLlaALwAymA_LV_SlAmplqJpqlNLA^ATN County of Los Angeles All-Hazards Mitigation Plan Page 84 of 204 x Coastal Communities: Rising sea levels and storm surges threaten beachfront ilaiNlpVNm‘UAlIalm‘A_LIqmV_NmmNm Urban areas are particularly vulnerable due to impervious surfaces and outdated LlAV_ATNmympN^mqlV_TV_pN_mNmpal^m‘_NVTUIalUaaLmV_aw_paw_!am_TN]Nm‘ 1aqpU!‘A_LpUN1A_Nl_A_La9A]]NySlNkqN_p]yNxiNlVN_JNmplNNpŔaaLV_TA_LplASœJ disruptia_m‘LN^a_mplApV_TpUN]V^VpApVa_maSNxVmpV_TV_SlAmplqJpqlNV_UA_L]V_T^aLNl_ storm events. For a better visual representation of this Flooding Hazard within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVx for ŔaaLA_LV_q_LApVa_^Aim. 6.6.3 Extent !am_TN]Nmaq_pySAJNmAmVT_VœJA_pA_LNva]vV_TŔaaLlVm\‘wVpUV^iAJpmlA_TV_T Sla^]aJA]V|NLqlIA_V_q_LApVa_pawVLNmilNALlVvNlV_NŔaaLV_TA_LLNmplqJpVvNLNIlVm Ŕawm]pUaqTUpUNaq_pyUAmV_vNmpNLUNAvV]yV_ŔaaLJa_pla]V_SlAmplqJpqlN“ inc]qLV_T A_ NxpN_mVvN _Npwal\ aS LA^m A_L LNIlVm IAmV_m“ pUNmN mympN^m AlN increasingly strained and cannot fully eliminate the threat. A growing number of lNmVLN_pmAlNNxiamNLpaLA_TNlaqmŔaaLV_TNAJUyNAl‘AmVpqApVa_^ALNwalmNIypUN limitations of aging infrastructure and the complexities of urban hydrology. Intense lAV_SA]]NvN_pm‘NmiNJVA]]ypUamNAmmaJVApNLwVpUAp^amiUNlVJlVvNlm‘AlNaJJqllV_T^alN SlNkqN_p]y A_L wVpU TlNApNl mNvNlVpy‘ aSpN_ avNlwUN]^V_T LlAV_ATN mympN^m A_L lNmq]pV_TV_mNvNlNŔooding of streets and neighborhoods. Compounding this risk are Iql_mJAlmSla^lNJN_pwV]LœlNm‘wUVJUUNVTUpN_pUN]V\N]VUaaLaS^qLm]VLNmA_LLNIlVm ŔawmpUAppUlNApN_IapU]VSNA_LilaiNlpymJ]V^ApNiAppNl_mmUVSpA_LNxplN^NwNApUNl events become ^alNJa^^a_‘pUNŔaaLvq]_NlAIV]VpyaS!am_TN]Nmaq_pyJa_pV_qNm to deepen across its diverse geography. Flood severity is typically measured using the 100-year and 500-yNAlŔaaLlNJqllN_JN V_pNlvA]m‘wUVJUV_LVJApNAÈA_L€‚ÈA__qA]ilaIAIV]VpyaSŔaaLV_T‘lNmiNJpVvN]y 3UNmNLNmVT_ApVa_mTqVLNŔaaLi]AV_^A_ATN^N_pA_L^VpVTApVa_NSSalpm Key Flood Hazard Statistics in Los Angeles County: x ‚„ƒƒ‚mkqAlN^V]NmŸ…È aS]A_LUAvNA€‚ÈA__qA]ŔaaLilaIAIV]Vpy x „‰mkqAlN^V]NmŸ€€‰È UAvNAÈA__qA]ŔaaLilaIAIV]Vpy County of Los Angeles All-Hazards Mitigation Plan Page 85 of 204 Key Flood Hazard Statistics for Unincorporated Los Angeles County: x †„‡‡mkqAlN^V]NmŸ‚ƒÈ UAvNA€‚ÈŔaaLilaIAIV]Vpy x ‚ƒmkqAlN^V]NmŸ€€„È UAvNAÈŔaaLilaIAIV]Vpy As climate change accelerates sea-]NvN]lVmNA_LNxplN^NlAV_SA]]NvN_pm‘pUNmNŔaaL- ila_NAlNAm^AyNxiA_L‘ASSNJpV_T^alNlNmVLN_pm‘V_SlAmplqJpqlN‘A_LIqmV_NmmNm !%%"-3%#!#0 Area 0.2% Annual Flood Probability 1% Annual Flood Probability Los Angeles County 243.32 sq. mi. (5.11%) 4.19 sq. mi. (0.09%) Unincorporated LA County 64.77 sq. mi. (2.13%) 1.23 sq. mi. (0.04%) 6.6.4 History !am_TN]Nmaq_pyUAmNxiNlVN_JNL_q^NlaqmmNvNlNŔaaLNvN_pm‘^A_yaSwUVJU UAvNJAqmNLJApAmplaiUVJLA^ATNpaV_SlAmplqJpqlN‘ilaiNlpy‘A_LUq^A_]VSN%vNlpUN LNJALNm‘J]V^ApNvAlVAIV]Vpy‘lAiVLqlIA_V|ApVa_‘A_LA_ATV_TŔaaLJa_pla]mympN^UAvN leLpalNiNApNLŔaaLV_TLVmAmpNlmThere have been no federal declarations or state ilaJ]A^ApVa_mSalNAlpUkqA\NmV_pUN]AmpœvNyNAlm N]awAlNma^NaSpUN^ampmVT_VœJA_pUVmpalVJA]A_LlNJN_pŔaaLNvN_pmASSNJpV_TpUN region. Notable Flood and Lightning Events in Los Angeles County: x 1938 Los Angeles Floods’%_NaSpUNLNAL]VNmpŔaaLmV_Jaq_pyUVmpaly‘JAqmNLIy wNN\m aS pallN_pVA] lAV_SA]]‘ lNmq]pV_T V_ avNl €€ LNApUm‘ pUN LNmplqJpVa_ aS pUaqmA_LmaSUa^Nm‘A_LwVLNmilNALV_SlAmplqJpqlNLA^ATN‘iAlpVJq]Al]ypaIlVLTNm and roadways. x 1969 Winter Storms’NAvylAV_m]NLpa^AmmVvNLNIlVmŔawmV_pUN1A_AIlVN] "aq_pAV_m‘mNvNlNqlIA_ŔaaLV_TAJlamm!am_TN]Nm‘A_L^q]pVi]NLA^IlNAJUNm‘ prompting major evacuations. x 1992-1993 El Niño Floods’mNlVNmaSmpal^mplVTTNlNL]A_Lm]VLNm‘ŔAmUŔaaLV_T‘ A_L^A[alJaAmpA]NlamVa_‘wVpUmVT_VœJA_pLA^ATNpa-AJVœJaAmpVTUwAyA_L residential areas. x ‚€‡:V_pNl1pal^mŸ0-4305): Record-IlNA\V_TlAV_SA]]]NLpamVT_VœJA_pqlIA_ ŔaaLV_T‘ laAL J]amqlNm‘ A_L ^qLm]VLNm‘ wVpU mNvNlN V^iAJpm AJlamm ^q]pVi]N communities. County of Los Angeles All-Hazards Mitigation Plan Page 86 of 204 x October 2021: Los Angeles County experienced a rare and intense thunderstorm wVpUAmVT_VœJA_pA^aq_paS]VTUp_V_T x September 2022 Hurricane Kay’iAJVœJUqllVJA_NpUApJAqmNLmVT_VœJA_plAV_SA]] A]a_TwVpUlVm\aS^qLŔawm‘JaAmpA]ŔaaLV_T‘A_LJaAmpA]NlamVa_ x A_qAly‚€‚ƒp^amiUNlVJ0VvNlvN_pŸ0-4683): Heavy rainfall overwhelmed mpal^LlAV_m‘JAqmV_TmVT_VœJA_pŔaaLV_TV_a]]ywaaL‘ A]LwV_V]]m‘A_L]aw-lying V_]A_LAlNAm‘]NALV_TpaNvAJqApVa_mA_LV_SlAmplqJpqlNLA^ATN x NIlqAly‚€‚ƒ!am_TN]Nm]aaLmŸ0-4699): A series of intense storms caused wVLNmilNALŔAmUŔaaLV_T‘SlNNwAyJ]amqlNm‘A_L]A_Lm]VLNm‘LN^a_mplApV_T pUN increasing vulnerability of the county's urban areas to extreme precipitation events. x qTqmp‚€‚ƒ3laiVJA]1pal^V]AlyŸ0-4750): Several locations in the mountains of Southern California received over 10 inches of rainfall which set daily and/or ^a_pU]ylAV_SA]]lNJalLm‘V_^A_y]aJApVa_mV_1aqpUNl_A]VSal_VA‘V_J]qLV_TwVpUV_ !am_TN]Nmaq_pypA]maJlNApNLmVT_VœJA_ppUlNApaSŔAmUA_LlVvNlV_NŔaaLV_T prompted the evacuation of numerous vulnerable communities near burn scars in the region. x NJN^INl‚€‚ƒ-AJVœJ1pal^’1pal^mqlTNmA_LNxplN^NJaAmpA]ŔaaLV_T]NLpa mVT_VœJA_pNlamVa_A]a_TpUNJaAmp]V_N‘iAlpVJq]Al]yV^iAJpV_T"AlV_ALN]0Ny‘!a_T NAJU‘A_L9N_VJN NAJU x February - "AlJU‚€‚„p^amiUNlVJ0VvNl1pal^Ÿ0-4769): One of the most V_pN_mNlAV_SA]]NvN_pmV_lNJN_pUVmpaly‘lNmq]pV_TV_mNvNlNŔAmUŔaaLm‘^qLm]VLNm‘ A_LiawNlaqpATNm‘wVpU^A_yUa^NmA_LIqmV_NmmNmmqmpAV_V_TŔaaLLA^ATN 6.6.5 Probability ]aaLlNJqllN_JNV_!am_TN]Nmaq_pyVmV_ŔqN_JNLIyIapU_ApqlA]J]V^ApNvAlVAIV]Vpy A_LpUNV_JlNAmV_TNSSNJpmaSJ]V^ApNJUA_TNVmpalVJA]]y‘mNvNlNŔaaLV_TVm^amp]V\N]y LqlV_Tmpla_T]#V`aNvN_pm‘wUVJUaJJqlAiilaxV^ApN]yNvNly‚pa‡yNAlmAnd can persist for several months to multiple years. These events bring elevated precipitation ]NvN]mA_LV_JlNAmNpUN]V\N]VUaaLaSIapUV_]A_LA_LJaAmpA]ŔaaLV_T mJ]V^ApNJUA_TNAJJN]NlApNm‘pUNSlNkqN_JyA_LV_pN_mVpyaSŔaaL-generating events AlNNxiNJpNLpaV_JlNAmN‘A]pNlV_TplALVpVa_A]lNJqllN_JNV_pNlvA]mA_LNxiA_LV_TpUN areas at risk. 3UNlNVmA‰…ÈJUA_JNaSAŔaaLV_TNvN_paJJqllV_TNAJUyNAlwVpUV_T!am Angeles County. County of Los Angeles All-Hazards Mitigation Plan Page 87 of 204 Key climate-related drivers include: x Sea-!NvN]0VmN’-la[NJpNLpalVmNIy†V_JUNmpaavNl‚SNNpIy‚€…€‘V_JlNAmV_TpUN lVm\aSpVLA]A_Lmpal^mqlTNŔaaLV_TV_JaAmpA]Ja^^q_VpVNm x p^amiUNlVJ 0VvNl vN_pm’ JJalLV_T pa pUN ‚€‚„ 30‘ pUNmN NvN_pm AlN INJa^V_T^alNSlNkqN_pA_LV_pN_mN‘]NALV_TpaN]NvApNLŔAmUŔaaLA_LLNIlVm ŔawlVm\m x El Niño Cycles’1pV]]NxiNJpNLNvNly‚pa‡yNAlm‘IqpwVpUV_JlNAmNLvAlVAIV]VpyA_L mpal^V_pN_mVpypUApJA_avNlwUN]^]aJA]LlAV_ATNA_LŔaaLJa_pla]mympN^m. 3UNmN Nva]vV_T Ja_LVpVa_m JUA]]N_TN NxVmpV_T ŔaaLi]AV_ ^Aim A_LLNmVT_ Ammq^ipVa_m‘UVTU]VTUpV_TpUN_NNLSalALAipVvNi]A__V_T‘qiLApNLlVm\^aLN]m‘A_L Ja_pV_qNLV_vNmp^N_pV_lNmV]VN_pV_SlAmplqJpqlNA_LŔaaL^VpVTApVa_mplApNTVNm 6.6.6 Vulnerability !am_TN]Nmaq_pySAJNmwVLNmilNALA_L]AyNlNLvq]_NlAIV]VpVNmpaŔaaLV_T‘mUAiNL by a combination of environmental exposure and complex social factors. Physical vulnerability is pronounced in areas located within FEMA-designated Special Flood A|AlLlNAmŸ1m ‘iamp-wV]LœlNIql_mJAlm‘A_L]aw-lying urban drainage basins pUApAlNila_NpaŔaaLV_TawNvNl‘pUNLNTlNNaSlVm\VmmVT_VœJA_p]yUNVTUpN_NLSal JNlpAV_iaiq]ApVa_mwUa^Ay]AJ\pUNlNmaqlJNmalJAiAJVpypailNiAlNSal‘lNmia_Lpa‘ and reJavNl Sla^ ŔaaL NvN_pm 1aJVA]]y vq]_NlAI]N Tlaqim‘ V_J]qLV_T a]LNl ALq]pm‘ V_LVvVLqA]m wVpU LVmAIV]VpVNm al AJJNmm A_L Sq_JpVa_A] _NNLm Ÿ# ‘ ^aIV]N Ua^N lNmVLN_pm‘iNai]NNxiNlVN_JV_TUa^N]Nmm_Nmm‘A_L]aw-V_Ja^NUaqmNUa]Lm“AlN^alN likely to reside in structurally vulnerable housing. According to the 2021 Los Angeles County Comprehensive Floodplain Management -]A_‘^alNpUA_AkqAlpNlaSlNmVLN_pm]VvV_TwVpUV_pUN€€-yNAlŔaaLi]AV_NAl_]Nmm pUA_¸‚€‘€€€A__qA]]y‘q_LNlmJalV_TpUNLVmilaialpVa_ApNNJa_a^VJIqlLN_SAJNLIy those least able to absorb the costs of recovery. Climate vulnerability data further LN^a_mplApNmpUAp^AlTV_A]V|NLJa^^q_VpVNmV_ŔaaL-exposed areas face elevated lVm\mLqNpaŔaaLV_TNvN_pm3UNvq]_NlAIV]Vpy]A_LmJAiNVmSqlpUNlJa^i]VJApNLIyA shortage of affalLAI]NŔaaL-lNmV]VN_pmplqJpqlNm‘A_LA_V_JlNAmV_T_q^INlaSlNmVLN_pm living in areas newly exposed due to climate-driven changes in precipitation and runoff patterns. County of Los Angeles All-Hazards Mitigation Plan Page 88 of 204 6.6.7 Impacts Flooding in Los Angeles County leads to a broad range of direct and cascading impacts a_ iNai]N‘ V_SlAmplqJpqlN‘ N_vVla_^N_p‘ A_L pUN NJa_a^y 3UN aq_py¯m NxpN_mVvN _Npwal\ aS JlVpVJA] SAJV]VpVNm‘ V_J]qLV_T UamiVpA]m‘ œlN mpApVa_m‘ wAmpNwApNl plNAp^N_p p]A_pm‘mJUaa]m‘A_LiawNlmqImpApVa_m3UNmNAlNAmSAJNlNJqllV_TNxiamqlNwVpUV_ both 100- and 500-yNAlŔaaLi]AV_mA^ATNpapUNmNSAJV]VpVNm_apa_]yJa^ila^VmNm their physical integrity but also threatens their functionality during emergency response operations. ]aaLV_TaSpN_LVmlqipm]VSN]V_NmNlvVJNmmqJUAmN]NJplVJVpy‘iapAI]NwApNl‘mA_VpApVa_‘ A_LplA_mialpApVa_‘wVpUlqlA]A_Lq_V_JalialApNLAlNAmSAJV_TpUNTlNApNmpJUA]]N_TNm palAiVLlNmpalApVa_"aIV]NUa^Nm‘SlNkqN_p]yJa_JN_plApNLV_]aw-lying or under- LlAV_NL _NVTUIalUaaLm‘ AlN NmiNJVA]]y mqmJNipVI]N pa ŔaaL LA^ATN LqN pa Ja_mplqJpVa_]V^VpApVa_mA_LV_ALNkqApNilapNJpVvN^NAmqlNm-lNvVaqmŔaaLNvN_pm UAvNlNmq]pNLV_mVT_VœJA_pLNIlVmŔawm‘laALJ]amqlNm‘plAV_mpaiiATNm‘A_LLA^ATN to public and private structures. -lV^Aly9q]_NlAIV]VpVNmË^iAJpm’ x %vNl‘„‡€mplqJpqlNmAlNNmpV^ApNLpaINLA^ATNLV_A€€-yNAlŔaaLNvN_p‘wVpU papA]LA^ATNmNxJNNLV_T¸‡†‰‡^V]]Va_V_ilaiNlpy]ammNmV_q_V_JalialApNL!am Angeles County. x LLVpVa_A]]y‘^alNpUA_ˆ€JlVpVJA]SAJV]VpVNmAlNNxiamNLV_pUN…€€-yNAlŔaaLi]AV_‘ while 70 are within the 100-yNAlŔaaLi]AV_‘V_J]qLV_TplA_mialpApVa_AmmNpm‘qpV]VpVNm‘ N^NlTN_JymNlvVJNm‘A_LUA|AlLaqm^ApNlVA]mSAJV]VpVNm x A 100-yNAlŔaaLNvN_pJaq]LLVmi]AJNavNlApUaqmA_LiNai]NwVpU^A_ylNkqVlV_T mUN]pNlV_T‘mqiialpA_LlNJavNlyNSSalpm x iilaxV^ApN]y‰‘…†ƒpa_maSIqV]LV_T-related debris could be generated by a 100- yNAl ŔaaL NvN_p‘ wVpU J]NA_-qilNkqVlV_T^alNpUA_‡ˆ€plqJ\]aALm‘iamV_T ]aTVmpVJA]‘N_vVla_^N_pA]‘A_LiqI]VJUNA]pUJUA]]N_TNm x 28.6% of households in the 100-yNAlŔaaLi]AV_AlNNJa_a^VJA]]yLVmALvA_pATNL‘ NAl_V_Tq_LNl¸‚€‘€€€iNlyNAl‘]V^VpV_TpUNVlAIV]VpypaNvAJqApN‘lNJavNl‘aliAySal mitigation improvements. x ]AlTNmUAlNaSŔaaL-prone properties are either uninsured or underinsured. The AvNlATNŔaaLV_mqlA_JNJ]AV^iAyaqpVm¸‡‘‚‰ˆ‘wUVJUVma_]yAIaqpÈaSpUN‚€‰ County of Los Angeles All-Hazards Mitigation Plan Page 89 of 204 ŚĂƌƚƐ^ŽƵƌĐĞ͗ >ŽƵŶƚLJWƵďůŝĐtŽƌŬƐ͖ϮϬϮϭ ŽƵŶƚLJŽŵƉƌĞŚĞŶƐŝǀĞ&ůŽŽĚWůĂŶ AvNlATNlNi]AJN^N_pJampaSmplqJpqlNmV_pUNŔaaLi]AV_—V_LVJApV_TmVT_VœJA_pTAim V_œ_A_JVA]lNmV]VN_JN x :V]LœlNIql_mJAlmA_Liamp-œlNUyLlaiUaIVJmaV]mmVT_VœJA_p]yV_JlNAmNŔaaLA_L LNIlVm Ŕaw lVm\m‘ iAlpVJq]Al]y V_ SaapUV]] A_L JA_ya_ Ja^^q_VpVNm 3UVm UA|AlL continues to grow in severity with climate-LlVvN_œlNmNAma_m 6.6.8 Mitigation and Preparedness !am_TN]Nmaq_py¯mŔaaL^VpVTApVa_mplApNTylNLqJNmUA|AlLNxiamqlN‘N_UA_JNm Ja^^q_VpylNmV]VN_JN‘A_Lmqiialpm]a_T-term climate adaptation. Grounded in FEMA’s #ApVa_A] "VpVTApVa_ lA^Nwal\‘ A]%1 i]A__V_T TqVLA_JN‘ A_L ]aJA] ia]VJy‘ pUN County implements both structural and non-structural measures to address current and SqpqlNŔaaLlVm\malNAJpVa_mV_J]qLNlNTq]Al^AV_pN_A_JNA_LpAlTNpNLqiTlALNmpa Estimated Damage to Critical Facilities in Unincorporated Areas from 100-Year Flood Sector Number of Facilities Affected Average % of Total 9A]qN Damaged Structure Content Safety & Security 1 7.56 10.24 Food, Water & Sheltering 9 6.72 18.73 Health & Medical 0 N/A N/A Energy 1 23.90 47.79 Communications 0 N/A N/A Transportation 59 1.41 8.86 Hazardous Materials 0 N/A N/A Total/Average 70 9.90 21.40 Estimated Damage to Critical Facilities in Unincorporated Areas from 500-Year Flood Sector Number of Facilities Affected Average % of Total 9A]qN Damaged Structure Content Safety & Security 4 28.39 37.56 Food, Water & Sheltering 41 7.73 27.01 Health & Medical 0 N/A N/A Energy 1 23.90 47.79 Communications 2 5.00 16.00 Transportation 107 3.38 19.74 Hazardous Materials 30 10.00 15.00 Total/Average 185 13.07 27.18 County of Los Angeles All-Hazards Mitigation Plan Page 90 of 204 mpal^wApNlV_SlAmplqJpqlN‘lNmpalApVa_aSŔaaLi]AV_m‘A_LV_pNTlApVa_aSŔaaLUA|AlL data into land use planning. The County also prioritizes the protection of critical SAJV]VpVNm A_L vq]_NlAI]N UaqmV_T pUlaqTU mVpN lNplaœpm‘ ilaiNlpy AJkqVmVpVa_‘ A_L e]NvApVa_ilaTlA^m-qI]VJaqplNAJUVmJa_LqJpNLpUlaqTUAIV]V_TqA]‘-accessible -laTlA^Sal-qI]VJ_Sal^ApVa_‘wUVJUila^apNmŔaaLmASNpyAwAlN_Nmm‘N^NlTN_Jy ilNiAlNL_Nmm‘A_LiAlpVJViApVa_V_pUN#ApVa_A]]aaL_mqlA_JN-laTlA^Ÿ#-  To ensure that mitigation is both data-driven and community-JN_pNlNL‘pUNaq_py qpV]V|NmJ]V^ApNila[NJpVa_mA_L"¯m?41^aLN]V_TpaV_Sal^V_vNmp^N_pm‘wUV]N coordinating with regional partners to align local actions with broader watershed strategies. Key components of the approach include: x 4iTlALV_T Jq]vNlpm‘ LNIlVm IAmV_m‘ A_L LlAV_ATN mympN^m pa ^A_ATN V_JlNAmNL runoff x Promoting low-impact development (LID) and incorporating green infrastructure in urban design x Updating ordinances and the General Plan to discourage development in high-risk areas x Maintaining inventories of repetitive loss areas and prioritizing resources for the most vulnerable populations This comprehensive strategy ensures Los Angeles County not only meets federal and mpApNmpA_LAlLmIqpALvA_JNmŔaaLlVm\lNLqJpVa_V_AwAypUApmASNTqAlLmiNai]N‘ ilaiNlpy‘A_L_ApqlA]mympN^mSalpUNSqpqlN 6.6.9 Summary Flooding is one of the most persistent and complex natural hazards in Los Angeles aq_py‘V_pN_mVœNLIyJ]V^ApNJUA_TN‘qlIA_V|ApVa_‘A_LATV_TV_SlAmplqJpqlN3UN!am _TN]Nm aq_py lNTVa_ NxiNlVN_JNm A lA_TN aS ŔaaL pyiNm‘including stormwater lq_aSS‘ŔAmUŔaaLV_T‘JaAmpA]V_q_LApVa_‘A_Liamp-wV]LœlNLNIlVmŔawm3UNmNNvN_pm are most common during winter storms and atmospheric river systems. High-density LNvN]ai^N_p‘NxpN_mVvNiAvNLmqlSAJNm‘A_LœlN-damaged hillsides contribute to rapid lq_aSSA_LV_JlNAmNLavNlA]]ŔaaLvq]_NlAIV]VpylNAmA]a_TŸIqp_ap]V^VpNLpa pUN!am _TN]Nm‘1A_AIlVN]‘A_L1A_pA]AlA0VvNlm‘AmwN]]AmJaAmpA] Ja^^q_VpVNm A_L SaapUV]]lNTVa_m‘AlNiAlpVJq]Al]yAplVm\ County of Los Angeles All-Hazards Mitigation Plan Page 91 of 204 Los Angeles County’s mitigation strategy is proactive and multifaceted. It includes V_SlAmplqJpqlNqiTlALNm‘_ApqlN-IAmNLma]qpVa_m‘]A_LqmNia]VJyqiLApNm‘A_LiqI]VJ NLqJApVa_alNilValVpVNmSaJqma_ilapNJpV_TJlVpVJA]SAJV]VpVNm‘lNLqJV_TNxiamqlNVn high-lVm\UaqmV_T‘A_Lila^apV_TJa^^q_VpylNmV]VN_JN-]A__V_TNSSalpmAlNmqiialpNL Iy"¯m?41lVm\^aLN]V_TA_L]aJA]J]V^ApNila[NJpVa_mNmiVpNilaTlNmm‘^alN pUA_‡…€‘€€€lNmVLN_pmlN^AV_AplVm\Sla^^A[alŔaaLNvN_pm‘lNV_SalJV_TpUN_NNLfor Ja_pV_qNLV_vNmp^N_pV_Ja^ilNUN_mVvN‘ŔaaLlVm\lNLqJpVa_AJlammpUNJaq_py 6.6.10 National Flood Insurance Program (NFIP) Repetitive Loss (RL) JJalLV_TpapUN!am_TN]Nmaq_py-qI]VJ:al\m‘pUNlNAlN……0NiNpVpVvN!ammŸ0!  properties in 28 RL areas of Unincorporated Los Angeles County as of 2025‘and 8 Severe Repetitive Loss Properties (SRLP). A Repetitive Loss (RL) property is any insurable IqV]LV_TSalwUVJUpwaal^alNJ]AV^maS^alNpUA_¸‘€€€wNlNiAVLIypUN#ApVa_A] Flood Insurance Program (NFIP) in any rolling 10-year period since 1978. Updated location information about RL properties in Unincorporated Los Angeles County were not avai]AI]NLqlV_TpUNLlASpV_TaSpUVmi]A_‘IqpVmINV_Tœ_A]V|NLA_LwV]]INV_J]qLNL in subsequent hazard mitigation efforts. Data from 2011 showed that 24 RL properties were located in the SFHA. ppUNpV^N‘pUN!am_TN]Nmaq_py-qI]VJ:al\mmpApNL‘¬pUN ^A[alVpyaSpUNlNiNpVpVvN]ammNmAlNAmmaJVApNLwVpU]aJA]V|NLqlIA_LlAV_ATNŔaaL ilaI]N^m‘NvN_SalilaiNlpVNmwVpUV_A"-LNmVT_ApNLŔaaL|a_N­3UN!am_TN]Nm County Public Works oversees RL mitigation projects. County of Los Angeles All-Hazards Mitigation Plan Page 92 of 204 CouCouCouCouCoCouCouCouCouCououuouCououCoCouCooCCCouCCCCCCCountyntyntyntynntntyntyntytyttytyntynttntyntyntyntyyyyyyyyyyyy ofofofofofofofofofoffooofofofofffffofofofoffofoofof LoLoLoLoLoLoLLoLoLoLoLoLoLoLoLoLoooLooLoLoooLoLoLoLoooooooooLLLooLoooLLLss As As As As As As AAsAs AsAsAs As As As AAsAs AssAss AsAs AssAss AAssssss Asssss As s Angngengengngengengengegegegeegeengngengegggeengengegengeengegengengengengegengeengegeengenglesleslesleslesleslessleseseseslesleslesleslelleselesleslesleslesleseselleleslesesssssssslesleleseesssslesleslsleesseslesssesssess AAAllAllAllAlAllAllAllAlAllAllAllAllAAAAAAAAAlAAAlllllAAAAAAAAAAAllAllAAAAAAAlAlAllllAAllAAAAAllllAAAAAAAlll----------------HazHazHazHHazHazHHHHazHazaHazaazHazHazHHHazHazHHazHHazazazHaHazHazazaHHazHazHaHazHazHHHHaHHHHHHHazHzHHHazzzzzHHHazzzzzzHHHHHaazHHazHaHHaHHaHazHazzHHHHHHHHaHaaazazazzzzzHHHHaHaHHaHazazzHazHazHzazazzzHazHHHaHHaHaHaazHazzHHazazHazazardardardardardardddardddddardardardardarddrdrdardardardardardardardarardaardardardardardaardaradaddrdaaaaaaardddrdaaaaaaaaararrrdrdrdddardrdardaaaaaaararardddardaardrardrddardaaraaaarrdardrddrdardrdardardrddaddardardardardrdddardardardardardardrdssMsMsMMsMMMMMMMsMMsMMssMsMMMMsMsMMMsMsMsMsMMMMMMMMMMMMMMMMssssMMsMMsMMsMssMMMMsMMMMMssMssMsMsMsMMMssssMsMsMMsMsMsMsMsMsMsssMsMsMssssMMMsMs Ms Ms Ms Mss MMMMs MMitiiiitiititiititiitiiitiittiititiiiitttiititttiiittititiiiiitttiiiititiittitiitiitttttitiiititiitiiittitititiitiitittiitiitiitiititiitiitiiitititititiitiitititi tttttttttttgatggggagaagaagatatatgatgatgatgatggggagaaagagatgggagaggagaattgatagataggagagatatgatggaaatatgatgatggatgatggatgatgattggaggagagatgggatgatatgatgatggatagatgatgagatgagataagiiiioninioniononnnniiononnniiiiionnnonnionnionioonionnioniioononnnnnnooonionioonononionnnionononionioonnionionionionionionnioonnioooooonononnnnionooononnnnoonnnnnn PPPPPlaPlaPlalaPlaPlaPlaPlalalPlPPPPPPPPPlPlPlalPlaPPPPlalPPPPPPPlallPPPPPlllnnnnnnnnnnnnnnnnnn 6.7 Dam Failure 6.7.1 Nature Dam failure refers to the structural collapse of a dam that results in the sudden and uncontrolled release of stored water. Such failures can occur due to age-lN]ApNL LNpNlValApVa_‘ V_ALNkqApN miV]]wAy JAiAJVpy‘ mplqJpqlA] LA^ATN Sla^ mNVm^VJ AJpVvVpy al ŔaaLV_T‘ A_L iaal maintenance. The catastrophic release of water from a dam failure has the potential to cause human JAmqA]pVNm‘mVT_VœJA_pNJa_a^VJ]amm‘A_L environmental destruction. This type of disaster is particularly dangerous because it can occur mqLLN_]y‘]NAvV_T]Vpp]NpV^NSalNvAJqApVa_al emergency response efforts. 3UN ^AT_VpqLN aS ŔaaLV_T Sla^ LA^ SAV]qlN often exceeds the capacity of downstream JUA__N]m‘ JAqmV_T lAiVL V_q_LApVa_ aS mqllaq_LV_T AlNAm 3UVm ŔaaLV_T JA_ ]NAL pa NxpN_mVvN ilaiNlpy LA^ATN‘ NlamVa_‘ V_SlAmplqJpqlNLNmplqJpVa_‘A_LJa_pA^V_ApVa_aS watelmqii]VNmLLVpVa_A]]y‘mNJa_LAlyUA|AlLm mqJUAm]A_Lm]VLNmA_LLNIlVmŔawmJA_IN plVTTNlNL‘Ja^iaq_LV_TpUNLVmAmpNl¯mV^iAJp The structural stress on dams may rise as dams ATN‘A_LJ]V^ApNvAlVAIV]VpyV_JlNAmNmpUNSlNkqN_JyaSNxplN^NilNJViVpApVan events. Planning efforts include both dams and debris basins. To simplify language of the plan both reservoir dams and storm water debris basins will be referred to as dams. County of Los Angeles All-Hazards Mitigation Plan Page 93 of 204 6.7.2 Location Los Angeles County has over 90 dams regulated by the California Department of Water Resources’ Division of Safety of Dams (DSOD). Fifteen (15) of these dams and eighteen (18) debris basins are owned and operated by the Los Angeles County Public Works Ÿ-: _‚€‡‘pUNA]VSal_VA!NTVm]ApqlN^A_LApNLpUApA]]mpApN-jurisdictional dams ŸNxJ]qLV_TpUamNJ]AmmVœNLAm!awA|AlL LNvN]aiLA^IlNAJUV_q_LApVa_^AimA_L Emergency Action Plans (EAPs) approved by DSOD and Cal OES. "A_yaSpUNmNLA^mAlN]aJApNL_NAlUVTU]yiaiq]ApNLAlNAm‘V_JlNAmV_TpUNiapN_pVA] for human and economic impacts during a failure event. Seventy (70) dams are J]AmmVœNLAmVTUalxplN^N]yVTUUA|AlLiapN_pVA]LA^m‘^NA_V_TpUNVlSAV]qlNJaq]L result V_mVT_VœJA_p]ammaS]VSNA_LwVLNmilNALilaiNlpyLA^ATN 3UN:UVppVNl#AllawmA^‘lNJ]AmmVœNLAmpUN41l^yalimaS_TV_NNlm¯Ÿ41  highest-ilValVpyLA^mASNpyJa_JNl_‘iamNma_NaSpUNTlNApNmplVm\mLqNpaVpmiapN_pVA] paŔaaLUVTU]yiaiq]ApNLAlNAmSla^-VJa0VvNlApa!a_T NAJU41 UAm determined that an extreme storm event has a 1 in 900 (0.1%) chance of causing catastrophic failure annually. Mitigation actions related to County-owned dams are prioritized based on their hazard level and potential to impact populated areas. For a better visual representation of this Dam Failure Hazard within the LA County i]A__V_TAlNA‘please reference Appendix A for all the County owned dams and debris basins maps. 6.7.3 Extent The Federal Guidelines for Inundation Mapping of Flood Risks Associated with Dam Incidents and Failures (FEMA P-‰„†‘ ‚€ƒ  JApNTalV|Nm LA^ UA|AlLm V_pa Saql J]AmmVœJApVa_m’ x Low Hazard’"V_V^A]LA^ATNNxiNJpNL‘_a]ammaS]VSN x 1VT_VœJA_pA|AlL: Potential for property damage and economic disruption. x High Hazard’!V\N]ypalNmq]pV_]ammaS]VSNA_LmVT_VœJA_pLA^ATNpaJlVpVJA] infrastructure. x xplN^N]yVTUA|AlLŸ1%]AmmVœJApVa_ : Could cause large-scale fatalities A_LV_q_LApNAlNAmwVpUavNl‘€€€lNmVLN_pm VvN_pUNiaiq]ApVa_LN_mVpyaS!am_TN]Nmaq_py‘ALA^SAV]qlNJ]AmmVœNLAmVTUal xplN^N]yVTUA|AlLwaq]L]V\N]yJAqmNmqImpA_pVA]Uq^A_JAmqA]pVNm‘LVmi]AJNN_pVlN Ja^^q_VpVNm‘A_LV_ŔVJpmNvNlNNJa_a^VJA_LN_vVla_^N_pA]LA^ATNTable 6-3 and 6-4 below shows a list of dams and debris basins owned by PW along with their hazard J]AmmVœJApVa_m-apN_pVA]^VpVTApVa_AJpVa_mLNmJlVINLV_pUVm"-AlNa_]yAii]VJAI]N to the dams and debris basins owned by PW and implementation of these actions are the responsibility of the PW Stormwater Engineering Division – Dams Section. County of Los Angeles All-Hazards Mitigation Plan Page 94 of 204 Table 6-3: Los Angeles County PW Dam Hazard Status Dam Name Hazard Status >ŽĐĂƟŽŶ ŝŐĂůƚŽŶ džƚƌĞŵĞůLJ,ŝŐŚ 'ůĞŶĚŽƌĂ͕ ŝŐ^ĂŶƚĂŶŝƚĂ džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕ ŝŐdƵũƵŶŐĂEŽ͘ϭ džƚƌĞŵĞůLJ,ŝŐŚ dƵũƵŶŐĂ͕ ŽŐƐǁĞůů džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕ ĞǀŝůƐ'ĂƚĞ džƚƌĞŵĞůLJ,ŝŐŚ >ĂŶĂĚĂ&ůŝŶƚƌŝĚŐĞ͕ >ŝǀĞKĂŬ džƚƌĞŵĞůLJ,ŝŐŚ >ĂsĞƌŶĞ͕ DŽƌƌŝƐ džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕ WĂĐŽŝŵĂ džƚƌĞŵĞůLJ,ŝŐŚ WĂĐŽŝŵĂ͕ WƵĚĚŝŶŐƐƚŽŶĞ džƚƌĞŵĞůLJ,ŝŐŚ ^ĂŶŝŵĂƐ͕ WƵĚĚŝŶŐƐƚŽŶĞŝǀĞƌƐŝŽŶ ,ŝŐŚ >ĂsĞƌŶĞ͕ ^ĂŶŝŵĂƐ džƚƌĞŵĞůLJ,ŝŐŚ >ĂsĞƌŶĞ͕ ^ĂŶ'ĂďƌŝĞůEŽ͘ϭ džƚƌĞŵĞůLJ,ŝŐŚ njƵƐĂ͕ ^ĂǁƉŝƚ džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕ ^ŝĞƌƌĂDĂĚƌĞ ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕ dŚŽŵƉƐŽŶƌĞĞŬ džƚƌĞŵĞůLJ,ŝŐŚ ůĂƌĞŵŽŶƚ͕ Table 6-4: Los Angeles County PW Debris Basin Hazard Status Debris Basin Name Hazard Status >ŽĐĂƟŽŶ ĂŝůĞLJĞďƌŝƐĂƐŝŶ ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕ ŝŐĂůƚŽŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚŽƌĂ͕ ůĂŶĐŚĂƌĚĞďƌŝƐĂƐŝŶ ,ŝŐŚ dƵũƵŶŐĂ͕ ƌĂŶĚĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚĂůĞ͕ ĂƚŽŶtĂƐŚĞďƌŝƐĂƐŝŶ džƚƌĞŵĞůLJ,ŝŐŚ WĂƐĂĚĞŶĂ͕ >ĂdƵŶĂĞďƌŝƐĂƐŝŶ džƚƌĞŵĞůLJ,ŝŐŚ ^ƵŶsĂůůĞLJ͕ >ĂŐƵŶĂZĞŐƵůĂƟŶŐĂƐŝŶ ^ŝŐŶŝĮĐĂŶƚ ůŚĂŵďƌĂ͕ >ŝƩůĞĂůƚŽŶĞďƌŝƐĂƐŝŶ džƚƌĞŵĞůLJ,ŝŐŚ 'ůĞŶĚŽƌĂ͕ >ŽǁĞƌ^ƵŶƐĞƚĞďƌŝƐĂƐŝŶ ,ŝŐŚ ƵƌďĂŶŬ͕ DŽƌŐĂŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ 'ůĞŶĚŽƌĂ͕ ZƵďŝŽĞďƌŝƐĂƐŝŶ ,ŝŐŚ ůƚĂĚĞŶĂ͕ ^ĂŶƚĂŶŝƚĂĞďƌŝƐĂƐŝŶ >Žǁ ƌĐĂĚŝĂ͕ ^ĂǁƉŝƚĞďƌŝƐĂƐŝŶ džƚƌĞŵĞůLJ,ŝŐŚ DŽŶƌŽǀŝĂ͕ County of Los Angeles All-Hazards Mitigation Plan Page 95 of 204 Debris Basin Name Hazard Status >ŽĐĂƟŽŶ ^ĐŚŽŽůŚŽƵƐĞĞďƌŝƐĂƐŝŶ ,ŝŐŚ >ŽƐŶŐĞůĞƐ͕ ^ŝĞƌƌĂDĂĚƌĞsŝůůĂ džƚƌĞŵĞůLJ,ŝŐŚ ^ŝĞƌƌĂDĂĚƌĞ͕ ^ƚĞǀĞŶƐŽŶZĂŶĐŚ ,ŝŐŚ ^ƚĞǀĞŶƐŽŶZĂŶĐŚ͕ ^ƚŽƵŐŚĞďƌŝƐĂƐŝŶ džƚƌĞŵĞůLJ,ŝŐŚ ƵƌďĂŶŬ͕ tŝůƐŽŶĞďƌŝƐĂƐŝŶ ,ŝŐŚ >ŽƐŶŐĞůĞƐ͕ 6.7.4 History Los Angeles County has experienced one of the deadliest dam failures in U.S. history: x St. Francis Dam Failure (March 12-ƒ‘‰‚ˆ ’ o Released 12.4 billion gallons of water o At least 411 fatalities o Devastated towns from San Francisquito Canyon to Ventura County o Resulted in sweeping changes to California dam safety regulations and the creation of state oversight for civil engineers :UV]N_a^A[alLA^SAV]qlNmUAvNaJJqllNLV_lNJN_pLNJALNm‘Ja_JNl_mavNlATV_T LA^V_SlAmplqJpqlN‘mNVm^VJlVm\m‘A_LV_JlNAmV_TJ]V^ApNvAlVAIV]VpyUAvNlAVmNLA]Al^m AIaqpSqpqlNlVm\m1pqLVNmV_LVJApNpUAp^A_yA]VSal_VALA^m‘V_J]qLV_TpUamNV_!am _TN]Nm aq_py‘ lNkqVlN mplqJpqlA] qiLApNm pa wVpUmpA_L ^aLNl_UyLla]aTVJA] conditions and potential seismic activity. There have been no federal declarations or mpApNilaJ]A^ApVa_mSalLA^SAV]qlNV_pUN]AmpœvNyNAlm 6.7.5 Dam Coordination Los Angeles County Public Works JaalLV_ApNmwVpU]aJA]‘mpApN‘A_LSNLNlA]ATN_JVNmpa ^VpVTApNŔaaLlVm\UA|AlLmpaLaw_mplNA^Ja^^q_VpVNmSla^VpmL A^mppUN]aJA]]NvN]‘ PW works with cities and public agencies during development of Emergency Action -]A_mŸ- 3UVmilavVLNm]aJA]mpA\NUa]LNlmwVpUpUNaiialpq_VpypalNvVNwpUN-‘ ilavVLNSNNLIAJ\‘A_LJa_œl^lNmia_mVIV]VpVNmA_Lla]NmLqlV_TA_-AJpVvApVa_p request from local [qlVmLVJpVa_m‘PW ^Ay ilavVLN paqlm aS Vpm LA^ SAJV]VpVNm‘ wUNlN information on dam safety and the potential hazards associated with dam failures are shared. ppUNmpApN]NvN]‘PW works with the DSOD to meet compliance with state dam safety mpA_LAlLm A_L ŔaaL ^A_ATN^N_p Ap A]] aSPW’s dams. This includes annual dam County of Los Angeles All-Hazards Mitigation Plan Page 96 of 204 V_miNJpVa_m‘lNvVNw‘AiilavA]‘A_LavNlmVTUpaSLA^Ja_mplqJpVa_ila[NJpm‘lNvVNwaS LA^mASNpy^a_VpalV_T‘A_LavNlmVTUpaSapUNlLA^mASNpylNTq]ApalyAJpVvVpVNmPW also JaalLV_ApNmwVpUvAlVaqmmpApNATN_JVNm‘V_J]qLV_T1%‘A]%1‘A_LA]plA_mLqlV_T development of EAPs. ppUNSNLNlA]]NvN]‘PW works with the Federal Energy Regulatory Commission (FERC) pa^NNpJa^i]VA_JNwVpUmpApNLA^SNLNlA]mpA_LAlLmA_LŔaaL^A_ATN^N_pApPW’s 1A_ AIlVN] A^‘ wUVJU Vm q_LNl 0 [qlVmLVJpVa_ 3UVm V_J]qLNm A__qA] LA^ V_miNJpVa_m‘lNvVNw‘AiilavA]‘A_LavNlmVTUpaSLA^Ja_mplqJpVa_ila[NJpm‘lNvVNwaS LA^mASNpy^a_VpalV_T‘-JaalLV_ApVa_‘A_LavNlmVTUpaSapUNlLA^mASNpylNTq]Apaly activities. PW also coordinates with the United States Army Corps of Engineers (USACE) on operations of interconnected dam facilities and emergency response planning for USACE facilities that may be in the pathway of dam failure impacts. Information Sharing PW ilavVLNmJlVpVJA]V_Sal^ApVa_palN]NvA_p]aJA]‘mpApN‘A_LSNLNlA]mpA\NUa]LNlmpa address hazard mitigation related to dam safety. This includes: x Emergency Action Plans (EAPs): -maqp]V_NpUNla]Nm‘lNmia_mVIV]VpVNm‘A_L procedures to follow in the event of a dam emergency. The EAPs include V_q_LApVa_^Aim‘wUVJUmUawAlNAmpUApwaq]LINASSNJpNLIyALA^SAV]qlN‘ helping to identify populations at risk. These plans are shared with stakeholders to ensure a coordinated response. Due to the sensitive nature of information Ja_pAV_NLwVpUV_pUN-m‘pUNyAlNJa_œLN_pVA]A_L_aplN]NAmNLpapUNTN_NlA] public. x Inundation Maps: Inundation maps are critical tools for identifying areas and populations at risk in the event of a dam failure. They also indicate potential V^iAJpm a_ JlVpVJA] V_SlAmplqJpqlN SAJV]VpVNm mqJU Am UamiVpA]m‘ mJUaa]m‘ A_L transportation networks. These maps are shared with relevant stakeholders recognized in the EAP and are available to the general public through the DSOD Dam Breach Inundation Map Web Publisher. 6.7.6 Probability Los Angeles County contains over 90 state-[qlVmLVJpVa_A]LA^m‘wVpUAiilaxV^ApN]y‡€ J]AmmVœNLAmVTUalxplN^N]yVTUA|AlLIypUNA]VSal_VAVvVmVa_aS1ASNpyaSA^m Ÿ1% ‘ ^NA_V_T pUNVl SAV]qlN Jaq]L lNmq]p V_ ]amm aS ]VSN A_LmVT_VœJA_p ilaiNlpy damage. County of Los Angeles All-Hazards Mitigation Plan Page 97 of 204 ]pUaqTUJa^ilNUN_mVvNSAV]qlNilaIAIV]VpVNmAlN_apiqI]VmUNLSalNAJULA^‘" and DSOD guidance suggest that the general annual probability of failure for High A|AlLLA^m_ApVa_wVLNlA_TNmSla^€€Èpa€ÈŸalV_€‘€€€paV_‘€€€  depending on ^AV_pN_A_JN‘ATN‘mNVm^VJvq]_NlAIV]Vpy‘A_LapUNlmVpN-miNJVœJSAJpalm Applying this range to Los Angeles County: x 3UN ATTlNTApN A__qA] ilaIAIV]Vpy aS A mVT_VœJA_p LA^ SAV]qlN NvN_p V_ pUN county—across one or more of the 70 high-risk dams—is estimated at between €ÈA_L€…ÈA__qA]]y‘SAJpalV_TJq^q]ApVvNNxiamqlNA_LLVSSNlN_pUA|AlL J]AmmVœJApVa_mŸ1qJUAmNAlpUkqA\NalŔaaLlN]ApNL  x ]V^ApNJUA_TN‘ATV_TV_SlAmplqJpqlN‘A_LmNVm^VJAJpVvVpyV_!am_TN]Nmaq_py increase systemic risk across multiple structures simultaneously. _mq^^Aly‘wUV]NpUNV_LVvVLqA]]V\N]VUaaLaSSAV]qlNSalA_ya_NLA^VmvNly]aw‘pUN overall countywide probability of at least one major dam failure event is low but still wAllA_pmJa_pV_qNLvVTV]A_JN‘^AV_pN_A_JN‘A_LN^NlTN_Jyi]A__V_T 6.7.7 Vulnerability A catastrophic dam failure in Los Angeles County could have severe consequences for Uq_LlNLm aS pUaqmA_Lm aS lNmVLN_pm3UN LN_mN]y iaiq]ApNL _ApqlNaSpUNJaq_py‘ combined with the location of several large dams near residential and commercial AlNAm‘V_JlNAmNmpUNiapN_pVA]SalwVLNmilNALLVmi]AJN^N_p‘]ammaS]VSN‘A_LNJa_a^VJ LA^ATN3UN‚€‚„30VLN_pVœNm^q]pVi]NUVTU-risk zones where dam failure could lNmq]pV_NxpN_mVvNŔaaLV_TA_L^AmmNvAJqApVa_m x High-lVm\LA^m‘A^a_TapUNlm‘iamNAmVT_VœJA_ppUlNAppaLN_mN]yiaiq]ApNL communities. A breach in any of these dams could inundate entire _NVTUIalUaaLm‘ASSNJpV_T^alNpUA_…€€‘€€€lNmVLN_pmV_]aw-lying areas and ŔaaLi]AV_m x 1aJVA]]y vq]_NlAI]N iaiq]ApVa_m‘ V_J]qLV_T N]LNl]y V_LVvVLqA]m‘pUN# Ja^^q_Vpy‘iNai]NNxiNlVN_JV_TUa^N]Nmm_Nmm‘]aw-V_Ja^NJa^^q_VpVNm‘A_L non-English-speaking residents face heightened risks during evacuations and lNJavNlyLqNpa]V^VpNL^aIV]Vpy‘œ_A_JVA]Ja_mplAV_pm‘A_LAJJNmmpalNmaqlJNm x LqJApVa_A]A_LUNA]pUJAlNV_mpVpqpVa_mAlNAplVm\‘wVpUmNvNlA]mJUaa]m‘UamiVpA]m‘ and long-pNl^JAlNSAJV]VpVNm]aJApNLV_ŔaaL-prone areas. A major dam failure Jaq]L lNmq]p V_ mJUaa] J]amqlNm‘ LVmi]AJN^N_p aS mpqLN_pm‘ A_LLVmlqipVa_ aS healthcare services. County of Los Angeles All-Hazards Mitigation Plan Page 98 of 204 x vAJqApVa_A_LN^NlTN_JymUN]pNlV_TLN^A_Lmwaq]LINmqImpA_pVA]‘lNkqVlV_T the rapid mobilization of resources to support displaced residents. Temporary mUN]pNlm‘N^NlTN_Jy^NLVJA]mNlvVJNm‘A_Llogistical support would need to be activated to accommodate evacuees. !am_TN]Nmaq_pylN]VNmUNAvV]ya_LA^mA_LlNmNlvaVlmSalwApNlmpalATN‘ŔaaL Ja_pla]‘A_Lmqii]ylNTq]ApVa_ApAmplaiUVJLA^SAV]qlNiamNmA_AJqpNpUlNAppa]VSN A_LilaiNlpy‘NmiNJVA]]yV_]aw-]yV_T‘UVTU]yiaiq]ApNLLaw_mplNA^AlNAm Extent of Exposure x Total Area Exposed : 490.64 sq mi x Supervisorial Districts (SD) Impacted: o SD5: 223.88 sq mi (7.97%) o SD1: 162.25 sq mi (45.98%) o SD2: 66.57 sq mi (18.32%) o SD3: 25.76 sq mi (5.97%) o SD4: 12.17 sq mi (5.72%) x Critical Facilities Affected: o Fire Department: 112 (33.22%) o Public Works: 92 (40.00%) o Health Services: 29 (44.62%) o Public Health: 17 (42.50%) o Libraries: 30 (34.48%) o Parks: 65 (35.50%) o Education: 34 (41.46%) Problem Statement Dam SAV]qlN‘wUV]NlAlN‘JA_UAvNJApAmplaiUVJJa_mNkqN_JNmV_LN_mN]yiaiq]ApNL Law_mplNA^ AlNAm :VpU mVT_VœJA_p ialpVa_m aS JlVpVJA] V_SlAmplqJpqlN NxiamNL— particularly in SD1 and SD5—i]A__V_T Sal N^NlTN_Jy NvAJqApVa_m‘ NAl]y wAl_V_T mympN^m‘V_SlAmplqJpqlNUAlLN_V_T‘A_LLaw_mplNA^LNvN]ai^N_plNTq]ApVa_VmJlVpVJA] to saving lives and reducing loss. County of Los Angeles All-Hazards Mitigation Plan Page 99 of 204 A failure or breach of a High Hazard Potential Dam (HHPD) in Los Angeles County waq]L lNmq]p V_ JApAmplaiUVJ Ja_mNkqN_JNm Sal Law_mplNA^ Ja^^q_VpVNm‘ wVpU pUN greatest vulnerabilities concentrated in densely populated urban areas. Rapid and ^AmmVvN ŔaaLV_T waq]L ]V\N]y V_q_LApN lNmVLN_pVA] _NVTUIalUaaLm‘ Ja^^NlJVA] LVmplVJpm‘A_LV_LqmplVA]|a_NmwVpUV_^V_qpNmpaUaqlm‘LNiN_LV_Ta_ilaxV^VpyA_L topography. Critical infrastructure—V_J]qLV_TUamiVpA]m‘œlNA_Lia]VJNmpApVa_m‘mJUaa]m‘ and major transportation corridors—waq]L IN mNvNlN]y V^iAJpNL‘ LVmlqipV_T N^NlTN_JymNlvVJNmA_LNvAJqApVa_laqpNm3UaqmA_LmaSiNai]N‘V_J]qLV_Tvq]_NlAI]N iaiq]ApVa_mmqJUAmpUamNwVpUJJNmmA_Lq_JpVa_A]#NNLmŸ# ‘N]LNl]ylNmVLN_pm‘ and low-V_Ja^N UaqmNUa]Lm‘ wauld face immediate life-pUlNApN_V_T Ja_LVpVa_m‘ LVmi]AJN^N_p‘A_L]V^VpNLAJJNmmpa^NLVJA]JAlNalmUN]pNlJa_a^VJ]ammNmwaq]LIN Ja^iaq_LNLIyLA^ATNpaqpV]VpVNm‘V_J]qLV_TiawNlmqImpApVa_mA_LwApNlmympN^m‘ potentially leaving large swaths of the region without essential services. The sheer scale aSLNvAmpApVa_Sla^ALA^SAV]qlN‘NmiNJVA]]yApSAJV]VpVNmmqJUAm:UVppVNl#Allawmal AmpAVJA^‘q_LNlmJalNmpUNJlVpVJA]V^ialpA_JNaSJa_pV_qNLlVm\lNLqJpVa_‘NAl]y wAl_V_TmympN^m‘A_LLA^lNUAIV]Vtation efforts. 6.7.8 Data Limitations A limitation of this AHMP is that planning efforts only covered PW-owned dams in Los Angeles County. Future mitigation planning should include other dam owners and operators in Los Angeles County such as the US Army Corps of Engineers. The data on high-hazard dams reviewed during the 2025 AHMP planning process was generally suitable for the analysis required. Future opportunities for obtaining additional data to be considered in the next update to the plan should: x Incorporate more current information as it becomes available. x Assess any new or updated EAPs for dams owned by Los Angeles County. x Identify and review more current structural or condition assessment data to inform future risk assessments. x Involve other dam owners within Los Angeles County in future planning efforts. 6.7.9 Impacts A dam failure in Los Angeles County would have catastrophic and immediate Ja_mNkqN_JNmSal]VSN‘ilaiNlpy‘A_LJlVpVJA]V_SlAmplqJpqlN‘iAlpVJq]Al]yV_pUNLN_mN]y populated downstream areas. The sudden release of impounded water from a High or Extremely HVTUA|AlLLA^Jaq]LV_q_LApN_NVTUIalUaaLmwVpUV_^V_qpNm‘A]]awV_T ]Vpp]Npa_apV^NSalNvAJqApVa_"alNpUA_…€€‘€€€lNmVLN_pm]VvNwVpUV_VLN_pVœNLLA^ V_q_LApVa_ |a_Nm‘ ^A_y aS wUa^ AlN V_ maJVA]]y vq]_NlAI]N iaiq]ApVa_m—including County of Los Angeles All-Hazards Mitigation Plan Page 100 of 204 V_LVvVLqA]mwVpU]V^VpNL^aIV]Vpy‘]aw-V_Ja^NUaqmNUa]Lm‘A_LiNai]NNxiNlVN_JV_T homelessness—making rapid evacuation and sheltering especially challenging. County-owned high hazard potential dams and their locations are listed in Table 6-3. Inundation maps for County-owned high hazard potential dams are listed in Appendix A-7. Critical infrastructure is also at mVT_VœJA_plVm\amiVpA]m‘œlNmpApVa_m‘]AwN_SalJN^N_p SAJV]VpVNm‘ N^NlTN_Jy aiNlApVa_m JN_pNlm‘ mJUaa]m‘ A_L wAmpNwApNlplNAp^N_pi]A_pm ]aJApNL V_ Law_mplNA^ |a_Nm ^Ay IN LA^ATNL al lN_LNlNL V_aiNlAI]N‘ mNvNlN]y disrupting emergency response and life-sustaining services. Major transportation laqpNmmqJUAmV_pNlmpApNm‘lAV]]V_Nm‘A_LAlpNlVA]laALmJaq]LINmqI^NlTNLalwAmUNL aqp‘V^iNLV_TlNmJqNA_LlNJavNlyNSSalpmLLVpVa_A]]y‘iawNlmqImpApVa_m‘ wApNl LVmplVIqpVa__Npwal\m‘A_LpN]NJa^^q_VJApVons infrastructure could suffer cascading SAV]qlNm‘Ja_plVIqpV_TpawVLNmilNALaqpATNmA_Lila]a_TNLlNJavNlyiNlVaLm The economic consequences of dam failure would be immense. Beyond property LA^ATN‘ IqmV_Nmm aiNlApVa_m V_ V_q_LApNL AlNAm waq]L UA]p‘ ]NALV_T pa ]amm aS N^i]ay^N_p‘pAxlNvN_qN‘A_LNJa_a^VJAJpVvVpy_LqmplVA]|a_NmŸNmiNJVA]]ypUamN_NAl ^A[al ŔaaL Ja_trol reservoirs or channels) could potentially release hazardous ^ApNlVA]mVSavNlwUN]^NL‘iamV_TmNJa_LAlyN_vVla_^N_pA]A_LiqI]VJUNA]pUUA|AlLm NIlVm AJJq^q]ApVa_‘ mNLV^N_pApVa_‘ A_L Ja_pA^V_ApVa_ Jaq]L mNvNlN]y V^iAJp NJamympN^m‘wApNlkqA]Vpy‘A_LŔaaLJa_pla]V_SlAmplqJpqlNLaw_mplNA^‘Ja^i]VJApV_T both emergency cleanup and long-term environmental recovery. VvN_pUNmJA]NaSiapN_pVA]V^iAJpm‘LA^SAV]qlNVmJa_mVLNlNLAmpAI]N]aw-probability but high-Ja_mNkqN_JNUA|AlLV_!am_TN]Nmaq_py‘lNkqVlV_TJa_pV_qNLV_vNmp^N_p V_mplqJpqlA]^VpVTApVa_‘N^NlTN_JyilNiAlNL_Nmm‘A_LiqI]VJAwAlN_NmmpalNLqJNpUN severity of its effects. 6.7.10 High Hazard Potential Dams Goals aA]’_UA_JNlNmV]VN_JNAJlammLA^LNIlVmIAmV_V_SlAmplqJpqlN‘V_J]qLV_TUVTU- UA|AlLiapN_pVA]LA^m‘A_LapUNlJlVpVJA]SAJV]VpVNmwVpUV_LA^V_q_LApVa_|a_Nm aA]‚’Encourage structural reinforcement or lNplaœpmSalATV_TA_Lvq]_NlAI]NLA^m aA]ƒ’Ensure all dams/ debris basins have updated Emergency Action Plans (where applicable) and updated dam inundation mapping consistent with state standards. County of Los Angeles All-Hazards Mitigation Plan Page 101 of 204 6.7.11 Mitigation and Preparedness Los Angeles County and state agencies have implemented various mitigation efforts to reduce the risks associated with dam failures: x 1plqJpqlA]0NV_SalJN^N_pm’4iTlALV_TmiV]]wAym‘mplN_TpUN_V_TNAlpUN_LA^m‘ A_LV^i]N^N_pV_TmNVm^VJlNplaœppV_T^NAmqlNm x Emergency Action Plans (EAPs): Mandated by DSOD for all High and Extremely High hazard dams to guide evacuation and response efforts. x Early Warning Systems: ^ilavNL ŔaaL ^a_VpalV_T A_L Aqpa^ApNL A]Nlp systems to notify at-risk communities in real-time. 6.7.12 High Hazard Potential Dam Prioritization The risk assessment within the 2025 AHMP considers the county planning area’s vulnerability and potential impacts related to HHPDs. Mitigation actions and planning efforts that are related to mitigating long-term vulnerabilities to County-owned HHPDs will automatically be given a HIGH priority as described in the overall mitigation action prioritization criteria in Section 7.6. The County Departments responsible for V^i]N^N_pV_T pUN AmmaJVApNL ^VpVTApVa_ AJpVa_m‘ A]a_T wVpU pUNilValVpy‘ iapN_pVA] funding saqlJN‘A_LNxiNJpNLpV^NSlA^NAlN]VmpNLV_1NJpVa_‡ˆ 6.7.13 Summary Los Angeles County has 90 state-[qlVmLVJpVa_A]LA^m‘wVpU‡€J]AmmVœNLAmVTUal xplN^N]yVTUUA|AlL‘^NA_V_TpUNVlSAV]qlNJaq]LlNmq]pV_wVLNmilNAL]ammaS]VSNA_L NJa_a^VJLNvAmpApVa_:UV]NlNTq]ApalyavNlmVTUpUAmV^ilavNLLA^mASNpy‘ ATV_T infrAmplqJpqlN‘mNVm^VJpUlNApm‘A_LV_JlNAmNLmpal^V_pN_mVpylN^AV_ JUA]]N_TNm a_pV_qNLV_vNmp^N_pV_lNplaœpm‘NAl]ywAl_V_TmympN^m‘A_LN^NlTN_Jyi]A__V_TVm essential to mitigating the risk of catastrophic dam failures. County of Los Angeles All-Hazards Mitigation Plan Page 102 of 204 CoCCCouCouCouCCoCoCoCouCouCouCouCoCouCouuCCCCCCCCooouououCoCCCCCCCCCouCoCCCCouuuCCCoCCCoCouCoCouCoCoCoCCCCCCuouCoCCCCuouCuuuCCCCCCouCCCCououCCCCCCouCCoCououuCCoCoCCouCCCCCoCCCCoCoouuCCCCCoCCCoCoCoooCCooCoCCCCCoCCCoonntyntyntyntyntyntyntyntyntyntytyntyntyntyntyntyntyntyntyntyntyntntyntyntyntytntyntntyntynttytyntyntyntyntyntntyyntyntyntynntytyntyntyntyntynnnnntyntynntyntyntynnntynntyntntynntyyntyyyntytyytttynnntytnntyt ofofofofoffofofoofofofofofofofofofofofofofofofofofoofoffofofofoffoofoffofofofoffffffoffffffffooffooffoooffff LoLLLLLoLoLoLLLoLoLoLoLooLoLoLoLLoLoLoLoLoLoLLoLoLLLLLLoLoLoLoooLLoLoLoLoLoLLoLoLLLLoLoLoLooLooLLoLLoLoLoLoLLoLoLoLLoLoLooLoLoLooLooLoLLoLoLoooLoooLoLoLoooooLoLoLoLoLooLoLoLoLoLoLLLoos AsAs As As AsAs As As AAAAs AAAs AAAAAAs As As AAs AAAs AAAAAAAAs As AsAsAs AAs AAsAAAs As AAAAAs AAAAAAAsAsAs As As AAAAAs Ass As As AAs As AsAAAs AsAs AAAs AAs AAAAss As AAs As AAss AsAsAAAs AAAAsAsAs AAsAsAAAAAssAsAAAAAsAsAAAAAAsAAAsAs AAs AAs ss sss ngngengnngngngengngngengngengegegegegengegengengegegegeegeegengegegegeenggenggegegengengegengegengngengnnngeggggegengegeengeeeeengengennngnnggngeegegennngengengengggngngngngeengengngengggngeegeggeggggengengeegegenngnngengennngngengennngenggeggggenngenggeeennggggennnnngggennnngngggggegggggggglesleslesleesleesleseseseseseseslesleslesleslelesleseslelleslesesleeslesesesslellelelllesleleleseleslesesessleleeeseeesseleeleeeesleleeeesesseseslleeeelleeeesllees AllAllAllAAllAllAllAllAllAAllAllAAAAllAllAllAllAllAAlAlAllAllAllAllAAlAllAAllAAAAlAA--------HHHaHazHazazzHazHazHazzazHazaHHHHHaHazazHazzzHHHHHHHHHHHHazaazHHaazzzzHHHHazHazaazHazzzHHHHHHazzazHHHHHHazHazazazzHHHazzHHHHHHHzzHHHHaaaaazHHHHHaHHHHHHazzHHHaazHHHHHHHHHHHHaaaazHHHaazHHHHHaaaHHHHHHHazzHHHazHHazaaardaardardrdardardardardardardaardarardaardarddrdarrdddddadddarararddddaaaaarardrdardardardrddardrdrrdrrrarrrradaadrrs Ms MsMsMsMs Ms s Ms MMMMMMMMMMMMMMs MMMMMMMMMMs Msss MsMMMMMMMMMMMsMMMsMs sMsMMMMMMMMMMMsMMMsMssMMMMMMs MsMs MMMMMMs Mss MMMss sMMMMMMsMMMMMMMssssMMMMMMMMMsss MMMsss MMMMMMMMMMMMMMMMMMMMs MMMsMMMMMMsMMMMMMMMMMMMMMMMMM iitiitiitiitiitiitititiiiitittttitititiitiitiiiiiiititiititiitiiitititiitiiiiiititiititiititiititititiittiittittitttitgatgagatgatgagagagagataatatgatgatgatatatgatatatatgagagagagagatatgatgagatatgatgatgagatgattgatgatgataaaagatgatgatgatgatggatgatagatgatgagagagatgatgatagatgatggggatgatatattatggtgatggatatggagaggggatgatatttggaagagaaaaatggagagagaaggggggggggggggg oionnionionononononoioioononioniononioniononoononionionionionionionononnonionionioonionioonononionionononioononionionononnonioononononionoonionoonniioonooonononnnnnonnnonnnonionoonnonnnonnonioionoonnoooniononooo PlalaPlaPlaPlaPlaPlPlalPllPlaaPlaPlaPlaPlalPlaPlPlaPlaPlaPlaPlPlaPlalaPlPlaPllPlaPlaPlaPlPllaPlaPlaPlaPlaPlaPlaPlaPlaPlaaaPlaaPlaPlaPPlaPlaalaPlaaaPPlalaaaaPPlalPlaaaPPlaPlaaPPaaPlaPlaaaaaPlaPlaPlPlaPlaPlaPlaaPlaPPPlllaPlaaPPPPlPPPllaaaPPPPPPaPlaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6.8 Land Movement 6.8.1 Nature Land movement refers to the downward ^avN^N_p aS laJ\‘ maV]‘ al LNIlVm A]a_T A slope due to gravity. This process can occur mqLLN_]yalTlALqA]]yavNlpV^N‘LNiN_LV_T on contributing factors such as soil Ja^iamVpVa_‘ m]aiN mpAIV]Vpy‘ A_L NxpNl_A] triggers. Land movement encompass a variety of movement types including ^qLŔawm‘ laJ\SA]]m‘ LNIlVm Ŕawm‘ ]A_L m]q^im‘ ]A_L mqImVLN_JN‘ A_L maV] ^avN^N_p _ !am _TN]Nm aq_py‘ pUN diverse topography and geological formations make certain areas more prone to land ^avN^N_p‘iAlpVJq]Al]yLqlV_TiNlVaLm aS V_pN_mN ilNJViVpApVa_‘ mNVm^VJ AJpVvVpy‘ al human land-qmN^aLVœJApVa_m Climate change exacerbates land movement by increasing the frequency and intensity of NxplN^N wNApUNl NvN_pm‘ mqJU Am UNAvy lAV_SA]] A_L ŔaaLV_T‘ wUVJUJA_]NALpa accelerated erosion and heightened landslide risks. County of Los Angeles All-Hazards Mitigation Plan Page 103 of 204 !A_L^avN^N_paSpN_aJJqlV_Ja_[q_JpVa_wVpUapUNl_ApqlA]UA|AlLm‘NxAJNlIApV_T their impact. Some of the primary contributing factors include: x Seismic Activity’AlpUkqA\NmJA_LNmpAIV]V|Nm]aiNm‘]NALV_Tpa]A_L^avN^N_p A_LlaJ\SA]]m3UNSalJNaSmNVm^VJmUA\V_TJA_JAqmNmqLLN_SAV]qlNm‘iAlpVJq]Al]yV_ areas with pre-existing instability. x NAvy0AV_SA]]A_L]aaLV_T: The likelihood of land movement increases after mqJJNmmVvNmpal^m-la]a_TNLalV_pN_mNlAV_SA]]mApqlApNmmaV]‘lNLqJV_TVpmJaUNmVa_ and triggering slope failures. x Coastal Erosion’:AvNmA_Lmpal^mqlTNNlaLNJaAmpA]J]VSSm‘]NALV_TpaV_mpAIV]Vpy A_LNvN_pqA]Ja]]AimN‘iAlpVJq]Al]yV_AlNAmmqJUAmaq_pyINAJUNmA_LJaAmpA] Ja^^q_VpVNm‘^A_yaSwUVJUUAvNilNvVaqm]yNxiNlVN_JNLmVT_VœJA_pNlamVa_ x :V]LœlNm’!ammaSvNTNpApVa_LqNpaœlNmlNLqJNmpUNmaV]¯mAIV]VpypalNpAV_^aVmpqlN‘ making slopes more susceptible to erosion and land movement during subsequent rain events. x Burn Scars’:V]LœlNIql_mJAlmmVT_VœJA_p]yN]NvApNpUNlVm\aS]A_L^avN^N_pIy mplViiV_TpUN]A_LaSmpAIV]V|V_TvNTNpApVa_lNAmASSNJpNLIy^A[alœlNmmqJUAmpUN :aa]mNyVlNŸ‚€ˆ ‘ aIJApVlNŸ‚€‚€ ‘ lVLTNVlNŸ‚€‚„ ‘Apa_VlNŸ‚€‚… ‘A_L Palisades Fire (2025) have shown increased susceptibility to land movement due to reduced soil stability and rapid runoff during rainstorms. 6.8.2 Location Los Angeles County is home to multiple regions susceptible to land movement due to mpNNim]aiNm‘q_mpAI]NTNa]aTy‘A_LwNApUNliAppNl_m3UNA]VSal_VANa]aTVJA]1qlvNy (CGS) Landslide Susceptibility Map highlights high-risk areas. For a better visual replNmN_pApVa_aSpUN!A_L"avN^N_pA|AlLwVpUV_pUN!aq_pyi]A__V_TAlNA‘ please reference Appendix A for maps that show areas that are susceptible to land movement and recent burn scars. Potential land movement areas include (but are not limited to): x Santa Monica Mountains x San Gabriel Mountains x Sierra Pelona Mountains x Baldwin Hills x Puente Hills x Palos Verdes Hills County of Los Angeles All-Hazards Mitigation Plan Page 104 of 204 3UNmN AlNAm AlN iAlpVJq]Al]y vq]_NlAI]N LqN pa pUNVl mpNNi pNllAV_m‘ wNA\ laJ\ Sal^ApVa_m‘ A_L UVmpaly aS m]aiN ^avN^N_pLLVpVa_A]]y‘ Uq^A_AJpVvVpVNm mqJU Am TlALV_T‘ NxJAvApVa_‘ A_L Ja_mplqJpVa_ V_ pUNmN lNTVa_m JA_ SqlpUNl LNmpAIV]V|N pUN Tlaq_L‘V_JlNAmV_TpUN]V\N]VUaaLaS]A_L^avN^N_plNAmV^iAJpNLIyiAmpwV]LœlNm‘ \_aw_AmIql_mJAlm‘AlNA]maUVTU]ymqmJNipVI]Npa]A_L^avN^N_p‘AmpUN]ammaS vegetation reduces soil stability and increases erosion risks during heavy rains. This is particulal]yJa_JNl_V_TV_wV]LœlN-prone areas such as the Santa Monica Mountains and pUNSaapUV]]maSpUN1A_AIlVN]"aq_pAV_m‘wUNlNiamp-œlN ]A_L ^avN^N_p UAvN UVmpalVJA]]yJAqmNLmVT_VœJA_pLA^ATN 6.8.3 Extent 3UNNxpN_paS]A_L^avN^N_pV_!am_TN]NmVmmVT_VœJA_pA_LvAlVNL‘V_ŔqN_JNLIyVpm q_VkqNTNa]aTVJA]mNppV_TJJalLV_TpapUN‚€1!A_Lm]VLN1qmJNipVIV]Vpy"Ai‘ approximately 750 square miles (15.75%) of Los Angeles County fall within high-risk landslide zones. The highest concentrations of deep-seated landslide susceptibility are distributed as follows: Table 6-5 Landslide Susceptibility Map Area High-0Vm\!A_Lm]VLN?a_Nm Ÿmk^V]Nm  Percentage of Total Land Area Los Angeles County 750.02 15.75% Unincorporated Areas 577.63 18.99% Supervisorial District 1 17.29 7.02% Supervisorial District 2 2.73 1.68% Supervisorial District 3 114.61 26.58% Supervisorial District 4 105.12 23.89% Supervisorial District 5 509.31 18.14% County of Los Angeles All-Hazards Mitigation Plan Page 105 of 204 6.8.4 History !A_L^avN^N_pUAvNUVmpalVJA]]yJAqmNLmVT_VœJA_pLA^ATNV_!am_TN]Nmaq_py‘ aSpN_lNmq]pV_TV_ilaiNlpyLNmplqJpVa_‘V_SlAmplqJpqlNLA^ATN‘A_LlaALJ]amqlNmThere UAvNINN__aSNLNlA]LNJ]AlApVa_malmpApNilaJ]A^ApVa_mSalLA^SAV]qlNV_pUN]AmpœvN years. Some of the most notable events include: x 1956 – Portuguese Bend Landslide: A massive landslide on the Palos Verdes Peninsula began in 1956 and remains active today. The movement of land has LVmi]AJNLUa^NmA_LV_SlAmplqJpqlN‘UVTU]VTUpV_TpUNlNTVa_¯ma_TaV_TTNa]aTVJ instability. x 1994 – #alpUlVLTN AlpUkqA\N-Induced Land movement: The earthquake plVTTNlNL^alNpUA_‘€€€^avV_TNvN_pm‘ilV^AlV]yV_pUN1A_pA1qmA_A"aq_pAV_m A_L1A_AIlVN]"aq_pAV_m‘JAqmV_TNxpN_mVvNlaALA_LmplqJpqlA]LA^ATN x March 1995 – -AJVœJ -A]VmALNm !A_Lm]VLN: Heavy rains weakened the coastal I]qSSm‘]NALV_TpaAƒ€€-foot-wVLNJa]]AimNpUApIqlVNLiAlpaSpUN-AJVœJaAmp Highway under 30 feet of debris. x March 2005 – Sunset Mesa Landslide: A slope failure near Malibu caused over ‚€‘€€€JqIVJyAlLmaSLNIlVmpaI]aJ\laALwAymA_LLA^ATNilaiNlpy x July 2023 – -NAlplNN!A_N!A_L"avN^N_pŸ0a]]V_TV]]mmpApNm : A sudden m]aiNSAV]qlNlNmq]pNLV_pUNLVmi]AJN^N_paS‚Ua^Nm‘wUVJUwNlNlNL-tagged due to structural instability. x September 2024 – JJN]NlApNL!A_L"avN^N_pV_0A_JUa-A]am9NlLNm: A mVT_VœJA_pV_JlNAmNV_]A_L^avN^N_p‘wVpUJNlpAV_AlNAmmUVSpV_TqipaSaqlV_JUNm iNlwNN\pawAlLpUNaJNA_‘pUlNApN_V_TlaALmA_LavNl‚…€lNmVLN_pVA]ilaiNlpVNm 6.8.5 Types of Land Movement Debris Flow"qLŔaw1aV]"avN^N_p NIlVmŔawV_va]vNmpUNlAiVL^avN^N_paSALN_mN^VxpqlNaSwApNl‘maV]‘laJ\‘A_L alTA_VJ ^ApNlVA] Law_ A m]aiN 3UVm ilaJNmm JA_ UAvN mVT_VœJA_pV^iAJpma_ ]A_LmJAiNm‘NJamympN^m‘A_LUq^A_V_SlAmplqJpqlN NIlVmŔawmAlNJUAlAJpNlV|NLIypUNVlŔqVL-like behavior and ability to transport large aI[NJpm‘mqJUAmIaq]LNlmA_LplNNm3UNyJA_plAvN]ApUVTUmiNNLm^A\V_TpUN^UVTU]y LNmplqJpVvN3UNJa^iamVpVa_aSALNIlVmŔawJA_vAly‘IqpVppyiVJA]]yV_J]qdes: County of Los Angeles All-Hazards Mitigation Plan Page 106 of 204 x Water: A crucial component that facilitates movement. x 1aV]A_L0aJ\’3UNmNilavVLNpUNIq]\aSpUN^ApNlVA]V_ALNIlVmŔaw x Organic Material: Includes vegetation and other natural debris that get caught in pUNŔaw "qLŔawm AlN lAiVLmovements of water-saturated earth materials that can cause mVT_VœJA_pLA^ATNpaIapU_ApqlA]N_vVla_^N_pmA_LUq^A_mNpp]N^N_pm"qLŔawm AlNJUAlAJpNlV|NLIypUNVlŔqVL-]V\N^apVa_‘wUVJUaJJqlmwUN_maV]‘laJ\m‘A_LLNIlVm become saturated with water. 3UVmmApqlApVa_lNLqJNmpUNSlVJpVa_INpwNN_iAlpVJ]Nm‘ A]]awV_TpUN^Ammpa^avNLaw_UV]]q_LNlpUNV_ŔqN_JNaSTlAvVpy NyJUAlAJpNlVmpVJm include: x 1iNNLA_L9a]q^N’"qLŔawmJA_plAvN]ApmiNNLmqipaƒ…^V]NmiNlUaqlA_L JA_JAlly]AlTNva]q^NmaS^ApNlVA]‘V_J]qLV_TlaJ\m‘plNNm‘A_LNvN_vNUVJ]Nm x Consistency: 3UNJa_mVmpN_JyaSA^qLŔawJA_vAlySla^ApUVJ\‘vVmJaqmm]qllypa AwApNlyŔaw3UVmLNiN_Lma_pUNilaialpVa_aSwApNlpama]VL^ApNlVA]m x Path: "qLŔawmpyiVJA]]ySa]]awNxVmpV_TLlAV_ATNiAppNl_m‘mqJUAmlVvNlJUA__N]m A_LvA]]Nym‘IqpJA_A]maJAlvN_NwiApUm‘]NALV_Tpaq_ilNLVJpAI]NA_LwVLNmilNAL damage. 1aV]^avN^N_pVmA_ApqlA]ilaJNmmpUApmVT_VœJA_p]yV^iAJpmpUNN_vVla_^N_pA_L human activities. It involves the displacement of soil particles due to various natural and human caused factors. Key characteristics include: x Landslides: %SpN_ aJJqllV_T V_ UV]]y AlNAm‘ ]A_Lm]VLNm V_va]vN pUN Law_wAlL movement of rock and soil. They can be sudden and fast-^avV_T‘^A\V_TpUN^ particularly dangerous. x Soil Creep: 3UVmVmAm]awA_LTlALqA]^avN^N_paSmaV]Law_Am]aiN‘aSpN_ q__apVJNLq_pV]mVT_VœJA_pLA^ATNaJJqlm x 1aV]!VkqNSAJpVa_’qlV_TA_NAlpUkqA\N‘mApqlApNLmaV]JA_pN^ialAlV]y]amNVpm mplN_TpUA_LINUAvN]V\NA]VkqVL‘JAqmV_TmplqJpqlNmpamV_\alpV]p Causes _!am_TN]Nmaq_py‘mNvNlA]SAJpalmJa_plVIqpNpapUNaJJqllN_JN aS LNIlVm Ŕawm^qLŔawmmaV]^avN^N_p’ x NAvy0AV_SA]]A_L1pal^vN_pm’_pN_mNA_Lila]a_TNLlAV_SA]]‘aSpN_AmmaJVApNL wVpUmpal^m‘JA_mApqlApNpUNmaV]‘lNLqJV_TVpmmpAIV]VpyA_LplVTTNlV_TLNIlVmŔawm County of Los Angeles All-Hazards Mitigation Plan Page 107 of 204 3UNlNTVa_µm"NLVpNllA_NA_J]V^ApN‘wVpUwNpwV_pNlmA_LLlymq^^Nlm‘JlNApNm conditions conducive to such events. x :V]LœlNm’!am_TN]Nmaq_pySlNkqN_p]yNxiNlVN_JNmwV]LœlNm‘wUVJUJA_Iql_ and destabilize vegetation that normally helps hold soil in place. The loss of vNTNpApVa_V_JlNAmNmpUNlVm\aSmaV]NlamVa_A_L‘Ja_mNkqN_p]y‘LNIlVmŔawmLqlV_T subsequent rainfalls. x Steep Terrain: 3UN Jaq_pyµm ^aq_pAV_aqm pNllAV_‘ V_J]qLV_T AlNAm ]V\N aq_py ^aq_pAV_aqmAlNAm‘VmiAlpVJq]Al]yila_NpaLNIlVmŔaw3UNmpNNim]aiNmSAJV]VpApN the rapid movement of debris downhill. x Soil Composition: NlpAV_maV]pyiNm‘mqJUAmJ]Ay-lVJUmaV]m‘JA_INJa^NUVTU]y q_mpAI]NwUN_mApqlApNLwVpUwApNl‘^A\V_TpUN^^alNmqmJNipVI]NpaLNIlVmŔaw x Human Activity: 4lIA_LNvN]ai^N_p‘laALJa_mplqJpVa_‘A_LLNSalNmpApVa_JA_ A]pNl_ApqlA]]A_LmJAiNmA_LNxAJNlIApNJa_LVpVa_mpUAp]NALpaLNIlVmŔaw x Seismic Activity: !am_TN]Nmaq_pyVmmVpqApNLV_AUVTU]yAJpVvNmNVm^VJ|a_N‘ ^A\V_T Vp ila_N pa NAlpUkqA\Nm 1NVm^VJ AJpVvVpy JA_ ]NAL pa maV] ]VkqNSAJpVa_‘ ]A_Lm]VLNm‘A_LTlaq_LmUA\V_T‘A]]Ja_plVIqpV_TpamaV]LVmi]AJN^N_p !A_L1qImVLN_JN Land subsidence is a gradual settling or sudden sinking of the Earth's surface due to various natural and human-V_LqJNLSAJpalm3UVmUA|AlLJA_UAvNmVT_VœJA_pV^iAJpma_ pUNN_vVla_^N_p‘V_SlAmplqJpqlN‘A_LJa^^q_VpVNm lNLqJpVa_V_]A_LN]NvApVa_Vma_NaSpUN^amp_apVJNAI]NSNApqlNmaS]A_LmqImVLN_JN‘ ]NALV_TpamVT_VœJA_pJUA_TNmV_pUN]A_LmJAiN3UVmiUN_a^N_a_JA_aJJqlLqNpa _ApqlA]ilaJNmmNm‘mqJUAmpUNLVmma]qpVa_aS]V^Nmpa_N‘AmwN]]AmUq^A_AJpVvVpVNmlike pUN NxJNmmVvN NxplAJpVa_ aS Tlaq_LwApNl‘ aV]‘ al _ApqlA] TAm qlpUNl^alN‘ ]A_L mqImVLN_JNV_JlNAmNmpUNlVm\aSŔaaLV_TINJAqmNpUN]awNlN]NvApVa_JA_]NALpaiaal LlAV_ATNA_LwApNlAJJq^q]ApVa_mpUNTlaq_LmV_\m‘VpaSpN_lNmq]pmV_pUNSal^Apion aSLNilNmmVa_m‘œmmqlNm‘A_LmV_\Ua]Nm‘wUVJUJA_LlA^ApVJA]]yA]pNlpUNTNaTlAiUyA_L infrastructure of the area. x Depressions: Are sunken or low-]yV_TAlNAma_pUNAlpU¯mmqlSAJN‘aSpN_Sal^NLIy natural or man-made processes. x Fissures: lNA]a_T‘_AllawJlAJ\al]V_NAlaiN_V_TV_pUNAlpU¯mJlqmp x 1V_\Ua]Nm’Are holes in the ground causes by the collapse or sinking of surface material into an underlying void. County of Los Angeles All-Hazards Mitigation Plan Page 108 of 204 Causes x laq_LwApNlxplAJpVa_’One of the primary causes of land subsidence in Los Angeles County is the excessive extraction of groundwater. As water is pumped out aSq_LNlTlaq_LAkqVSNlm‘pUNTlaq_LAIavNJA_mV_\almNpp]N‘]NALV_T pa subsidence. x %V]A_LAmxplAJpVa_’The removal of oil and natural gas from beneath the earth's surface also contributes to land subsidence. This extraction can create voids and lNLqJNilNmmqlNV_mqIpNllA_NA_]AyNlm‘JAqmV_TpUNTlaq_LpamV_\ x Natural Soil Compaction: %vNlpV^N‘_ApqlA]ilaJNmmNmmqJUAmmaV]Ja^iAJpVa_ can lead to gradual subsidence. In areas with loose or q_Ja_ma]VLApNLmaV]m‘pUN wNVTUpaSavNl]yV_T^ApNlVA]mJa^iAJpmpUNTlaq_L‘lNmq]pV_TV_A]awNlV_TaSpUN land surface. Rock Falls Rock falls are a natural geological phenomenon where rock fragments break free from a steep slope or cliff and tumble downward. These events can range from small iNII]NmLVm]aLTV_Tpa^AmmVvNIaq]LNlmJlAmUV_TLaw_wVpUmVT_VœJA_p SalJN A_L impact. Rock falls are characterized by: x Speed and Suddenness: 0aJ\ SA]]m aJJql kqVJ\]y A_L wVpUaqp ^qJU wAl_V_T‘ making them particularly dangerous. x 9AlVNL1V|Nm’The size of the falling material can range from small pebbles to large Iaq]LNlm‘V^iAJpV_TpUNmNvNlVpyaSpUNNvN_p x Path Predictability: :UV]NpUNV_VpVA]plVTTNliaV_pVmaSpN_VLN_pVœAI]N‘pUNiApUaS descent can be unpredictable due to varying terrain and obstacles. Causes The primary causes of rock falls include: x Weathering and Erosion: %vNlpV^N‘wNApUNlV_TilaJNmmNmmqJUAmSlNN|N-thaw JyJ]Nm‘JUN^VJA]wNApUNlV_T‘A_LpUNAJpVa_aSwApNlJA_wNA\N_laJ\mplqJpqlNm lamVa_JA_q_LNl^V_NpUNIAmNaSm]aiNm‘^A\V_TlaJ\m^alNmqmJNipVI]NpaSA]]V_T x Seismic Activity: Los Angeles County is located in a seismically active region. AlpUkqA\NmJA_LVm]aLTNlaJ\mSla^J]VSSmA_LmpNNim]aiNm‘plVTTNlV_TlaJ\SA]]m County of Los Angeles All-Hazards Mitigation Plan Page 109 of 204 x NAvy0AV_SA]]’_pN_mNalila]a_TNLlAV_SA]]JA_mApqlApNpUNTlaq_L‘V_JlNAmV_T the weight and pressure on rock faces. This saturation can lead to the loosening and collapse of rocks. x Human Activity: a_mplqJpVa_‘^V_V_T‘A_LapUNlUq^A_AJpVvVpVNmJA_LNmpAIV]V|N rock formations. The vibrations from heavy machinery and blasting can initiate rock falls. 6.8.6 Probability !A_Lm]VLNmA_LapUNl]A_L^avN^N_pNvN_pmUAiiN_V_!am_TN]Nmaq_pySAVl]yaSpN_‘ NmiNJVA]]yASpNlUNAvylAV_alV_AlNAmpUAplNJN_p]yUALwV]LœlNmalAlNila_Npam]VLV_T x 1^A]]]A_Lm]VLNmŸ]V\NLNIlVmŔawm AlN^amp]V\N]yLqlV_TyNAlmwVpUUNAvylAV_‘ NmiNJVA]]y]#V`ayNAlm3UNmNUAiiN_NvNly‚pa‡yNAlm“pUNlNVm„Èpa…€È chance each year during those cycles. x In high-lVm\|a_NmŸ]V\NmpNNi^aq_pAV_m]aiNmwVpUAUVmpalyaS^avN^N_p ‘ probability is 1–‚ÈJUA_JNiNlyNAl‘NmiNJVA]]ySa]]awV_T^q]pV-year wet periods al^A[alwV]LœlNm x Some areas of the County have been experiencing continuous sliding. 6.8.7 Vulnerability !A_L ^avN^N_p iamN lVm\m pa ]VSN‘ ilaiNlpy‘ A_L NmmN_pVA] V_SlAmplqJpqlN3UN ‚€‚„ THIRA projects that approximately 1.2 million residents in Los Angeles County could be directly or indirectly affected by land movement. The most at-risk populations include: x 0NmVLN_pmaSUV]]mVLNA_LJA_ya_Ja^^q_VpVNmmqJUAm"A]VIq‘3aiA_TA‘A_LpUN Palos Verdes Peninsula. x Homeowners in coastal bluff areas that are facing erosion-driven slope failures. x a^^q_VpVNmV_wV]LœlNIql_mJAlAlNAm‘wUNlNpUN]ammaSvNTNpApVa_V_JlNAmNm landslide probability during heavy rains. x The Access and Functional Needs (AFN) community who may face challenges in evacuating or leaving landslide-prone areas. County of Los Angeles All-Hazards Mitigation Plan Page 110 of 204 Contextual Overview Los Angeles County’s diverse topography includes many hillside communities susceptible to deep-mNApNL]A_Lm]VLNm‘NmiNJVA]]yASpNlwV]LœlNalUNAvylAV_3UNmN hazards can isolate Ja^^q_VpVNm‘LA^ATNilaiNlpy‘A_LLVmlqip]VSN]V_Nm Extent of Exposure x Total Area Exposed : 284.57 sq mi x Supervisorial Districts (SD) Impacted: o SD5: 151.96 sq mi (5.41%) o SD3: 90.23 sq mi (20.93%) o SD4: 25.94 sq mi (12.20%) o SD1: 13.77 sq mi (3.90%) o SD2: 2.68 sq mi (0.74%) x Critical Facilities Affected: o Fire Department: 41 (12.17%) o Public Works: 32 (13.91%) o Health Services: 12 (18.46%) o Public Health: 4 (10.00%) o Libraries: 9 (10.34%) o Parks: 27 (14.92%) o Education: 8 (9.76%) Problem Statement !A_Lm]VLNmiamNAmNlVaqmlVm\paUV]]mVLNJa^^q_VpVNmA_LAJJNmmlaqpNm‘NmiNJVA]]yV_ AlNAmlNJavNlV_TSla^wV]LœlNqllN_pLNvN]ai^N_pA_LlaALV_SlAmplqJpqlN^Ay_ap be resilient against slope failure. Mitigation actions should include slope stabilizApVa_‘ pAlTNpNLIqyaqpmallN]aJApVa_m‘A_LNAl]ywAl_V_TmympN^m County of Los Angeles All-Hazards Mitigation Plan Page 111 of 204 6.8.8 Impacts Los Angeles County's diverse landscape and dense population make it highly mqmJNipVI]NpapUNNSSNJpmaS]A_L^avN^N_p‘ASSNJpV_TJlVpVJA]V_SlAmplqJpqlNA_LlAVmV_T mVT_VœJA_pNJa_a^VJ‘maJVA]‘A_LmASNpyJa_JNl_m 3lA_mialpApVa_#Npwal\m !am_TN]Nmaq_pyµmNxpN_mVvNplA_mialpApVa__Npwal\VmvVpA]SalLAV]yJa^^qpNm‘ TaaLmplA_mialp‘A_LN^NlTN_JymNlvVJNm!A_L^avN^N_pJA_mNvNlN]yV^iAJppUNmN systems: x 0aALA^ATN’AqmNmJ]amqlNm‘hazardous driving conditions and costly repairs‘ AmmNN_A__qA]]ya_-AJVœJaAmpVTUwAyŸ- ‘A_L^A_yapUNl]aJA]laALm x Bridge Compromise’ SSNJpm mplqJpqlA] V_pNTlVpy‘ _NJNmmVpApV_T J]amqlNm A_L expensive reconstructions. x Public Transit Disruptions’^iAJpmplAV_plAJ\mA_LIqmlaqpNm‘]NALV_TpaLN]Aym and service interruptions. x 0AV] 1ympN^m’3lAJ\ ^VmA]VT_^N_p JA_ JAqmN LN]Aym A_L iapN_pVA] LNlAV]^N_pm‘ affecting both passenger and freight lines. Water Supply Systems The county's water delivery system is complex and vulnerable to land movement: x Compromised Pipelines’ !NALm pa lqipqlNm al ]NA\m‘ LVmlqipV_T mqii]y A_L requiring major repairs. x 0NmNlvaVl^iAJp: Landslides can affect water quality and storage capacity. Energy Infrastructure !A_L^avN^N_piamNmlVm\mpa!am_TN]Nmaq_pyµmN_NlTyV_SlAmplqJpqlN‘V_J]qLV_T’ x ]NJplVJA] lVL 9q]_NlAIV]VpVNm’Land movement can damage power lines and mqImpApVa_m‘JAqmV_TaqpATNm x Am-ViN]V_N0Vm\m’1aV]mUVSpmJA_lNmq]pV_TAm]NA\malNxi]amVa_m‘N_LA_TNlV_T safety. County of Los Angeles All-Hazards Mitigation Plan Page 112 of 204 Communication Systems 0N]VAI]NJa^^q_VJApVa_VmJlVpVJA]‘A_L]A_L^avN^N_pJA_LVmlqip’ x Telecommunication Towers: Structural damage can impair cellular and internet services. x Underground Cables: AlpUmUVSpmJA_LA^ATNJAI]Nm‘ASSNJpV_TJa__NJpVvVpy Emergency Services Facilities x Hospitals and Fire Stations: mmN_pVA] Sal N^NlTN_Jy lNmia_mN‘ Iqp mplqJpqlA] LA^ATNJaq]LV^iNLNaiNlApVa_m‘q_LNlmJalV_TpUN_NNLSallNmV]VN_pJa_mplqJpVa_ and strategic planning. Economic Impacts x Infrastructure Damage: !NALmpaJamp]ylNiAVlmA_L^AV_pN_A_JNaSlaALm‘IlVLTNm‘ and buildings. x Property Loss: a^Naw_Nlm SAJN œ_A_JVA] ]ammNm LqN pa ilaiNlpy LA^ATN al devaluation. Environmental Impacts x Ecosystem Disruption: Soil movement can lead to habitat loss A_LASSNJp]aJA]ŔalA and fauna. x Increased Pollution: lamVa_JA_lNmq]pV_mNLV^N_plq_aSS‘LNTlALV_TwApNlkqA]Vpy in rivers and oceans. For a better visual representation of the Land Movement Hazard within the LA County i]A__V_T AlNA‘ i]NAmN lNSNlN_JN iiN_LVx  for maps that show areas that are susceptible to land movement and recent burn scars. 6.8.9 Mitigation Strategies 3alNLqJNpUNV^iAJpaS]A_L^avN^N_p‘!am_TN]Nmaq_pyUAmV^i]N^N_pNLmNvNlA] ^VpVTApVa_A_LilNiAlNL_NmmmplApNTVNm‘V_J]qLV_T’ x !A_L4mNA_LNvN]ai^N_p0NTq]ApVa_m’Restricting development in high-risk landslide zones to prevent new structures from being built on unstable terrain. x _SlAmplqJpqlN 0NmV]VN_JN’Reinforcing existing infrastructure through slope mpAIV]V|ApVa_ila[NJpm‘lNpAV_V_TwA]]m‘A_LV^ilavNLLlAV_ATNmympN^m County of Los Angeles All-Hazards Mitigation Plan Page 113 of 204 x 1pAIV]V|ApVa_ 0NTq]ApVa_m’Implementing stricter grading and excavation regulations to minimize the destabilization of slopes. x Public Awareness Campaigns: _UA_JV_T ]A_Lm]VLN NAl]y _apVœJApVa_m Iy monitoring potential movement areas and precipitation thresholds. x Evacuation Planning: Developing evacuation plans for at-lVm\ Ja^^q_VpVNm‘ ensuring residents receive timely alerts and clear guidance. x Public Education: Conducting public education campaigns to inform residents about recognizing landslide warning signs and preparedness measures. x Operational Area Coordination’_JlNAmV_TJaalLV_ApVa_AJlammmpApN‘SNLNlA]‘A_L %SœJN aS ^NlTN_Jy "A_ATN^N_p aSœJVA]m wVpU ]aJA] [qlVmLVJpVa_m pa V^ilavN forecasting and response efforts. 6.8.10 Summary !A_L^avN^N_plN^AV_mAmVT_VœJA_pUA|AlLV_!am_TN]Nmaq_py‘iAlpVJq]Al]yV_ mpNNiA_LJaAmpA]lNTVa_m3UN-A]am9NlLNm-N_V_mq]A‘1A_pA"a_VJA"aq_pAV_m‘A_L 1A_AIlVN]"aq_pAV_mAlNA^a_TpUN^ampvq]_NlAI]NAlNAm‘with climate change and human activities exacerbating risks. By implementing land-qmN lNTq]ApVa_m‘ V_SlAmplqJpqlNlNV_SalJN^N_pm‘A_LN^NlTN_JylNmia_mNV^ilavN^N_pm‘pUNaq_pyJA_ enhance resilience and reduce losses in the future. Local governments and communities must actively monitor and manage contributing factors to effectively mitigate the impacts of land subsidence. County of Los Angeles All-Hazards Mitigation Plan Page 114 of 204 6.9 Tsunami 6.9.1 Nature This section characterizes tsunamis as high-N_NlTy‘ ]a_T-wavelength ocean waves generated primarily by mVT_VœJA_p aSSmUalN mNVm^VJ NvN_pm (such as subduction zone NAlpUkqA\Nm ‘ mqI^AlV_N ]A_Lm]VLNm‘ or volcanic eruptions. In the context of !am _TN]Nm aq_py‘ pmq_A^Vm represent a relatively infrequent but potentially high-impact hazard that could produce rapid coastal inundation and surge impacts. Characteristics: x 3lVTTNlNL^AV_]yIyLVmpA_p‘]AlTN- magnitude seismic events. x Features long wavelengths and prolonged arrival times. x AiAI]NaSilaLqJV_TlAiVL‘LNNiV_q_LApVa_A]a_T]aw-lying coastal areas. x _mq^^Aly‘pmq_A^VmAlNLy_A^VJ_ApqlA]iUN_a^N_AwVpUpUNiapN_pVA]paJAqmN mqLLN_JaAmpA]ŔaaLV_TA_LLA^ATNVSAplVTTNlV_TNvN_paJJqlm County of Los Angeles All--HazHards Mitigation Plan County of Los Angeles All-Hazards Mitigation Plan Page 115 of 204 6.9.2 Location 3UN qiLApNL pmq_A^V UA|AlL ilaœ]N SaJqmNm a_ pUN JaAmpA]areas of Los Angeles County. The new zone map—developed using enhanced modeling techniques and updated coastal geomorphology data—UVTU]VTUpmAlNAmA]a_TpUN-AJVœJmUalN]V_NpUAp AlNAplVm\3UNmNV_J]qLNlNTVa_mAL[AJN_ppapUN!am_TN]Nm AmV_‘iAlpmaS!ang NAJU‘1A_pA"a_VJA Ay‘A_LapUNl]aw-elevation coastal zones. For a better visual representation of Tsunami Inundation zones within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVxAfor A¬3mq_A^V_q_LApVa_lNA­map. Important Details: x Coastal segments from the western margins of the Los Angeles Basin extending to the border with Orange County. %vNlA]]‘pUNcoastal areas aS!am_TN]Nmaq_py‘containing our communities and infrastructure‘face heightened exposure. 6.9.3 Extent 4mV_T pUN ]ApNmp UyLlaLy_A^VJ A_L V_q_LApVa_ ^aLN]V_T‘ pUN qiLApNL pmq_A^V inundation (zone)^AiilavVLNmAlNœ_NLvVNwaSpUNNxpN_paSiapN_pVA]ŔaaLV_T3UN ^AiV]]qmplApNmUawpmq_A^VwAvNmJaq]LilaiATApNV_]A_L‘mUawV_T lNvVmNL boundaries that account for current sea-level conditions and future sea-level rise projections. Highlights: x _q_LApVa_LNipUmA_LlNAJUUAvNINN_lNJA]Jq]ApNL‘wVpUma^NAlNAmiapN_pVA]]y experiencing water levels up to several feet in depth. x 3UNV_]A_LlNAJUaSŔaaLV_TvAlVNmIy]aJA]paiaTlAiUy‘wVpUŔAp‘]aw-lying areas showing the greatest potential for impacts^iAJpNLAlNAmV_J]qLN‘IqpAlN_ap ]V^VpNLpa‘!a_T NAJU‘3UNialpmaS!a_T NAJUA_L!am_TN]Nm‘"AlV_ALN]0Ny‘ Venice and Santa Monica. x lVpVJA]V_SlAmplqJpqlNwVpUV_pUNqiLApNL|a_NmUAmINN_VLN_pVœNLpailValVpV|N mitigation and evacuation routes for planning. _NmmN_JN‘pUNNxpN_paSpmq_A^VV^iAJpmVm_aw^AiiNL^alNilNJVmN]y‘aSSNlV_T]aJA] decision-^A\NlmAJ]NAlNlvVNwaSiapN_pVA]ŔaaLV_TLNipUmA_LLVmpA_JNmV_]A_L. County of Los Angeles All-Hazards Mitigation Plan Page 116 of 204 6.9.4 History VmpalVJA]]y‘mVT_VœJA_ppmq_A^VNvN_pmV_pUN!am_TN]NmlNTVa_AlNlAlN‘pUaqTU distant seismic events (for example: the 1960 Chilean tsunami‘alpUN^amplNJN_p‚€‚‚ Tonga tsunami) have been known to produce measurable impacts. Historical records combined with geological studies indicate that while tsunamis have occurred in the iAmp‘pUNVlSlNkqN_JyVm]awJa^iAlNLpaapUNlUA|AlLmawNvNl‘pUNlNTVa_¯milaxV^Vpy to major tectonic boundaries necessitates ongoing vigilance. Historical Context: x Past events have been sporadic but can serve as valuable lessons for preparedness. x VmpalVJA] V_q_LApVa_ lNJalLm A_L mNLV^N_p mpqLVNm Ja_œl^ pUAppmq_A^Vm UAvN reached the Los Angeles coast in prehistory. x Lessons learned from past minor events underscore the importance of maintaining updated hazard maps. 3Uqm‘wUV]NUVmpalVJA]pmq_A^VNvN_pmAlNV_SlNkqN_p‘pUNyilavVLNAJlVpVJA]Ja_pNxpSal understanding future risks and guiding preparedness measures. There have been no SNLNlA]LNJ]AlApVa_malmpApNilaJ]A^ApVa_mSalpmq_A^VV_pUN]AmpœvNyNAlm 6.9.5 Probability The probability of a tsunami affecting Los Angeles County is generally low when Ja^iAlNL pa ^alN SlNkqN_p UA|AlLm ]V\N NAlpUkqA\Nm al ŔaaLm #NvNlpUN]Nmm‘ pUN potential for a distance source pmq_A^VTN_NlApNLIyALVmpA_p‘large seismic event remains a realistic risk. Updated probabilistic assessments—incorporating recent seismic data and tsunami modeling V_LVJApNpUApwUV]NpUNavNlA]]]V\N]VUaaLVm]aw‘pUN consequences in the event of a tsunami can be severe. Probability Considerations: x Low annual probability but high consequence if an event occurs“ !am_TN]Nm County has about a 2% annual chance. x Distance source events from subduction zones across the ocean contribute most to the risk. x Continuous monitoring and updated modeling are essential to reassess the risk over time. x _mq^^Aly‘pUNilaIAIV]VpyaSApmq_A^VlN^AV_m]aw‘IqpLqNpapUNiapN_pVA]Sal high-V^iAJpaqpJa^Nm‘VpwAllA_pmJa_pV_qaqmmpqLyA_LilNiAlNL_Nmm County of Los Angeles All-Hazards Mitigation Plan Page 117 of 204 6.9.6 Vulnerability aAmpA]vq]_NlAIV]VpyV_!am_TN]Nmaq_pyVmmVT_VœJA_p]yV_ŔqN_JNLIySAJpalmmqJU Am qlIA_ LN_mVpy‘ ]aw-N]NvApVa_ pNllAV_‘ ATV_T V_SlAmplqJpqlN‘ A_L maJVa-economic conditions. The updated tsunami zone map now better delineates areas where these vulnelAIV]VpVNmAlN^ampila_aq_JNL‘UVTU]VTUpV_TJa^^q_VpVNmpUAp^AyUAvN]V^VpNL evacuation routes and fewer resources to recover from rapid inundation. Iaqp‡…‘€€€ iNai]N]VvNV_iAlpmaS!am_TN]Nmaq_pypUApJaq]LINŔaaLNLIyApmq_A^V"A_y people a]mawal\V_pUNmNJaAmpA]AlNAm‘A_LAlaq_L††€q_UaqmNLV_LVvVLqA]m]VvN pUNlN‘^A\V_TpUN^NmiNJVA]]yAplVm\INJAqmNpUNy^Ay_apUAvNNAmyAJJNmmpamUN]pNl or transportation. 3aqlVm^ALLmNvN_^alNiNai]NpapUNmNAlNAm‘NmiNJVA]]yLqlV_TIqmywNN\N_Lmal Ua]VLAym-]AJNm]V\N1A_pA"a_VJAJA_mNNqipaƒ€€‘€€€vVmVpalmALAyLqlV_TiNA\ times. This makes evacuating harder if a tsunami warning is issued. Roads near the coast ca_kqVJ\]yINJa^NJlawLNL‘A_LvVmVpalm^Ay_ap\_awpUNINmpwAypa]NAvN 3lASœJJaq]Lm]awLaw_N^NlTN_Jyi]A_m‘maVp¯mV^ialpA_ppaUAvNJ]NAlmVT_m‘NAl]y wAl_V_Tm‘A_LTaaLplASœJJa_pla]paUN]iiNai]NTNppamASNpykqVJ\]y Factors: x High population density in low-lying coastal areas. x lVpVJA]V_SlAmplqJpqlNŸNT‘UamiVpA]m‘qpV]VpVNm‘ ialpmA_LmUViiV_T‘ transportation networks) located within the inundation zones. x Socio-economic and language barriers that may hinder effective emergency response. x Limited natural barriers in some coastal segments. x Vulnerable communities include those with high population densities and critical infrastructure near the coast. 4]pV^ApN]y‘pUNvq]_NlAIV]VpyaSpUNlNTVa_VmJa^iaq_LNLIyIapUiUymVJA]NxiamqlNm A_LmaJVA]SAJpalm‘q_LNlmJalV_TpUN_NNLSalpAlTNpNL^VpVTApVa_NSSalpm Contextual Overview aAmpA]Ja^^q_VpVNmV_!am_TN]Nmaq_py‘V_J]qLV_TialpmA_LpaqlVmp|a_Nm‘AlNAp risk from tsunamis. These rare but highly destructive events can inundate coastal infrastructure with little warning. County of Los Angeles All-Hazards Mitigation Plan Page 118 of 204 Extent of Exposure x Total Area Exposed : 32.89 sq mi x Supervisorial Districts (SD) Impacted: o SD4: 15.83 sq mi (7.43%) o SD3: 12.59 sq mi (2.92%) o SD2: 2.03 sq mi (0.56%) x Critical Facilities Affected: o Fire Department: 16 (4.75%) o Public Works: 9 (3.91%) o Health Services: 3 (4.62%) o Public Health: 1 (2.50%) o Libraries: 5 (5.75%) o Parks: 13 (7.26%) o Education: 3 (3.66%) Problem Statement 3mq_A^Vm JA_ JAqmN lAiVL A_L JApAmplaiUVJ JaAmpA] ŔaaLV_T :VpU JlVpVJA] JaAmpA] V_SlAmplqJpqlNA_LlNmVLN_pVA]AlNAmNxiamNL‘NmiNJVA]]yV_1„A_L1ƒ‘pUNlNVmA_NNL SallaIqmpNvAJqApVa_i]A__V_T‘vNlpVJA]NvAJqApVa_mUN]pNlm‘A_LJa^^q_VpyaqplNAJU to enhance preparedness and reduce vulnerability. 6.9.7 Impacts 1Uaq]L A pmq_A^V aJJql‘ pUN iapN_pVA] V^iAJpm a_ !am _TN]Nm aq_py Jaq]L IN extensive. Parts of Los Angeles County that could be impacted by a Tsunami are Marina N]0Ny‘-alpaS!am_TN]Nm‘-alpaS!a_T NAJU‘A_LapUNlbeach communities in low lying areas. 3UNqiLApNLV^iAJpAmmNmm^N_pmlNŔNJpiammVI]NmJN_AlVamlA_TV_TSla^ mVT_VœJA_pilaiNlpyLA^ATNpa]ammaS]VSNA_L]a_T-term economic disruption. The new zone map aids in quantifying these impacts by providing detailed inundation depths and spatia]NxpN_pm‘pUNlNIyA]]awV_TSalINppNllVm\Ja^^q_VJApVa_A_Li]A__V_T County of Los Angeles All-Hazards Mitigation Plan Page 119 of 204 Potential Impacts: x 1NvNlNŔaaLV_TaSJaAmpA]V_SlAmplqJpqlNA_LlNmVLN_pVA]AlNAm x VmlqipVa_aSplA_mialpApVa_‘qpV]VpymNlvVJNm‘A_LN^NlTN_JylNmia_mNaiNlApVa_m x Ja_a^VJ]ammNmV_\NymNJpalmmqJUAmpaqlVm^‘mUViiV_T‘A_L]aJA]Ja^^NlJN x 1aJVA] V^iAJpm V_J]qLV_T LVmi]AJN^N_p‘ ]amm aS ]VvN]VUaaLm‘ A_L JUA]]N_TNm V_ emergency sheltering. _mUalp‘pUNiapN_pVA]V^iAJpmaSApmq_A^VAlNSAl-lNAJUV_T‘ _NJNmmVpApV_T laIqmp ^VpVTApVa_‘NvAJqApVa_‘A_LlNJavNlyi]A__V_Tpa^V_V^V|NUAl^ For a better visual representation of Tsunami Inundation zones within the LA County i]A__V_TAlNA‘i]NAmNlNSNlN_JNiiN_LVx for A¬3mq_A^V_q_LApVa_lNA­^Ai. 6.9.8 Summary The updated tsunami section for the 2025 AHMP V_JalialApNm pUN ]ApNmp mJVN_pVœJ œ_LV_TmA_L^AiiV_TpNJU_VkqNmpailavVLNA^alNilNJVmNq_LNlmpA_LV_TaSpmq_A^V lVm\m V_ !am_TN]Nm aq_py y V_pNTlApV_T A_ qiLApNL V_q_LApVa_ |a_N ^Ai‘ pUN lNvVmVa_ J]AlVœNm pUN miApVA] NxpN_p aS iapN_pVA] ŔaaLVng and highlights the vulnerabilities in coastal communities. This comprehensive update is designed to guide decision-^A\NlmV_N_UA_JV_TilNiAlNL_Nmm‘pAlTNpV_T^VpVTApVa_mplApNTVNm‘A_L strengthening community resilience. Ny3A\NAwAym’ x Nature: Tsunamis are infrequent but high-energy events capable of rapid coastal inundation. x Location & Extent: 3UNqiLApNL|a_N^AiVLN_pVœNmvq]_NlAI]NJaAmpA]AlNAmwVpU lNvVmNLV_]A_LŔaaLNxpN_pm x History & Probability: VmpalVJA]NvN_pmAlNlAlN“UawNvNl‘distance events remain a realistic risk. x 9q]_NlAIV]Vpy Ë ^iAJpm’ High population density and critical infrastructure in JaAmpA]|a_NmA^i]VSylVm\‘wVpUiapN_pVA]SalmNvNlNNJa_a^VJA_LmaJVA]LVmlqipVa_ 3UVmqiLApNLmNJpVa_VmV_pN_LNLpamNlvNAmAJlVpVJA]paa]Salia]VJy^A\Nlm‘N^NlTN_Jy ^A_ATNlm‘A_LJa^^q_VpympA\NUa]LNlmAmpUNywal\paTNpUNlpalNLqJNpUN]a_T-term risks associated with tsunamis and enhance overall regional resilience. County of Los Angeles All-Hazards Mitigation Plan Page 120 of 204 CouCoCoCoCCCooCCCCoCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCntytyyyyyyyyyyyyyy ofofooofofofofofffofofffofofffofofoooooofofofoooooffoooooooo LoLoLoLoooLoLoLooLoLooLoLLoLoLLoooLoLoLoLoLLLooLoLLLoooooLoLoooooLLLooLoooooosAsAAsAsAsAsAAsssAAAAAAAsssAsssAsAssAsAAAAAAAAssssssAsAsAsAAAssAs AsAAs Angengengngenngngengngenngenngnnngengengengngngngngenngngengngnnngngngngnngngnnngggggggggggggggggggleslesesesessesssesessssesssessseseseessesesssesessseeeesseseseeesseeeesesessssssssss AAAAllAAAAAAAAAAAAA-Hazards MMMMMMMMMMMMMMMMMMMMMMitiititiitiittitiitiitiiiititiitititittitiiitiitititittittititiititittittttittttitiitititttitttiittttiiiititiiiiittititiittittiitiitiitittiiitiititttiiiiititiiitttiitiittttttittttttiittggatgatgggggggggionoonnononioniononionionioionononionoonononononooonooonooooooonnnnnnnnnnnnnnn Plaaannnnn 6.10 Severe Wind and Tornado 6.10.1 Nature Severe wind and tornadoes pose mVT_VœJA_ppUlNApmpa]VSN‘ilaiNlpy‘A_L V_SlAmplqJpqlN‘ pUaqTU pUNy LVSSNl V_ frequency and intensity within Los Angeles aq_py 1NvNlN wV_L NvN_pm‘ iAlpVJq]Al]y 1A_pA _A wV_Lm‘ AlN A lNJqllV_T _ApqlA] hazard that can cause widespread LA^ATN‘ V_J]qLV_T Law_NL iawNl ]V_Nm‘ plNN SA]]m‘ A_L mplqJpqlA]damage. These winds originate from high-pressure mympN^mavNlpUNlNAp AmV_‘Sq__N]V_TLly and warm air through mountain passes into the coastal and valley regions at high speNLm LLVpVa_A]]y‘ mpal^-LlVvN_ wV_Lm‘ ^VJlaIqlmpm‘straight-line winds and gust fronts associated with severe weather can JlNApNUA|AlLaqmJa_LVpVa_m‘aSpN_]NALV_T paplA_mialpApVa_LVmlqipVa_m‘œlNUA|AlLm‘ and prolonged power outages. County of Los Angeles All-Hazards Mitigation Plan Page 121 of 204 3al_ALaNm‘ wUV]N lN]ApVvN]y lAlN V_ pUN lNTVa_‘ UAvN INN_ lNJalLNLA_LJA_JAqmN localized but intense damage. These violent windstorms form when unstable Ap^amiUNlVJ Ja_LVpVa_m ilaLqJN lapApV_T qiLlASpm‘ lNmq]pV_T V_A Sq__N] J]aqL pUAp contacts the ground. 6.10.2 Location Severe wind events affect the entire Los Angeles County planning area‘ wVpU pUN mpla_TNmpaJJqllN_JNmV_JA_ya_iAmmNm‘vA]]Nym‘A_LJaAmpA]lNTVa_mThe Santa Ana wV_LmAlN^ampV_pN_mNV_pUNSA]]A_LwV_pNl^a_pUm‘iAlpVJq]Al]yV^iAJpV_TAlNAmin the 9A]]Ny‘A_L foothill communities of the County. Storm-LlVvN_wV_Lm‘a_pUNapUNlUA_L‘ can impact any part of the county and vary in intensity based on weather patterns. 3UNmN wV_Lm JA_ lNAJU miNNLm aS †€ pa ˆ€ ^iU‘ ma^NpV^Nm NxJNNLV_T pUamN pUlNmUa]Lm‘]NALV_TpamVT_VœJA_pLA^ATN Tornadoes are more sporadic in occurrence and can develop in various parts of the Jaq_py‘iAlpVJq]Al]yV_]aw]A_LAlNAmwUNlNmNvNlNpUq_LNlmpal^mUAvNpUNiapN_pVA]pa form rotating systems. 6.10.3 Extent Winds and breezes are common occurrences in LA County. As wind speeds increase so does the potential for a catastrophic event. Hot dry winds can reach high speeds as pUNyLNmJN_LSla^pUNV_]A_LLNmNlplNTVa_m‘JlNApV_T_apa_]yJlVpVJA]wV_LNvN_pmIqp almaNxplN^N]yLA_TNlaqmœlNJa_LVpVa_mA_LJa_plVIqpV_TpapUNmilNALaSwV]LœlNm 3UNwV_LmAlNJ]AmmVœNLV_pUN NAqSalp:V_L1JA]N‘mNNFigure 6.10.1 below. Beaufort wind scale is an empirical scale that relates wind speed to observed conditions at sea or land. It uses numerical scale from 1-12 to describe wind force based on visual observations of the effects of the wind and gives quantitative measures of the wind. For NxA^i]N‘aVmLNmJlVINLAm®JA]^¯AmNA]V\NA^VllalwUV]N‚LNmJlVINLAmUqllVJAne force with devastating conditions. 3al_ALaNm AlN J]AmmVœNL qmV_T pUN _UA_JNL q[VpA Ÿ Scale Figure 6.10.2. The _UA_JNLq[VpAŸ 1JA]NVmmiNJVœJA]]yqmNLpalApNpUNV_pN_mVpyaSpal_ALamIAmNL a_pUNLA^ATNpUNyJAqmNŸLA^ATNV_LVJApalm mqJUAmIqV]LV_TpyiNm‘A_LplNNmp ranges from EF-0 to EF-…‘wVpUV_JlNAmV_T_q^INlmV_LVJApNmpla_TNlpal_ALamA_d more severe damage. While tornadoes in the region typically do not exceed EF-1 County of Los Angeles All-Hazards Mitigation Plan Page 122 of 204 V_pN_mVpy‘pUNyJA_mpV]]ilaLqJNLA^ATV_TwV_LmAIavN€€^iU‘JAiAI]NaSpNAlV_T laaSmaSSIqV]LV_Tm‘qilaapV_TplNNm‘A_LavNlpql_V_TvNUVJ]Nm Beaufort Wind Scale: Force Wind (Knots) WMO Classification Appearance of Wind Effects On the Water On Land 0 Less than 1 Calm Sea surface smooth and mirror-like A]^‘m^a\NlVmNm vertically 1 1-3 Light Air 1JA]ylVii]Nm‘_aSaA^JlNmpm Smoke drift indicates wV_LLVlNJpVa_‘mpV]]wV_L vanes 2 4-6 Light Breeze 1^A]]wAvN]Npm‘JlNmpmT]Ammy‘ no breaking :V_LSN]pa_SAJN‘]NAvNm lqmp]N‘vA_NmINTV_pa move 3 7-10 Gentle Breeze !AlTNwAvN]Npm‘JlNmpmINTV_ paIlNA\‘mJAppNlNLwUVpNJAim Leaves and small twigs Ja_mpA_p]y^avV_T‘]VTUp flags extended 4 11-16 Moderate Breeze Small waves 1-4 ft. becoming ]a_TNl‘_q^NlaqmwUVpNJAim qmp‘]NAvNm‘A_L]aamN iAiNl]VSpNL‘m^A]]plNN branches move 5 17-21 Fresh Breeze Moderate waves 4-8 ft taking ]a_TNlSal^‘^A_ywUVpNJAim‘ some spray Small trees in leaf begin to sway 6 22-27 Strong Breeze Larger waves 8-ƒSp‘ wUVpNJAimJa^^a_‘^alN spray Larger tree branches ^avV_T‘whistling in wires 7 28-33 Near Gale 1NAUNAimqi‘wAvNmƒ-‰Sp‘ white foam streaks off breakers :Ua]NplNNm^avV_T‘ resistance felt walking against wind County of Los Angeles All-Hazards Mitigation Plan Page 123 of 204 8 34-40 Gale Moderately high (18-25 ft) wAvNmaSTlNApNl]N_TpU‘ edges of crests begin to IlNA\V_pamiV_LlVSp‘SaA^ blown in streaks 3wVTmIlNA\V_TaSSplNNm‘ generally impedes progress 9 41-47 Strong Gale High waves (23-ƒ‚Sp ‘mNA INTV_mpala]]‘LN_mNmplNA\m aSSaA^‘milAy^AylNLqJN visibility Slight structural damage aJJqlm‘m]ApNblows off roofs 10 48-55 Storm Very high waves (29-41 ft) wVpUavNlUA_TV_TJlNmpm‘mNA white with densely blown SaA^‘UNAvyla]]V_T‘]awNlNL visibility Seldom experienced on ]A_L‘plNNmIla\N_al qilaapNL‘´Ja_mVLNlAI]N mplqJpqlA]LA^ATN´ 11 56-63 Violent Storm Exceptionally high (37-52 ft) wAvNm‘SaA^iApJUNmJavNl mNA‘vVmVIV]Vpy^alNlNLqJNL 12 64+ Hurricane VlSV]]NLwVpUSaA^‘wAvNm avNl„…Sp‘mNAJa^i]NpN]y wUVpNwVpULlVvV_TmilAy‘ visibility greatly reduced Figure 6.10.1 ĞĂƵĨŽƌƚtŝŶĚ^ĐĂůĞ County of Los Angeles All-Hazards Mitigation Plan Page 124 of 204 Enhanced Fujita Scale: THE ENHANCED FUJITA SCALE (EF SCALE) 03# ƒ1NJa_LqmpŸ"-  " EF 0 65-85 MPH !VTUp’ lA_JUNmIla\N_‘ minor roof damage EF 1 86-110 MPH Moderate: Roofs LA^ATNL“plNNmqilaapNL EF 2 111-135 MPH Considerable: Roofs torn aSS‘]AlTNplNNmLaw_ EF 3 136-165 MPH 1NvNlN’a^NmLNmplayNL“ cars lifted EF 4 166-200 MPH Devastating: Houses ]NvN]NL“LNIlVmAVlIal_N EF 5 Over 200 MPH Incredible: Homes swept away“ total destruction 6.10.4 History Los Angeles County has experienced multiple severe wind events and occasional tornadoes in recent history wUVJUJAqmNLLNmplqJpVa_m‘A_LwV]LœlNm. There have been no federal declarations or state proclamations for Severe Wind & Tornadoes in the last œvNyNAlm Some notable incidents include: x November-December 2011: wV_LNvN_pJAqmNL^alNpUA_¸ƒ…^V]]Va_V_ damages and severely impacted several foothill communities and unincorporated areas. x December 2019: An EF-€pal_ALapaqJUNLLaw_V_1aqpU!am_TN]Nm‘JAqmV_T minor roof damage and downing power lines. x January 2021: mNvNlNwV_Lmpal^V^iAJpNLpUNlNTVa_‘]NALV_TpaLA^ATN across multiple communities and emergency response efforts to clear roadways. x September 2021: An EF-0 tornado developed near the community Lake of Los _TN]Nm“È_aLA^ATNwAmlNialpNL Figure 6.10.2 Enhanced Fujita Scale County of Los Angeles All-Hazards Mitigation Plan Page 125 of 204 x April 2023: An EF-0 tornado recorded in Cerritos causing tree damage. x March 2023 (0œ „†‰‰): An EF- pal_ALa mplqJ\ "a_pNIN]]a‘ a_N aS pUN mpla_TNmp pal_ALaNm lNJalLNL V_ pUN AlNA‘ JAqmV_T mVT_VœJA_p LA^ATN pa commercial structures and vehicles. x May 2023: An EF-0 tornado occurred near the communities of Carson and Compton damaging buildings and vehicles. x August 2023 (0œ „‡…€): Tropical Storm Hillary impacting Los Angeles County. x February 2024: Strong winds impacting across Eastern Santa Monica Mountain and Santa Clarita Valley. x March 2024: Strong winds impacting areas around San Gabriel Valley. x January 2025 (0œ„ˆ…†): A mNvNlNwV_Lmpal^V^iAJpNLpUNlNTVa_‘]NALV_T to a -apN_pVA]]yA_TNlaqm1VpqApVa_Ÿ-1 ‘lNLŔATJa_LVpVa_m1NvNlA]œlNm Ila\NaqpV_pUNAlNA‘wUVJUNxUVIVpNLNxplN^NœlNINUAvVal‘JAqmV_TwVLNmilNAL destruction. x March 2025 (0œ„ˆ…†): miAlpaSAmpal^NvN_p‘A_ EF-0 tornado struck Pico 0VvNlA‘A]VSal_VA‘Apƒ’…A^‘with wind speeds reaching up to 85 mph. 6.10.5 Probability 1NvNlNwV_LNvN_pmAlNAlNTq]AlaJJqllN_JNV_!am_TN]Nmaq_py‘ wVpU A Uigh probability‘‰‰ÈJUA_JN recurring annually. Santa Ana winds are particularly common LqlV_TpUNJaa]Nl^a_pUm‘A_LJ]V^ApNiAppNl_mmqTTNmppUApNxplN^NwV_LNvN_pm^Ay become more frequent due to changing weather dynamics. Because wind events and pal_ALam AlN ]aJA]V|NL V_ _ApqlN‘ ilaIAIV]Vpy vAly Sla^ a_N AlNApaA_apUNlA_LVm LVSœJq]ppaLNpNl^V_NiNlJN_pATNaSUAiiN_V_TV_a_NAlNATornadoes remain a low- probability hazard‘10% chance‘ in the planning area“UawNvNl‘TVvN_iAmpaJJqllN_JNm‘ they cannot be ruled out entirely. Atmospheric conditions capable of producing pal_ALaNm^AyAlVmNLqlV_TmNvNlNpUq_LNlmpal^m‘iAlpVJq]Al]yV_wV_pNlmpal^mympN^m that generate strong wind shear. While the likelihood of an EF-2 or stronger tornado is ^V_V^A]‘pUNiapN_pVA]Sal]aJA]V|NLLA^ATNlN^AV_m The Santa Ana winds occur ten to twenty-œvNpV^NmA__qA]]yA_LJA_]AmpSalmNvNlA]LAym‘iamV_TAlNJqllV_TpUlNApaS damage and disruption in Los Angeles County. County of Los Angeles All-Hazards Mitigation Plan Page 126 of 204 6.10.6 Vulnerability SNvNlNwV_LA_Lpal_ALaNmJA_INNxpN_mVvN‘ASSNJpV_TIapUV_SlAmplqJpqlNA_LiqI]VJ safety. High-wV_LNvN_pmiamNAlVm\paJlVpVJA]V_SlAmplqJpqlN‘iAlpVJq]Al]yiawNl]V_Nm‘ Ja^^q_VJApVa_ mympN^m‘ A_L plA_mialpApVa_ _Npwal\m qV]LV_Tm‘NmiNJVA]]y a]LNl structures and ^aIV]NUa^Nm‘AlNvq]_NlAI]NpawV_L-lN]ApNLLA^ATN‘V_J]qLV_TlaaS SAV]qlNm‘wV_LawIlNA\ATN‘A_LmplqJpqlA]Ja]]AimN _ALLVpVa_paiUymVJA]LA^ATN‘mNvNlNwV_LNvN_pmJA_JAqmNmVT_VœJA_pNJa_a^VJ LVmlqipVa_m-la]a_TNLiawNlaqpATNmV^iAJpIqmV_NmmNm‘UNA]pUJAlNSAJV]VpVNm‘ A_L emergency response services. Road closures and debris blockages hinder mobility and commercN‘wUV]NwV_L-LlVvN_wV]LœlNm‘AmNJa_LAlyUA|AlLaS1A_pA_AwV_Lm‘JA_ lead to devastating losses. -qI]VJmASNpyVmA]maA^A[alJa_JNl_‘wVpUlVm\maSŔyV_TLNIlVm‘vNUVJ]NAJJVLN_pm‘ avNlpql_NLvNUVJ]Nm‘ and respiratory issues caused by airborne dust and pollutants stirred up by high winds. Severe wind and tornado events disproportionately impact certain populations and infrastructure in Los Angeles County due to both geographic exposure and maJVaNJa_a^VJvq]_NlAIV]VpVNm3UNmNUA|AlLmJA_LVmlqipJlVpVJA]mNlvVJNm‘NxAJNlIApN existing inequa]VpVNm‘A_LmVT_VœJA_p]yLA^ATNmplqJpqlNm_apIqV]ppawVpUmpA_LNxplN^N wind conditions. 9q]_NlAI]N-aiq]ApVa_m %qpaSpUNJaq_py¯mNmpV^ApNL€‚^V]]Va_lNmVLN_pm‘pUNSa]]awV_Tiaiq]ApVa_mAlN considered especially vulnerable: x Older Adults (65+): Approx. 1.6 million residents (15.5%)—more likely to suffer injury or health complications during wind-related power outages and evacuation events. x Access and Functional Needs (AFN) Populations: Estimated 1.7 million V_LVvVLqA]m Ÿ‡È  V_J]qLV_T pUamN wVpU LVmAIV]VpVNm‘ ]V^VpNL ^aIV]Vpy‘ al communication barriers. x Low-Income Households: Over 13% of households fall below the poverty line and may lack the resources for structural mitigation or relocation during prolonged outages. County of Los Angeles All-Hazards Mitigation Plan Page 127 of 204 x -Nai]N xiNlVN_JV_T a^N]Nmm_Nmm Ÿ- ’ %vNl ‡…‘€€€ V_LVvVLqA]m Ÿ‚€‚„ !1 Jaq_p ‘ Ap LVlNJp lVm\ Sla^ SA]]V_T LNIlVm A_L ]AJ\ aS mUN]pNl LqlV_T windstorms. x "aIV]Na^N0NmVLN_pm’iilaxV^ApN]y‰ˆ‘€€€q_VpmJaq_pywVLN‘Ja_JN_plApNL in inland valleys and foothill communities that are highly exposed to Santa Ana winds. x UV]LlN_4_LNlTN…’laq_L†€€‘€€€Jaq_pywVLN‘vq]_NlAI]NpalNmiVlApaly complications from airborne particulates and debris stirred by strong winds. x Ja_a^VJ ^iAJp’ qmV_Nmm LVmlqipVa_m‘ V_JlNAmNL V_mqlA_JN J]AV^m‘A_LpUN Jampm aS N^NlTN_Jy lNmia_mN A_L lNJavNly ALL œ_A_JVA] IqlLN_m pa ]aJA] communities. lVpVJA]_SlAmplqJpqlNAp0Vm\ Severe wind and tornado events can cause widespread cascading failures in vital mympN^m‘V_J]qLV_T’ x -awNl _SlAmplqJpqlN’ !am _TN]Nm aq_py Ja_pAV_m avNl ‚€‘€€€ ^V]Nm aS overhead power lines vulnerable to high-wV_LLA^ATNA_LœlNVT_VpVa_ x "NLVJA]AJV]VpVNm’%vNlƒ…€]VJN_mNLUamiVpA]mA_LUNA]pUJ]V_VJm‘^A_ylN]VA_p on uninterrupted power and access for vulnerable patient populations. x Transportation Corridors: Major highways (I-…‘ -€‘ 41-€  A_L avNl ƒ‘€€ IlVLTNm‘iAlpVJq]Al]yV_JA_ya_A_LSaapUV]]AlNAm‘AlNmqmJNipVI]NpaaImplqJpVa_ by fallen trees and debris. x Communication Towers: Over 800 critical telecom sites serve the county’s emergency communications and can be disrupted by high wind gusts. x 1JUaa]m’iilaxV^ApN]y‚‘ƒ€€iqI]VJ –12 schools and 100+ college campuses face operational disruptions from power outages or infrastructure damage during events. 6.10.7 Impacts 1NvNlNwV_LA_Lpal_ALaNvN_pmiamNmVT_VœJA_ppUlNApmpaJlVpVJA]V_SlAmplqJpqlN‘iqI]VJ mASNpy‘A_LJa^^q_VpyaiNlApVa_mV_!am_TN]Nmaq_pyVTUwV_Lm‘mqJUAmpUamN LqlV_T1A_pA_ANvN_pm‘lNTq]Al]yLA^ATNiawNl]V_Nm‘qilaapplNNm‘A_LLVmAI]N County of Los Angeles All-Hazards Mitigation Plan Page 128 of 204 plA_mialpApVa_ JallVLalm  _apAI]N NxA^i]N aJJqllNL V_ A_qAly ‚€‚…‘ wUN_ wVLNmilNAL wV_Lmpal^m JAqmNL iawNl aqpATNm Sal ^alN pUA_ ‚€€‘€€€ Jqmpa^Nlm‘ V_J]qLV_T AiilaxV^ApN]y ‚‡‘€€€ !am _TN]Nm NiAlp^N_p aS :ApNlA_L-awNl Ÿ!:-  Jqmpa^Nlm A_L avNl …‚‘€00 Southern California Edison (SCE) customers. qlV_TpUVmmA^NiNlVaL‘wV]LœlNmNxAJNlIApNLIypUNmpla_TwV_LmV^iAJpNLmNvNlA] ^NLVJA] SAJV]VpVNm‘ LVmlqipV_T JlVpVJA] UNA]pU mNlvVJNm A_L lNkqVlV_T pUN N^NlTN_Jy relocation of patients. 3al_ALaNm‘wUV]NlAlN‘UAvNA]maLN^a_mplApNLLNmplqJpVvNJAiAJVpyV_]aJA]V|NLAlNAm _"AlJU‚€‚…‘A_-€pal_ALapaqJUNLLaw_V_-VJa0VvNlA‘Law_V_TiawNl]V_NmA_L plNNm A_L aImplqJpV_T laALwAym‘ UVTU]VTUpV_T pUN iapN_pVA] Salpal_ALVJ AJpVvVpy pa impact urban communities. These hazards not only endanger life and property but also pUlNApN_NJa_a^VJJa_pV_qVpyA_LpUNSq_JpVa_V_TaSN^NlTN_JymNlvVJNm‘iAlpVJq]Al]y in vulnerable neighborhoods and areas with aging infrastructure. 6.10.8 Mitigation and Preparedness Efforts to mitigate the effects of severe wind and tornadoes should focus on improving mplqJpqlA] lNmV]VN_JN‘ N_UA_JV_T NAl]y wAl_V_Ts and alerts‘ A_L V_JlNAmV_T iqI]VJ awareness of such events. Severe Wind and Tornado Mitigation x Strengthening building codes to require wind-resistant design features. Promoting the use of wind-resistant materials and construction techniques in new developments. x Conducting regular tree-trimming and vegetation management to reduce infrastructure damage risks. x 0NplaœppV_TA_LlNV_SalJV_TJlVpVJA]V_SlAmplqJpqlN‘mqJUAmiawNl]V_NmA_LqpV]Vpy mympN^m‘pawVpUmpA_LUVTU-wind conditions. x Implementing public education campaigns on windstorm preparedness and safety measures. x Leveraging early warning alerting and ilNiAlNL_Nmm ^NmmATV_T‘ Am wN]] Am integrating emergency messaging with local broadcast and mobile networks. County of Los Angeles All-Hazards Mitigation Plan Page 129 of 204 6.10.9 Summary 1NvNlNwV_LA_Lpal_ALaNm‘pUaqTULVSSNlV_TV_SlNkqN_Jy‘lN^AV_iapN_pVA]UA|AlLmSal Los Angeles County. Santa Ana winds and storm-driven gusts regularly impact the lNTVa_‘JAqmV_TLA^ATNpaV_SlAmplqJpqlNA_LV_JlNAmV_TwV]LœlNlVm\m:UV]Npal_ALaNm alNlAlN‘pUNVlaJJAmVa_A]aJJqllN_JN_NJNmmVpApNmilNiAlNL_NmmA_L^VpVTApVa_NSSalpm y V^i]N^N_pV_T mpla_TNl IqV]LV_T JaLNm‘ lNV_SalJV_T JlVpVJA] V_SlAmplqJpqlN‘ A_L enhancing preparedness and iqI]VJAwAlN_Nmm‘pUNJaq_pyJA_lNLqJNVpmvq]_NlAIV]Vpy to these hazards‘ helps to better protect its residents from potential hazards of severe winds and tornado and improve community resilience. County of Los Angeles All-Hazards Mitigation Plan Page 130 of 204 CouCouCouCouCouCountyntyntyntyntyntyyyyyyy ofofofofofofof LoLoLoLoLoLos As AsAsAs AsAAAngengengengeggngegegengengengegegeggegeggeeeeeegegeeegeegegegeeeeeeeeeeegggggeeeeeeeegegggggggeeeeeeegggggggeeegeegegggggggggeeeeeeggggggggeeeeeggggggeggggggelesleslesleseseleleelesslesleseseseseeeelelesleslesleeeeslesllleseseleslesllleeeeesleseeleslesleesellleeeeseseseeeesleseeelesseeeesseeeesssseseeesesslesllllleellsllle AAllAAllAllAllAllAAAA---HHazHazHazHazHazHazzzzazzaaHazzazazzzzzzzzazzzzazzzzzzzzzazazazzzzzzzzzzzzzzzazazzzzzzazzzzzzzzzzzzzzzzzzzaazzzzazzzzazzzzzardardardardardardardardardardardrdardardardardardrddardardardddardarddardardaadarddddddddds MsMssMssMsMMsMsMsMsMsMsMs Ms ssMsMssMssMssMMMMMsssMssMMsMMMssMMMsssMMssMMs s MMMsMsMMMMMMMMMMMMMMMsMMMMMMMsMMsMMMMMMMMs Ms MsMs MssMMMMs Ms Ms Ms Ms MsMMMMss s Ms Ms MsMs MMs Ms Ms MMMMMMsss MMMMsssss MsMitiitiiitiiititititiitititiititttititiitiiitititiittttttitiiiiitittttttttiiitititiiititttitttiiiitiitiitittttiiitiitiiitiiiitittttttiitgatgatgatgatgatgatgatgatgatggatgatgattgagatgatggatgggatgtggggatgatggggggagatggatgggggaggatgggggagggatgagagaggggggataggaggggagagaaggggggggggggggggggggggggggioioooonononnioiooonononnnioioooonoonoioiooooooonoooooooooooonioooonooononiooooioo PlPllPlaaaPlaPlaPlaaaPlaPllaaPlPlaPlaPllaaaaaPlPlPllalaaaPlPlPlaPlaPlaaaaalaPlaalPlPlaaaPlaaaalaaPPPllaPlaaaPllaaaaaPPPPPPPPPPPlPllaaaPPPPPPPPlPllaaPPPPPPPPlPlaaaaPPPllaaPPPllaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6.11 Mass Violence 6.11.1 Nature 3UVmmNJpVa_aqp]V_NmpUNLNœ_V_T JUAlAJpNlVmpVJm aS ^Amm vVa]N_JN‘ wUVJU V_J]qLNm V_pN_pVa_A]‘ UVTU- V^iAJp V_JVLN_pm mqJU Am pNllalVm^‘ AJpVvNmUaapNlNvN_pm‘vNUVJ]N- lA^^V_Tm‘A_LapUNlJaalLV_ApNL attacks. Understanding the nature of these events is critical for developing effective mitigation strategies. x Mass violence includes both pAlTNpNL AppAJ\m ŸNT‘ ideologically motivated terrorism) and opportunistic AJpm ŸNT‘ AJpVvN mUaapNlm al violent assaults in public spaces). x 3UNmNV_JVLN_pmAlNJUAlAJpNlV|NLIypUNVl]awwAl_V_TpV^N‘UVTU]NpUA]Vpy‘A_L potential to incite widespread fear and panic. County of Los Angeles All-Hazards Mitigation Plan Page 131 of 204 x Acts of mass violence may be perpetrated by V_LVvVLqA]m‘m^A]]Tlaqim‘ or well-organized _Npwal\m‘ A_L JA_ V_va]vN œlNAl^m‘ Nxi]amVvNm‘ vNUVJ]Nm‘ al biological agents. x These attacks often aim to disrupt societal Sq_JpVa_m‘ LA^ATN V_SlAmplqJpqlN‘ al Nxi]aVp vulnerabilities in soft pAlTNpm mqJU Am mJUaa]m‘ i]AJNmaSwalmUVi‘al entertainment venues. _mq^^Aly‘pUN_ApqlNaS^Amm violence lies in its deliberate V_pN_ppaV_ŔVJpUAl^a_Tlaqim A_L LVmlqip iqI]VJ alLNl‘ making strong mitigation measures essential for protecting life and property of Los Angeles County. 6.11.2 Extent The potential extent of mass violence is characterized by its ability to cause widespread LVmlqipVa_A_LmVT_VœJA_p]ammaS life and property. County of Los Angeles All-Hazards Mitigation Plan Page 132 of 204 x Events can result in many casualties and severe physical and psychological impacts. x Mass violence can LVmlqip NmmN_pVA] mNlvVJNm‘ mplAV_ N^NlTN_Jy lNmia_mN mympN^m‘A_LJlNApNJAmJALV_TmaJVaNJa_a^VJNSSNJpm x 3UNavNlA]]LVmlqipVa_^AyNxpN_LSAlINya_LpUNV^^NLVApNmJN_N‘ASSNJpV_T broader community resilience. _ NmmN_JN‘ wUV]N pUNmN NvN_pm ^Ay IN lAlN‘ pUNVl NxpN_mVvN V^iAJpm _NJNmmVpApN comprehensive planning and resilient infrastructure. 6.11.3 History VmpalVJA]LApAV]]qmplApNmpUAp^AmmvVa]N_JNUAmNva]vNLavNlpV^N‘wVpUNAl]VNlNvN_pm shaping current mitigation strategies and more recent incidents underscoring emerging vulnerabilities. Previous mitigation and other plans referenced events such as large-scale terrorist attacks and active shooter incidents. x 0NJN_pNvN_pmV_pUN]AmpœvNyNAlmV_J]qLNUVTU-ilaœ]NAJpVvNmUaapNlV_JVLN_pm Ap mJUaa]m‘ iqI]VJ plA_mialpApVa_ UqIm‘ A_L Ja^^NlJVA] JN_pNlm‘AmwN]]Am vehicle-ramming attacks in urban areas. %vNlA]]‘pUNUVmpalVJA]plN_LmUawmpUApwUV]NSlNkqN_JylN^AV_m]aw‘pUNmNvNlVpyaS mass violence i_JVLN_pmUAmNmJA]ApNL‘_NJNmmVpApV_TJa_pV_qA]qiLApNmpa^VpVTApVa_ strategies. 6.11.4 Location "AmmvVa]N_JNV_JVLN_pmpN_LpaaJJqlV_AlNAmwUNlNiNai]N_ApqlA]]yJa_TlNTApN‘ V_J]qLV_TqlIA_JN_pNlm‘plA_mialpApVa_UqIm‘NLqJApVa_A]and religious V_mpVpqpVa_m‘ mUaiiV_TJN_pNlm‘A_LiqI]VJevents and venues. x -qI]VJmiAJNmmqJUAmplA_mVpmpApVa_m‘mpALVq^m‘^A]]m and other locations where ]AlTN_q^INlaSiNai]NAmmN^I]N‘ are considered higher-risk areas. x Critical infrastructure location‘like government buildings and commercial center‘are often targeted. x Certain events may also occur in areas lacking adequate physical security or surveillance. County of Los Angeles All-Hazards Mitigation Plan Page 133 of 204 3Uqm‘VLN_pVSyV_TA_LmNJqlV_TUVTU-density locations is a key focus for mitigating the effects of mass violence. 6.11.5 Probability 3UNilaIAIV]VpyaS^AmmvVa]N_JNV_JVLN_pmVmLVSœJq]ppailNLVJpilNJVmN]y“UawNvNl‘pUN potential for occurrence is recognized as a persistent low-SlNkqN_Jy‘UVTU-impact risk that requires constant vigilance. x Such incidents are statistically rare yet present a disproportionate risk due to their catastrophic consequences. x Threat assessments and intelligence reports indicate that evolving tactics may increase probability over time. x a_pV_qaqm^a_VpalV_TA_LqiLApNLpUlNApA_A]ymNmŸNT‘vVA30ilaJNmmNm  are essential in quantifying risk levels. _ mq^^Aly‘ wUV]N ^Amm vVa]N_JN NvN_pm AlN _ap Ja^^a_‘ pUNVl V_UNlN_p unpredictability and high severity demand that communities prepare as if an incident could occur at any time. 6.11.6 Vulnerability Mass vVa]N_JNLNiN_Lma_AvAlVNpyaSSAJpalm‘V_J]qLV_TiUymVJA]V_SlAmplqJpqlNLNmVT_‘ iqI]VJAwAlN_Nmm‘mNJqlVpyilNiAlNL_Nmm‘A_LV_pNlATN_JyJaalLV_ApVa_ x Critical vulnerabilities include open public spaces with minimal physical barriers or limited or ineffective safety / security protocols in place. x ௗAimV_plAV_V_TA_LilNiAlNL_NmmA^a_TœlmplNmia_LNlmJA_NxAJNlIApNpUN situation during an active incident. x Social vulnerabilities—such as communication gaps or lack of multilingual emergency information—may hinder rapid response and community resilience. 3Uqm‘ lNLqJV_T vq]_NlAIV]Vpy V_va]vNm V_vNmpV_T V_ V_SlAmplqJpqlN UAlLN_V_T‘ laIqmp mNJqlVpy ^NAmqlNm‘ lNTq]Al plAV_V_T NxNlJVmNm‘ A_L NSSNJpVvN iqI]VJ Ja^^q_VJApVa_ strategies. County of Los Angeles All-Hazards Mitigation Plan Page 134 of 204 6.11.7 Impacts 3UNV^iAJpmaS^AmmvVa]N_JNNvN_pmAlN^q]pVSAJNpNL‘life safety‘Ja^^q_VpympAIV]Vpy‘ and the local economy. x ^^NLVApN V^iAJpm V_J]qLN SApA]VpVNm‘ V_[qlVNm‘ A_L plAq^A A^a_T ASSNJpNL populations. x 1NJa_LAly V^iAJpm ^Ay N_Ja^iAmm ila]a_TNL LVmlqipVa_ aS ]aJA] mNlvVJNm‘ NJa_a^VJLaw_pql_m‘A_L]AmpV_TimyJUa]aTVJA]NSSNJpma_Ja^^q_VpVNm x Long-term consequences can involve extensive resource allocation for recovery A_L^VpVTApVa_‘SqlpUNlmplAV_V_TiqI]VJmympN^m "AmmvVa]N_JNV_ŔVJpmV^^NLVApNUAl^A_LaSpN_plVTTNlmAJUAV_aSmNJa_LAlyV^iAJpm that complicate community recovery and strain long-term resilience efforts. 6.11.8 Summary _Ja_J]qmVa_‘^VpVTApV_TpUNUA|AlLmaS^AmmvVa]N_JNlNkqVlNmA_V_pNTlApNL‘^q]pV- ]AyNlNL AiilaAJU pUAp miA_m ilNvN_pVa_‘ ilNiAlNL_Nmm‘response and recovery. Communities must implement measures to secure high-lVm\ ]aJApVa_m‘ qiTlALN iUymVJA] A_L LVTVpA] mNJqlVpy‘ N_UA_JN V_pNlATN_Jy JaalLV_ApVa_‘ A_L Ja_pV_qaqm]y update training and threat assessments. x "VpVTApVa_mplApNTVNmV_J]qLNiUymVJA]mNJqlVpyN_UA_JN^N_pmŸNT‘IAllVNlmA_L mqlvNV]]A_JN ‘lNTq]AlAJpVvNmUaapNlLlV]]m‘V^ilavNLN^NlTN_JyJa^^q_VJApVa_ mympN^m‘A_LJaalLV_ApNL]AwN_SalJN^N_pA_LiqI]VJUNA]pUlNmia_mNm x Investment in resilience-building measures and community outreach helps to N_mqlNpUAp‘V_pUNNvN_paSA_V_JVLN_p‘Ja^^q_VpVNmJA_lNJavNlkqVJ\]yA_L effectively. This section underscores that while mass violence NvN_pmAlNlAlN‘pUNVliapN_pVA]Sal high impact demands rigorous preparedness and adaptive mitigation strategies to safeguard lives and maintain community functionality. County of Los Angeles All-Hazards Mitigation Plan Page 135 of 204 6.12 Cybersecurity Incidents 6.12.1 Nature Cybersecurity incidents refer to disruptive events affecting digital networks and systems. These events involve the unauthorized electronic or physical access of information systems that jeopardizes or disrupts pUN V_pNTlVpy‘ Ja_œLN_pVA]Vpy‘ al availability of information. Cyber incidents can range from minor targeted data breaches to large- scale ransomware attacks and distributed denial-of-service (DDoS) events that compromise critical infrastructure. Common types of JyINlmNJqlVpyV_JVLN_pmV_J]qLN‘Iqp are not limited to: x Data Breaches:3UN Ja^ila^VmN‘ q_AqpUalV|NL LVmJ]amqlN‘ al q_AqpUalV|NL acquisition of information. CouContytyttyyntyy offofofo LoLoLoLLLoLLLLLooLLLosAs AsAs As AsAsAs AsAs As As As As AA AAs AAAAAAAAAAAAAngengengngengengengengengengngegngengengengengengngegegeenggngegengeegngennglesleslesesleslesllesleslesleslesleseslesleesesleslesessesleseslleselel AllAA-HazHazHazHHHHHazHazHazzzHaaardardardrdardardrddardddddardddardddrdds Ms Ms Ms Ms Ms MsMsMMs Ms MsMMsMMMMs MMMMMs MMMs Ms MMs Ms MMs Mitiitiitiitiitititiitiitiitiiititiititiitttitiiititittgatgatgatgagatgatgatgatgatgatgatgatgatatgatgatgatggagatgagatagggggattaaaaioiononionionionionionnnionionionionionnnnononionnoonnonnonnoionoonnoonoononionnononniooonnnnooooonooononnnnnn PlPlPlPlPlPlPlPllPPPllPPlPlPPPPPlPllPlaPlaPPPPPlPlaPPPPlPlPPPPPPPlaaPPPPllPlPlaPPPllaPPPnn County of Los Angeles All-Hazards Mitigation Plan Page 136 of 204 x Malware: "A]VJVaqm UAlLwAlN‘ œl^wAlN‘ al maSpwAlN pUAp Vm V_pN_pVa_A]]y included or inserted in a system for a harmful purpose. x 0A_ma^wAlN’ A type of malicious software designed to lock access to a system until a ransom payment is received. Note that ransom payment is not a guarantee that system access will be restored by the threat actor. x Denial of Service (DoS): _AppAJ\^NA_ppamUqpLaw_A^AJUV_Nal_Npwal\‘ rendering it inaccessible to its intended users. x Distributed Denial of Service (DDos): A DoS attack that uses numerous hosts to perform the attack. x Insider Threats: :UN_ A_ V_mVLNl ŸNT‘ A_ N^i]ayNN al vN_Lal  qmNm pUNVl AqpUalV|NLAJJNmm‘wVppV_T]yalq_wVppV_T]y‘paLaUAl^paA_alTA_V|ApVa_ x -UVmUV_TppAJ\m’ The fraudulent practice of sending emails purporting to be from reputable senders in order to induce individuals to reveal information or download malware by clicking on a link. Key characteristics of a cybersecurity incident include: 0AiVL%_mNp’ Impacts to operations can occur suddenly and evolve quickly. x Sophistication: Can be highly sophisticated with state or non-state actors involved. x yIlVL ppAJ\m’ May involve both cyber and physical components due to interdependencies. x Non-Malicious Incidents: Technological failures that cause similar impacts to cybersecurity incidents may also occur due to non-malicious reasons such as a software or hardware issue. Understanding the inherent digital nature and complex characteristics of these incidents is critical to developing effective prevention and mitigation strategies. 6.12.2 Location 4_]V\NplALVpVa_A]UA|AlLmpUApUAvNAiUymVJA]TNaTlAiUVJSaapilV_p‘ JyINlmNJqlVpy V_JVLN_pmAlNV_UNlN_p]yplA_mIaq_LAlyawNvNl‘pUNVlNSSNJpm^A_VSNmp]aJA]]ypUlaqTU the disruption of critical services and systems and necessitate regionally coordinated preparedness and response efforts. County of Los Angeles All-Hazards Mitigation Plan Page 137 of 204 qlVmLVJpVa_A]0N]NvA_JN’ x Impact local government networks and county infrastructure. x Affect public and private sector systems within Los Angeles County. x Disrupt critical infrastructure such as utilities and cause cascading impacts. x _va]vN JyINl _aLNm pUAp‘ wUV]N T]aIA]]y LVmplVIqpNL‘ Ja_vNlTNa_ lNTVa_A] networks. Critical Sectors Impacted: x Hospitals and healthcare facilities. x Financial‘IA_\V_T‘aliAyla]]systems. x Transportation providers and systems. x 4pV]VpVNmmqJUAmN]NJplVJVpy‘TAm‘A_LwApNl x Emergency response and public safety agencies. 6.12.3 Extent The extent of cybersecurity incidents is measured not only by the volume of Ja^ila^VmNLLApAalœ_A_JVA]]ammIqpA]maIypUNiapN_pVA]LVmlqipVa_paNmmN_pVA] services and critical infrastructure. Scope of Impacts: x Rapid spread across interconnected digital systems. x Potential for cascading failures that disrupt multiple sectors. x Economic losses that may run into millions of dollars. Measurable Factors: x Number of systems compromised. x Downtime of critical infrastructure and services. x Financial costs from remediation and lost productivity. The extensive reach of cybersecurity incidents—both in terms of economic impact and service disruption—highlights the need for robust digital defenses‘ Ja_pV_qVpy aS aiNlApVa_mi]A__V_T‘IAJ\qimympN^mA_LlNLq_LA_JVNm‘LVmAmpNllNJavNlymplApNTVNm‘ and regional cyber response coordination. County of Los Angeles All-Hazards Mitigation Plan Page 138 of 204 6.12.4 History VmpalVJA]]y‘ JyINlmNJqlVpy V_JVLN_pm UAvN Nva]vNL Sla^ Vma]ApNL IlNAJUNm pa coordinated attacks that leverage global networks. Early cybersecurity incidents focused on data theft and vandalism. More recent attacks have grown increasingly sophisticated and targeted critical infrastructure or use complex ransomware. Cyber threat actors include state-sponsored groups along with non-state groups such as criminal enterprises and terrorist organizations. Recent years have seen cybersecurity incidents affecting ]AlTNJalialApVa_m‘iqI]VJN_pVpVNmV_J]qLV_T]aJA]TavNl_^N_pm‘A_L critical infrastructure sectors. Previous major cybersecurity incidents have included: x ‚€‚„!am_TN]Nmaq_py1qiNlValaqlp0A_ma^wAlNppAJ\’Resulted in pUNmUqpLaw_aS_NAl]yNvNlyJaqlpmympN^‘A^q]pV-LAyJ]amqlNaSpUNJaqlp‘A_L cascading impacts to operations. x ‚€‚„amiVpA]laqippAJ\’A major hospital company experienced an attack that caused IT and phone system outages and disrupted patient care at several Los Angeles County hospitals. x ‚€‚„ 3N]NJa^^q_VJApVa_ _Lqmply ppAJ\m: A series of attacks against telecommunications providers in the United States resulted in compromised customer data. x ‚€‚ƒVpyppAJ\’A cybersecurity incident at a city within Los Angeles County JAqmNLJVpy3mympN^mpaINpA\N_aSŔV_N x ‚€‚‚vVApVa__LqmplyppAJ\m’ A series of cybersecurity incidents targeting the airports and airlines caused transportation system disruptions. The historical progression from rudimentary attacks to highly coordinated cybersecurity incidents underscores the growing importance of proactive risk management in the digital realm. 6.12.5 Probability The probability of cybersecurity incidents occurring is increasing as digital interconnectivity expands and as attackers continue to innovate their methods. County of Los Angeles All-Hazards Mitigation Plan Page 139 of 204 0Vm\Trends: x Rapid expansion of the Internet of Things (IoT)‘ pUN _Npwal\ aS V_pNl_Np- connected devices ranging from smart refrigerators to autonomous vNUVJ]Nm‘ has added new attack vectors to the threat landscape. x Increasing sophistication of cybercriminal methods including zero-LAyNxi]aVpm‘ a previously unknown cybersecurity vulnerability. x Growing frequency of reported incidents nationally and globally. Contributing Factors: x Inadequate cybersecurity measures in legacy systems still being used by organizations. x Underinvestment in cyber defense infrastructure or cybersecurity expertise. x Greater digital reliance in everyday operations without proper continuity of operations planning. VvN_JqllN_pplN_LmA_LpNJU_a]aTVJA]LNvN]ai^N_pm‘pUN]V\N]VUaaLaSJyINlmNJqlVpy V_JVLN_pmlN^AV_mUVTU‘_NJNmmVpApV_Ta_TaV_TvVTV]A_JNA_LN_UA_JNLilNiAlNL_Nmm measures. mJyINlmNJqlVpyV_JVLN_pmJa_pV_qNpaV_JlNAmNV_SlNkqN_Jy‘pUNiapN_pVA] for an incident to cause cascading and widespread impacts to critical infrastructure increases as well. 6.12.6 Vulnerability Vulnerability in the context of cybersecurity refers to the susceptibility of digital systems paAppAJ\3UVmVmV_ŔqN_JNLIyIapUpNJU_a]aTVJA]A_LalTA_V|ApVa_A]SAJpalmV_J]qLV_T‘ Iqp _ap ]V^VpNL pa’ aqpLApNL maSpwAlN al qmN aS ]NTAJy mympN^m‘ V_mqSœJVN_p iApJU ^A_ATN^N_p‘V_ALNkqApNmNT^N_pApVa_A_LLNSN_mN-in-LNipUmplApNTVNm‘A_L]AJ\aS cybersecurity training among personnel. Organizational challenges also contribute to JyINlmNJqlVpyvq]_NlAIV]VpyV_J]qLV_T‘Iqp_ap]V^VpNLpa’IqLTNpJa_mplAV_pm‘gaps in JaalLV_ApVa_‘ A_L lAiVL pNJU_a]aTy ALaipVa_ wVpUaqp JallNmia_LV_T mNJqlVpy protocols. JJalLV_TpapUN‚€‚„3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_pŸ30 ‘ avNl††‘€€€iNai]N^AyIN ASSNJpNLIy A]AlTN-scale cybersecurity incident with cascading impacts to utilities. Over ‚ƒ‘€€€of those impacted in the THIRA scenario are estimated to UAvN AJJNmm A_L Sq_JpVa_A] _NNLm A_L avNl ‡‡‘€€€ iNai]Nare County of Los Angeles All-Hazards Mitigation Plan Page 140 of 204 estimated to have ]V^VpNL_T]VmUilaœJVN_JyNiN_LV_Ta_pUNqpV]VpVNmASSNJpNLIy the V_JVLN_p‘AwVLNmilNALA^aq_paSpUNiaiq]ApVa_Jaq]LINwVpUaqpqpV]VpymNlvVJN for an extended period. Addressing these vulnerabilities is essential to reduce the risk and potential disruption aSJyINlmNJqlVpyV_JVLN_pm‘JA]]V_TSalIapUpNJU_VJA]qiTlALNm and improved interagency coordination. 6.12.7 Impacts 3UNV^iAJpmaSJyINlmNJqlVpyV_JVLN_pmAlN^q]pVSAJNpNL‘ASSNJpV_TNJa_a^VJmpAIV]Vpy‘ iqI]VJmASNpy‘A_LJlVpVJA]V_SlAmplqJpqlNaiNlApVa_m Direct Impacts: x VmlqipVa_ aS JlVpVJA] mNlvVJNm ŸNT‘ UNA]pUJAlN‘ N^NlTN_Jy lNmia_mN‘ plA_mialpApVa_‘NpJ). x Extended duration Continuity of Government or Continuity of Operations event. x Financial losses due to ransom payments‘ remediation costs‘A_LiapN_pVA]]NTA] fees. x Loss‘compromise‘alq_AqpUalV|NLlN]NAmN of sensitive data. Indirect impacts: x Erosion of public trust in digital services and affected institutions. x AmJALV_TNSSNJpma_iUymVJA]V_SlAmplqJpqlNŸNT‘iawNlTlVL‘wApNlmympN^m‘ wAmpNwApNl‘NpJ  x Long-term economic repercussions from reduced competitiveness. x 3UNmVT_VœJA_pV^iAJpm—both direct and cascading—of cybersecurity incidents necessitate comprehensive mitigation and recovery strategies that address both technical and socioeconomic dimensions. 6.12.8 Summary _ mq^^Aly‘ JyINlmNJqlVpy V_JVLN_pm lNilNmN_p A_ Nva]vV_T A_L JlVpVJA] pUlNAp pUAp intersects with multiple aspects of community resilience and safety. Ny3A\NAwAym’ x yINlV_JVLN_pmAlNLy_A^VJ‘maiUVmpVJApNL‘A_LSAl-reaching in impact x They affect local systems despite their global nature County of Los Angeles All-Hazards Mitigation Plan Page 141 of 204 x Historical trends and increasing digital dependency heighten both probability and vulnerability x ^iAJpmNxpN_LINya_Lœ_A_JVA]]ammpaV_J]qLNmNlvVJNLVmlqipVa_A_L cascading infrastructure failures yINlmNJqlVpy V_JVLN_pm LN^A_L A ilaAJpVvN‘ JaalLV_ApNL lNmia_mN pUAp V_pNTlApNm robust technical defenses with cross-sector planning and recovery efforts. By q_LNlmpA_LV_T pUN _ApqlN‘ mJaiN‘ A_L iapN_pVA] Ja_mNkqN_JNm aSpUNmN V_JVLN_pm‘ communities can build more resilient digital and physical infrastructures to safeguard against this growing threat. County of Los Angeles All-Hazards Mitigation Plan Page 142 of 204 6.13 Transportation Incidents 6.13.1 Nature This section describes the inherent characteristics of transportation incidents that can LVmlqippUNJa_pV_qaqmŔawaSiNai]N‘TaaLm‘A_LN^NlTN_Jy mNlvVJNmAJlamm!am Angeles County. Transportation incidents can be triggered by a variety of factors V_J]qLV_T _ApqlA] NvN_pm‘ Uq^A_ Nllal‘ A_L LN]VINlApN AJpmOther characteristics include: x Affected Modes of Transportation: Incidents can involve any mode of transportation such as multi-vNUVJ]N Ja]]VmVa_m‘ UA|AlLaqm ^ApNlVA] miV]]m‘ lAV] LNlAV]^N_pm‘AvVApVa_incidents‘A_L^AlVpV^NLVmlqipVa_m x Cascading Impacts: Disruptions to the transportation system often have the potential to trigger cascading failures due to the interconnected design of UVTUwAym‘lAV]_Npwal\m‘AVlialpm‘A_Lseaports. x Contributing Factors: Incidents may INV_ŔqN_JNLIyIapUilNLVJpAI]NSAJpalm ŸNT‘rush-Uaql Ja_TNmpVa_  A_L q_ilNLVJpAI]N aJJqllN_JNm ŸNT‘ NxplN^N weather or infrastructure failure). 6.13.2 Location 3UNJaq_py¯m_Npwal\N_Ja^iAmmNmUVTUwAym‘lAV]‘AVlialpm‘ialpm‘A_L]aJA]laALmpUAp are critical to regional mobility and commerce. CCCouCouCntynty ofo LoLos As Angengeeeeleslesleslelele AllAl-Hazazardars MMMs Mitigatggiononnn PlaPlaPlPlPlPnn County of Los Angeles All-Hazards Mitigation Plan Page 143 of 204 x Freeways: Los Angeles County boasts an extensive freeway system with over ‘‚€€^V]NmaSUVTU-capacity roads including corridors such as I-…‘-„€…‘-€‘ I-‡€‘A_L-210. x Major Transportation Hubs: The County is home to three commercial airports including Los Angeles International Airport (LAX)‘Long Beach Municipal Airport (LGB)‘and the Hollywood Burbank Airport (BUR) along with several general AvVApVa_AVlialpm3UNaq_pyaw_mA_LaiNlApNm lAJ\NppVN]LVlialp‘ a^ipa_:aaL]NyVlialp‘1A_AIlVN]9A]]NyVlialp‘N_NlA]:V]]VA^ax VlœN]L‘A_L:UVpN^A_VlialpThe -alpmaS!am_TN]NmA_L!a_T NAJU‘wUVJU are two of the busiest ports in the United States and vital for national and international trade‘AlNA]maV_!am_TN]Nmaq_pyLLVpVa_A]]y‘!am_TN]Nm Union Station serves as the largest passenger rail station on the west coast. x %pUNl3lA_mialpApVa_#Npwal\m’The county includes robust passenger rail‘ bus‘A_LiAlAplA_mVp mympN^m‘A]a_TwVpUSlNVTUplAV]mympN^m‘emerging mobility options such as taxis and rideshare services‘and enhanced bicycle networks. 3UVmJa^ilNUN_mVvN_Npwal\VmpUNIAJ\Ia_NSalLAV]yJa^^qpV_T‘ SlNVTUp ^avN^N_p‘A_LN^NlTN_JylNmia_mNAJlammpUNlNTVa_ 6.13.3 Extent The scope of transportation incidents spans multiple modes of travel and can have widespread consequences across the county’s integrated infrastructure.Road incidents may include multi-vNUVJ]N Ja]]VmVa_m‘ UA|AlLaqm ^ApNlVA] miV]]m‘ A_L laALwAy œlNm impacting multiple vehicles with potential delays in emergency responses. x 0AV]LVmlqipVa_mJA_V^iNLNJa^^qpNlA_LSlNVTUpmNlvVJNm‘V^iAJpV_TIapU]aJA] transit and regional connectivity. x Air and maritime incidents—such as delays at major airports or disruptions at port facilities—JA_mVT_VœJA_p]yASSNJpJa^^NlJN‘mqii]yJUAV_m‘A_LiqI]VJmASNpy x Cascading effects across interconnected transportation modes may exacerbate Ja_TNmpVa_A_LmplAV_ALLVpVa_A]V_SlAmplqJpqlNmympN^mmqJUAmiawNl‘wApNl‘ and emergency communications. The extensive and interdependent nature of these networks means that an incident in a_NAlNAJA_kqVJ\]yV_ŔqN_JN^q]pVi]NplA_mialpApVa_mympN^m County of Los Angeles All-Hazards Mitigation Plan Page 144 of 204 6.13.4 History Los Angeles County has a long record of transportation-related incidents that have disrupted mobility and commerce. x ‚€‚„9V_JN_p3Ua^Am lVLTNVlN’ A semi-truck carrying lithium-ion batteries avNlpql_NLA_LJAqTUpœlN‘JAqmV_TpUNIlVLTNpaINJ]amNLSalmNvNlA]LAym x 2023 I-10 Freeway Fire: œlNV_AiA]]NpyAlLIN]awpUN-10 freeway in Downtown Los Angeles caused an eight-day closure for repairs and major cascading disruptions. x 2020 Delta Air Lines Flight 89 Fuel Drop: 1Ualp]yASpNlpA\NaSSSla^!;‘A Boeing 777 encountered engine problems and conducted a fuel dump over iaiq]ApNLAlNAm‘V_[qlV_TavNl…€iNai]Na_pUNTlaq_L x ‚€€ˆUApmwalpU"Npla]V_\NlAV]^N_p’ A Metrolink passenger train collided wVpUA4_Va_-AJVœJSlNVTUpplAV_V_[qlV_TavNlƒ€iNai]NA_LJAqmV_T‚…LNApUm x 2007 Newhall Pass Tunnel Fire: A multi-vehicle collision involving over 30 vNUVJ]NmJAqmNLAœlNwVpUV_pUNpq__N]V_[qlV_T€iNai]NA_LJAqmV_TƒLNApUm The historical record reinforces the need to learn from previous events to enhance future preparedness and resilience. 6.13.5 Probability The likelihood of transportation incidents in Los Angeles County remains elevated due to several converging factors V_J]qLV_T‘Iqp_ap]V^VpNLpa’ x VTULAV]yplASœJva]q^Nma_SlNNwAymA_LAlpNlVA]mV_JlNAmNpUNlVm\aS^q]pV- vehicle accidents and congestion-related incidents. x Aging infrastructure—V_J]qLV_TIlVLTNm‘laALmqlSAJNm‘A_LlAV]mympN^m—creates AiNlmVmpN_plVm\aSSAV]qlN‘iAlpVJq]Al]yq_LNlNxplN^NwNApUNlJa_LVpVa_mA_L during peak usage periods. x 3UNJaq_py¯mla]NAmA^A[alUqISalSlNVTUpA_LJa^^qpNlplASœJ^NA_mpUApNvN_ minor incidents can escalate rapidly into larger disruptions. x The frequent movement of hazardous materials and the increasing reliance on just-in-time delivery systems further elevate the risk of incidents with potentially severe consequences. County of Los Angeles All-Hazards Mitigation Plan Page 145 of 204 3aTNpUNl‘pUNmNSAJpalmJa_plVIqpNpaAJa_mVmpN_p]yUVTUilaIAIV]VpyaSplA_mialpApVa_ incidents impacting the region. 6.13.6 Vulnerability The vulnerability of Los Angeles County’s transportation system is compounded by its interdependent design and its critical role in the regional economy. x Limited redundancy in key corridors means that a disruption on one freeway or rail line can quickly overload alternate routes. x TV_T A_L avNlIqlLN_NL V_SlAmplqJpqlN Vm ]Nmm lNmV]VN_p pa NxplN^N NvN_pm‘ leading to longer recovery times after incidents. x The county’s economic dependence on uninterrupted transportation for daily Ja^^qpV_T A_L Ja^^NlJVA] SlNVTUp V_JlNAmNm NxiamqlN pa mVT_VœJA_p ]ammNm during disruptions. x a^i]Nx V_pNlLNiN_LN_JVNm INpwNN_ plA_mialpApVa_ mympN^m‘ N^NlTN_Jy mNlvVJNm‘A_LapUNlJlVpVJA]mNJpalm^A\NpUN_Npwal\UVTU]ymN_mVpVvN pa cascading failures. 3UVm mympN^VJ vq]_NlAIV]Vpy JA]]m Sal JaalLV_ApNL‘ ^q]pV-agency efforts to bolster resilience and implement proactive mitigation measures. 6.13.7 Impacts Transportation incidents can produce both immediate and long-lasting effects on iqI]VJmASNpy‘Ja^^NlJN‘A_LavNlA]]kqA]VpyaS]VSN 1.3lASœJ A_L "aIV]Vpy’ Disruptions can lead to severe congestion affecting Uq_LlNLmaSpUaqmA_LmaSJa^^qpNlmA_LSlNVTUpvNUVJ]Nm‘LN]AyV_TN^NlTN_Jy services and disrupting daily operations. 2.Economic Loss: Interruptions in the movement of goods and people can result V_ mqImpA_pVA] œ_A_JVA] ]ammNm‘ V^iAJpV_T ]aJA] IqmV_NmmNm A_LpUN IlaALNl regional economy. 3.Public Safety: Extended delays in emergency response and Emergency Medical Services (EMS) transport times. 4.Cascading Disruptions: _V_JVLN_pV_a_N^aLNŸNT‘A^A[alUVTUwAy J]amqlN JA_lVii]NpUlaqTUpUNplA_mialpApVa__Npwal\‘ASSNJpV_TlAV]‘AVl‘A_L maritime operations simultaneously and complicating recovery efforts. These impacts highlight the critical need for robust mitigation strategies to manage both direct and indirect consequences of transportation incidents. County of Los Angeles All-Hazards Mitigation Plan Page 146 of 204 6.13.8 Summary Los Angeles County’s transportation network is among the most extensive and complex V_ pUN _ApVa_‘ mNlvV_T ^V]]Va_m aS lNmVLN_pm A_L q_LNliV__V_T AvVpA]NJa_a^VJ NJamympN^ 3UN LVvNlmN plA_mialpApVa_ ^aLNm‘ wUV]N SAJV]VpApV_T ^aIV]Vpy A_L Ja^^NlJN‘A]maJlNApNvq]_NlAIV]VpVNmLqNpaavNl]AiiV_TV_SlAmplqJpqlNA_LUVTUplASœJ volumes. x TV_T V_SlAmplqJpqlN‘ Jaqi]NL wVpU pUN Ja_pV_qaqm ^avN^N_p aS UA|AlLaqm ^ApNlVA]mA_LpUNV_JlNAmV_TilNmmqlNmaS LAV]yqmATN‘Ja_plVIqpNmpaAUVTU probability of incidents. x Historical data demonstrate that even localized incidents can have far-reaching V^iAJpm‘ V_J]qLV_T ila]a_TNL plASœJ Ja_TNmpVa_‘ NJa_a^VJ LVmlqipVa_m‘ A_L public safety challenges. _Ja_J]qmVa_‘^VpVTApV_TplA_mialpApVa_V_JVLN_plVm\mV_!am_TN]Nmaq_pylNkqVlNm A_V_pNTlApNL‘Jaq_pywVLNAiilaAJUpUApJa^IV_NmV_SlAmplqJpqlNqiTlALNm‘N_UA_JNL N^NlTN_Jy lNmia_mN‘ A_L ilaAJpVvN ^AV_pN_A_JN mplApNTVNm LLlNmmV_T pUNmN challenges Vm NmmN_pVA] pa mASNTqAlL iqI]VJ mASNpy‘ N_mqlN NJa_a^VJ mpAIV]Vpy‘ A_L maintain the region’s critical mobility infrastructure. County of Los Angeles All-Hazards Mitigation Plan Page 147 of 204 6.14 Public Health Emergencies 6.14.1 Nature Public health emergencies in Los Angeles County encompass a broad miNJplq^ aS iapN_pVA] UA|AlLm‘ including infectious disease aqpIlNA\m‘ N_vVla_^N_pA] UNA]pU UA|AlLm‘ A_L UN^VJA]‘ Va]aTVJA]‘ 0ALVa]aTVJA]‘ #qJ]NAl‘ xi]amVvNm (CBRNE) hazards. Given the county's LVvNlmN iaiq]ApVa_‘ qlIA_ LN_mVpy‘ A_L NJa_a^VJ mVT_VœJA_JN‘ iqI]VJ health hazards require a coordinated response among government ATN_JVNm‘UNA]pUJAlNV_mpVpqpVa_m‘A_L community partners. Public health emergencies refer to V_JVLN_pmpUApiamNAmVT_VœJA_p threat to the health of a population. These include‘IqpAlN_ap]V^VpNLpa: x -A_LN^VJmŸNT‘%9-‰‘_ŔqN_|A  x VapNllalVm^ŸNT‘_pUlAx‘1^A]]iax‘Iapq]Vm^) CouCouCouCouCouCouCouCouCouCouCCoooCouCouCouCCouCouCCouCouCououCouCoCooCouoCouCoooCoCouuoouCuouCCntyntyntyntyyntyyntnttyntynnnnnnntntytynn ofofoffoffofffffffffofooffffo LoLoLoLooooooLoLoLLLLooLoLLLLoooLoLLLoooooLoLLoooLLLooooooLLLLoooLLLLLLLoooooLLLLLLLoooLLLooooooLLLoooooooooLLLoooooooLLLooooooLLoooooooLooooooooLLLooooooooooLoooooooooooooooooooooooLooLoooosAsAAAsssAAsAAsAAAsAsAAsAAssAAsAsAsAsAsAsssAAAAsssAsAAsAsAsAAsAsAAAAAssAAAssAAAAAAAAAAAAsAssAAAAssAAsssssAsAAsAsAsAssssAssAAAAAAAAAsAAAAAAAAAAAAAsssAAAAAAAAAAssssssssAAAAAAAAAssssssssssssAAAAAAsAAAs s AAs As ngnngnggeeeegeengnnnggnggngeeeegegeeeegennnggngngggegegeeeeeegenggggggeeeeengennnnnnngggggggngengengegengengennngengengegggeeengengenngengengeggennnnnngegnnnngennngngeeennnnnneeeeengnnngeegennneeeennneeeeneeengellllllllllllllelesslleseeeeeeeeeeeesssslesesesllleeeeleeesesleslesesesssslleeeesleslesesssesslessleslelllesesssssslesslesesesesessssesss AAAAAAAAAAlAlllAlllAAAAAAAAAAll-------HaHaHaHazazazazzzzzzzzzzHzHaaHaHaHHHaazHaHaHaaazzHaHaaradardardardrdarddrdddardardardardaardrdrdrdadarrrddrddsss MMMMMMMMMMMMMMMMMMMMMMMMsMMMsMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMssMs MMMMMMMMMMMMsMMMsMsMMMMMsMMMMMMssMMMMMMMMMMMsssMMMMMMsssMMMMMMMMMMssss MMMMMMMMsssMMMMMMMssMMMMsMMMMMMMMssssssMss s s Ms MMMMMMsssssMMMMMs MMMMMMMssssss MMMMMMMMs MMMMMMMsss MMMMMMMMMMMMMMMssMMMMMMMMMMMMMMMMsssssMMMMMMMMMMitiitittiitiiiiiitiiititiitiiittttiiiittttiititiiittitititiiiiiiiiiitgatgagatgatgatgatgggggaatgatgggggagggagagggggggggggggaaaaaatgatgatgatgatgggaaaaaaaaaatattggggggggggaaaaaaaaaaatggggaaaaaaatatatattattttgggaaaaaatatataattttaaaatatatatttttgggaaaataaataatattttgaagaggaaaaaattttgaaaaaattatatattataatattaaaattaaaagaagiiiiiooooonononoionononnniioononoonononononnoonononnonononononoonionononooonioiononooionionioniooooioooionioioiiooniiiooiiioooonioiiooiionionionnniionn PPPPPPPPlaPlaPPPPPPPPPPPPPPPPPPPPPPPn County of Los Angeles All-Hazards Mitigation Plan Page 148 of 204 x Vector-Ial_NLVmNAmNmŸNT‘:Nmp#V]N9Vlqm‘?V\A  x Foodborne and waterborne illnesses x Chemical and radiological exposure x Climate-lN]ApNLUNA]pUpUlNApmŸNT‘NxplN^NUNAp‘iaalAVlkqA]Vpy‘wV]LœlNm  The County of Los Angeles Department of Public Health (DPH) and the Emergency "NLVJA]1NlvVJNmTN_JyŸ"1 Ja]]AIalApNpa^a_VpalpUlNApm‘ilNvN_paqpIlNA\m‘A_L mitigate impacts when emergencies arise. 6.14.2 Location and Extent Los Angeles County‘Ua^NpaavNl9.7 ^V]]Va_lNmVLN_pm‘VmpUN^ampiaiq]aqmJaq_py in the United States. Its diverse geography ŸVN‘qlIA_‘JaAmpA]‘^aq_pAV_aqm‘A_LlqlA]) and demography lead to a range of public health vulnerabilities. -qI]VJUNA]pUN^NlTN_JVNmJA_alVTV_ApNSla^]aJA]‘lNTVa_A]‘_ApVa_A]‘ al T]aIA] maqlJNm‘V^iAJpV_TmiNJVœJ_NVTUIalUaaLmalpUNN_pVlNJaq_py3UNNxpN_paSiqI]VJ health threats varies based on: x 3UN_ApqlNaSpUNpUlNAp‘mqJUAmplA_m^VmmVa_Ly_A^VJmalAvAV]AIV]VpyaS^NLVJA] countermeasures. x Population density (higher risks in urban centers for communicable diseases) x Access to healthcare infrastructure x _vVla_^N_pA]Ja_LVpVa_mŸAVlia]]qpVa_‘NxplN^NUNApNvN_pm  6.14.3 History Public health emergencies in Los Angeles County have included: x 2022 Monkeypox Outbreak o iilaxV^ApN]y‚‘…€€JAmNmwNlNlNialpNLV_!am_TN]Nmaq_py x COVID-19 Pandemic (2020–Present) o %vNl ƒ ^V]]Va_ JAmNm‘ „…€‘€€€ UamiVpA]V|ApVa_m‘ A_L „…‘€€€ LNApUm reported in the county alone. x 2018 Hepatitis A Outbreak o -lV^AlV]y ASSNJpV_T q_UaqmNL iaiq]ApVa_m‘ lNkqVlV_T ^Amm vAJJV_ApVa_ efforts. x 2016-2017 West Nile Virus Outbreaks o Multiple cases of mosquito-borne infections leading to severe illness and fatalities. County of Los Angeles All-Hazards Mitigation Plan Page 149 of 204 x 2015-2016 Zika Virus Outbreak o No cases of local mosquito-Ial_NplA_m^VmmVa_‘IqppUNlNwNlN‚‚JAmNm lNialpNLV_pUNaq_py‘wVpU‚INV_TplAvN]-related. x 2015 Meningococcal Disease Cluster o An outbreak among men who have sex with men (MSM) led to a targeted vaccination campaign. x ‚€€‰#_ŔqN_|A-A_LN^VJ o 3UaqmA_LmaSUamiVpA]V|ApVa_m“mJUaa]mA_LIqmV_NmmNmASSNJpNL 6.14.4 Probability and Emerging Risks 3UN‚€‚„3UlNApA_LA|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_pŸ30 VLN_pVœNm that pandemics and bioterrorism remain high-probability threats. Future public health risks also include: x Emergence of infectious diseases driven by global travel and climate change. x Increased incidence of heat-related illnesses amid rising temperatures. x Increased prevalence of respiratory diseases due to declining air quality. x Rise of antimicrobial-resistant infections due to overuse of antibiotics. The County of Los Angeles DPH continually assesses health threats and updates preparedness plans to address evolving concerns. 6.14.5 Vulnerability and Systemic Impacts Certain populations in Los Angeles County may be disproportionately affected by public health emergencies: x At-lVm\iaiq]ApVa_m^AyINLVSSNlN_pSalLVSSNlN_pUA|AlLmINSalN‘LqlV_T‘A_L after an emergency. It is important to assess each hazard in turn to identify those who may be disproportionately affected to improve preparedness and response efforts. -qI]VJUNA]pUN^NlTN_JVNmmplAV_pUNUNA]pUJAlNmympN^‘LVmlqipNJa_a^VJAJpVvVpy‘A_L create mental health burdens. The 2024 THIRA report noted that: x Healthcare infrastructure overload is a major concern during pandemics. x Potential economic loss from business closures during a prolonged public health crisis could exceed billions of dollars. County of Los Angeles All-Hazards Mitigation Plan Page 150 of 204 6.14.6 Mitigation Strategies and Preparedness Efforts Los Angeles County employs several mitigation and preparedness strategies: x Mass Vaccination Campaigns o __qA] Ŕq mUapm‘ %9-‰ vAJJV_ApVa_m‘ A_L aqpIlNA\-miNJVœJ immunization efforts. x Points-of-Dispensing (POD) sites o Disease Surveillance & Early Warning Systems x Syndromic surveillance for emerging threats. o Targeted sampling surveillance. x Healthcare Infrastructure Strengthening o Expanding hospital capacity Sal^NLVJA]mqlTN‘ and emergency medical resources. x Community Outreach & Public Health Education o Disseminating critical information in multiple languages. x Emergency Stockpiles (Strategic National Stockpile(SNS)) o Ni]ay^N_paSA_pVIVapVJm‘A_pVvVlA]m‘A_LiNlma_A]ilapNJpVvNNkqVi^N_p (PPE) in crisis situations. x Coordination with Federal & State Agencies o Collaboration wVpU"‘‘A_LpUNA]VSal_VANiAlp^N_paS-qI]VJ Health to enhance response capabilities. x Anthrax Threat Simulations o The County of Los Angeles Metro system assessed as a high-risk area for bioterrorism response. 6.14.7 Summary -qI]VJ UNA]pU N^NlTN_JVNm iamN mVT_VœJA_p JUA]]N_TNm paLos Angeles County‘ V^iAJpV_TUNA]pUJAlNmympN^m‘vq]_NlAI]Niaiq]ApVa_m‘A_LNJa_a^VJmpAIV]Vpy:UV]N the COVID-‰iA_LN^VJilavVLNLA^A[almplNmmpNmpSallNmia_mNNSSalpm‘a_TaV_T ilNiAlNL_Nmm‘mqlvNV]]A_JN‘A_L^VpVTApVa_mplApNTVNmAV^pailapNJplNmVLN_pmSla^ future threats. Ny3A\NAwAym’ x Los Angeles County SAJNm LVvNlmN UNA]pU pUlNApm‘ V_J]qLV_T iA_LN^VJm‘ IVapNllalVm^‘A_LJ]V^ApN-related illnesses. County of Los Angeles All-Hazards Mitigation Plan Page 151 of 204 x Vulnerable populations may suffer disproportionate impacts during public health crises. x -lNiAlNL_NmmNSSalpmSaJqma_mqlvNV]]A_JN‘vAJJV_ApVa_‘N^NlTN_JylNmia_mN‘ and coordination with federal and state partners. x qpqlNpUlNApmV_J]qLNN^NlTV_TV_SNJpVaqmLVmNAmNm‘UNAp-lN]ApNLV]]_NmmNm‘A_L antimicrobial resistance. yJa_pV_qV_TV_vNmp^N_pmV_iqI]VJUNA]pUilNiAlNL_Nmm‘Los Angeles County aims to reduce risks and strengthen resilience against future health emergencies. County of Los Angeles All-Hazards Mitigation Plan Page 152 of 204 7 Mitigation Strategy County of Los Angeles All-Hazards Mitigation Plan Page 153 of 204 7.1 Mitigation Strategy Overview The Mitigation Strategy section of the All-Hazard Mitigation Plan (AHMP) presents Los Angeles County’s strategic blueprint for reducing risks and vulnerabilities posed over pUN]a_TpNl^AmmaJVApNLwVpUpUNUA|AlLmVLN_pVœNLV_pUNA|AlLLN_pVœJApVa_And 0Vm\ mmNmm^N_p mNJpVa_ 3UN mplApNTVNm VLN_pVœNL V_ pUVm mNJpVa_ LlVvN ^VpVTApVa_ activities based on existing capabilities while also identifying areas of potential future V_vNmp^N_p pa IqV]L lNmV]VN_JN AJlamm Ja^^q_VpVNm‘ JlVpVJA] SAJV]VpVNm‘ A_L apher infrastructure within Los Angeles County. 7.2 Mitigation Goals and Objectives Mitigation goals are the long-term vision that the County hopes to achieve by V^i]N^N_pV_TpUNvAlVaqm^VpVTApVa_mplApNTVNmLNmJlVINLV_pUVm"-‘AmwN]]AmpUN broad guidelines that have shaped mitigation strategy development. x aA] ’Protect life, property, infrastructure, the environment, and the economy pUlaqTUNkqVpAI]N^VpVTApVa_mplApNTVNmAV^NLAplNLqJV_TlVm\m of natural and human-caused hazards. o Objective 1-’_pNTlApNvq]_NlAI]Niaiq]ApVa_m‘V_J]qLV_TiNai]NwVpU JJNmm A_L q_JpVa_A] #NNLm Ÿ# ‘ V_pa pUN V^i]N^N_pApVa_ aS A_y potential mitigation actions. o Objective 1-2: Implement mitigation strategies that enhance resilience to LVmAmpNlV^iAJpmAJlammlNmVLN_pVA]AlNAm‘Ja^^NlJVA]AlNAm‘V_SlAmplqJpqlN‘ high-UA|AlLiapN_pVA]LA^m‘A_LapUNlJlVpVJA]SAJV]VpVNm o Objective 1-ƒ’ _Sal^ mplApNTVJ V_vNmp^N_pm V_ J]V^ApN ALAipApVa_‘ LNvN]ai^N_p‘ A_L lNLNvN]ai^N_p pUAp AlN JN_pNlNL V_ NkqVpy A_L resilience. x aA]‚’_UA_JNJa^^q_Vpy-wide partnerships in hazard mitigation across all levels of government, the private sector, and the public. o Objective 2-1: Build a culture of disaster resilience and awareness of local UA|AlLmpUlaqTUiqI]VJN_TATN^N_p‘NLqJApVa_‘A_LaqplNAJU o Objective 2-2: Strengthen direct coordination among Los Angeles County Operational Area partners to unify efforts for mitigation activities. o Objective 2-3: Utilize a whole community approach to address disparities V_aqpJa^NmiamNLIypUNUA|AlLmVLN_pVœNLV_pUVm"- x aA] ƒ’Enhance planning, response, and recovery through hazard VLN_pVœJApVa_‘AmmNmm^N_p‘^VpVTApVa_‘A_LlNmV]VN_JNAJpVvVpVNm County of Los Angeles All-Hazards Mitigation Plan Page 154 of 204 o Objective 3-1: Establish and maintain coordination between hazard mitigation activities and other emergency management functions. o Objective 3-2: Integrate hazard mitigation activities into preparedness for future large-scale planned events within Los Angeles County. x aA]„’_mqlNN]VTVIV]VpySal"TlA_pSq_LV_Tpa^AxV^V|NNkqVpAI]N investment in hazard mitigation actions. o Objective 4-1: Continue to meet all requirements for existing hazard mitigation grant programs used by the County. o Objective 4-2: Expand the County’s ability to participate in grant programs not currently utilized by the County. 7.2.1 Changes in Mitigation Goals The AHMP Advisory Committee reviewed the 2020 AHMP goals and updated them to lNŔNJppUN^ampJqllN_pCaq_pyJa_JNl_mA_LilValVpVNm3UNlNSalN‘pUN‚€‚…"-has introduced new goals and objectives to build a more resilient community. Table 7-1 ŸIN]aw Ja^iAlNmpUN‚€‚…"-TaA]mwVpUilNvVaqm‚€‚€"-TaA]m“A]]apUNl goals above are new goals and objectives developed by the AHMP Advisory Committee. Mitigation priorities change through time depending on the type of disaster impacting !am_TN]Nmaq_py‘vq]_NlAIV]Vpy‘pUNmplApNTVNmV^i]N^N_pNL‘AmwN]]AmapUNl_NNLm of the community. Priorities are also made based on current countywide Threat and Ha|AlLLN_pVœJApVa_A_L0Vm\mmNmm^N_pŸ30 mpqLVNm‘#ApVa_A] 0Vm\ _LNx mmNmm^N_p‘1pApNA|AlL"VpVTApVa_-]A_Ÿ1"- A_L other local plans and guides. The previous 2020 AHMP integrated hazard data into several operational plans including but not li^VpNLpapUNN_NlA]-]A_‘%iNlApVa_A]lNA^NlTN_Jy%iNlApVa_m-]A_ Ÿ%%- ‘amongst others. Addressing these changes will help to address Los Angeles County hazard priorities and to have mitigation strategies focused on the hazards that impact the region at most. The plan also added additional hazards and addressed a larger vulnerable population. Table 7-"VpVTApVa_aA]4iLApNm aA]mLLlNmmNLV_ 2020 AHMP aA]mSal‚€‚…-2030 Planning Period Changes Build a culture and practice disaster resilience Goal 2 (see above). aA]NxiA_LNL“ previous goal integrated as an County of Los Angeles All-Hazards Mitigation Plan Page 155 of 204 aA]mLLlNmmNLV_ 2020 AHMP aA]mSal‚€‚…-2030 Planning Period Changes objective under Goal 2 in the current AHMP. NppNli]A_Sal‘lNmia_L pa‘A_LlNJavNlSla^‘ hazards and disasters V_J]qLV_TJ]V^ApNJUA_TN‘ LlaqTUp‘NAlpUkqA\N‘ LA^SAV]qlN‘ŔaaL‘ ]A_Lm]VLN‘pmq_A^V‘A_L wV]LœlNpUApASSNJp!am Angeles County. Goal 3 (see above). Previous goal replaced with new goal. More successfully adapt to hazards and disasters V_J]qLV_TJ]V^ApNJUA_TN‘ LlaqTUp‘NAlpUkqA\N‘ LA^SAV]qlN‘ŔaaL‘ ]A_Lm]VLN‘pmq_A^V‘A_L wV]LœlNpUApASSNJp!am Angeles County. Goal 1 (see above). Previous goal replaced with new goal. 7.3 Existing Mitigation Capabilities The mitigation strategies developed as part of this AHMP seek to maximize existing ^VpVTApVa_JAiAIV]VpVNmVLN_pVœNLAmJqllN_p]yAvAV]AI]NwVpUV_pUN!am_TN]Nmaq_py %iNlApVa_A]lNA3UNmNNxVmpV_TJAiAIV]VpVNmUAvNINN_qiLApNLpalNŔNJpJUA_TNmV_ humA_‘pNJU_VJA]‘œ_A_JVA]‘]NTA]‘lNTq]Apaly‘NLqJApVa_‘A_LaqplNAJUlNmaqlJNmmV_JN the 2020 AHMP. County of Los Angeles All-Hazards Mitigation Plan Page 156 of 204 7.3.1 qpUalVpVNm‘-a]VJVNm‘A_L!NTA]0NTq]Apaly0NmaqlJNm There are several NxVmpV_TAqpUalVpVNm‘ia]VJVNm‘A_LapUNl]NTA]allNTq]ApalylNmaqlJNm applicable to hazard mitigation efforts in Los Angeles County. From the County Code aS%lLV_A_JNmpaJa^i]NpNLi]A_m‘pUNmNSal^pUNJal_Nlmpa_NaSUA|AlL^VpVTApVa_ activities by provVLV_T A Saq_LApVa_ laapNL V_ LApA‘ lNmNAlJU‘ i]A__V_T‘ 3NJU_VJA] Ecological Knowledge (TEK) provided by our state and locally recognized indigenous Ja^^q_VpVNm‘A_LN]NJpNLaSœJVA]m¯AqpUalVpyThe County aims to expand and improve upon pUNmNVLN_pVœNLJAiAIV]VpVNmIyALaipV_TpUVm"-‘a_JNAiilavNL‘V_papUN Safety Element of the Los Angeles County General Plan. This action will contribute to the County’s ability to be considered for an additional cost-share on Public Assistance projects through the California Disaster Assistance Act. Table 7-2 provides an overview aSNxVmpV_TJAiAIV]VpVNmlN]ApNLpaAqpUalVpVNm‘ia]VJVNm‘A_L]NTA]lNTq]ApalylNmaqlJNm Table 7-2 qpUalVpVNm‘-a]VJVNm‘A_L!NTA]0NTq]Apaly0NmaqlJNm Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development Los Angeles County Operational Area Emergency Operations Plan (2023) Establishes the coordinated emergency management system within the Los Angeles County %iNlApVa_A]lNApailNiAlNSal‘ lNmia_Lpa‘A_LlNJavNlSla^pUN effects of large-scale emergencies lNTAlL]NmmaSJAqmN‘]aJApVa_‘al complexity. All-Hazard No Los Angeles County General Plan (2024) Provides the policy framework for how and where the unincorporated County will grow through the year 2035. All-Hazard Yes Los Angeles County Comprehensive Floodplain 0NvVNwmNxVmpV_TŔaaLi]AV_ management programs in the County and recommends enhancements to them through 35 Flood Land Movement Yes County of Los Angeles All-Hazards Mitigation Plan Page 157 of 204 Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development Management Plan (2021) mitigation actions. This plan is currently being reviewed and updated with completion targeted for early 2026. Los Angeles County Comprehensive Floodplain Management Plan Repetitive Loss Area Analysis (2021) Analyzes Repetitive Los Areas within Los Angeles County and Sq]œ]]ma^^q_Vpy0ApV_T1ympN^ requirements. Flood Land Movement Yes County of Los Angeles Floodplain Management Plan Progress Report (2024) Provides an annual update on the implementation of the action plan VLN_pVœNLV_pUNa^ilNUN_mVvN Floodplain Management Plan and on the implementation and evaluation of outreach projects. Flood Land Movement Yes County of Los Angeles Repetitive Loss Area Analysis Progress Report (2023) Provide an annual update on the implementation of the action plan VLN_pVœNLV_pUNRepetitive Loss Area Analysis to ensure there is a continuing and responsive planning process. Flood Yes Los Angeles County Fire Plan (2023) NmJlVINmpUNwV]LœlN N_vVla_^N_p‘UVmpaly‘A_LilN-œlN management strategies to N_UA_JNpUNilapNJpVa_aS]VvNm‘ ilaiNlpy‘A_L_ApqlA]lNmaqlJNm Sla^wV]L]A_LœlN :V]LœlN Yes County of Los Angeles All-Hazards Mitigation Plan Page 158 of 204 Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development Los Angeles County 2045 Climate Action Plan (2024) Delineates the County’s path toward meeting the goals of the Paris Agreement and achieving carbon neutrality for unincorporated Los Angeles County. :V]LœlN Extreme Heat Drought Flooding Yes Our County: Los Angeles Countywide Sustainability Plan (2019) Outlines how local governments and stakeholders can enhance the well-being of all County communities while adapting to climate change and reducing damage to the natural N_vVla_^N_p‘iAlpVJq]Al]ySaJqmV_T on communities disproportionately burdened by pollution. :V]LœlN Extreme Heat Drought Flooding Yes Los Angeles County Floodplain Management Ordinance Aims to minimize public and ilVvApN]ammNmlNmq]pV_TSla^ŔaaL conditions via uniformly applied lNTq]ApVa_mV_ŔaaLila_N‘ ^qLŔaw‘alŔaaLlN]ApNLNlamVa_ areas. Flood Land Movement Yes Los Angeles County Code – Title 32: Fire Code To build a new structure (or an addition equal to or greater than …€ÈaSNxVmpV_TmkqAlNSaapATN ‘ the Los Angeles County Fire Code lNkqVlNmlNvVNwaSVpm]aJApVa_‘pyiN aSJa_mplqJpVa_‘paiaTlAiUy‘m]aiN‘ amount and arrangement of vNTNpApVa_‘A_LavNlA]]site :V]LœlN Yes County of Los Angeles All-Hazards Mitigation Plan Page 159 of 204 Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development settings—in order to create defensible space necessary for NSSNJpVvNœlNilapNJpVa_aSUa^Nm in High Fire Severity Zones. Los Angeles County Code – Title 22: Planning and Zoning Establishes the regulations governing land use and LNvN]ai^N_pA_LLNœ_Nm|a_V_T for unincorporated Los Angeles County. Includes the Hillside Management Area Ordinance ŸUAipNl‚‚€„ ‘pUN0NmVLN_pVA] NmVT_1pA_LAlLm%lLV_A_JN‘A_L the Hillside Design Guidelines. These include requirements for development in Hillside "A_ATN^N_plNAm‘wUVJUAlN LNœ_NLAmAlNAmwVpU‚…Èal greater natural slopes. The TqVLN]V_NmV_J]qLNmiNJVœJA_L measurable design techniques that JA_INAii]VNLpalNmVLN_pVA]‘ commerciA]‘V_LqmplVA]‘A_LapUNl types of projects. :V]LœlN Earthquake Land Movement Yes Los Angeles County Code – Title 31: Green Building Standards Code Enhances the design and construction of buildings via building concepts with positive (or reduced negative) environmental V^iAJpm‘A_LN_JaqlATNm sustainable construction practices Extreme Heat Drought Yes County of Los Angeles All-Hazards Mitigation Plan Page 160 of 204 Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development AJlammi]A__V_TA_LLNmVT_‘ N_NlTyNSœJVN_Jy‘wApNl Ja_mNlvApVa_‘^ApNlVA]A_L lNmaqlJNNSœJVN_Jy‘A_L environmental air quality. Los Angeles County Brush Clearance Program Legally declares both improved and unimproved properties a iqI]VJ_qVmA_JN‘A_LwUNlN _NJNmmAly‘lNkqVlNmpUNJ]NAlA_JN of hazardous vegetation thereby creating defensible space for NSSNJpVvNœlNilapNJpVa_aS ilaiNlpy‘]VSN‘A_LpUNN_vVla_^N_p The Brush Clearance Program is a joint effort between the County of Los Angeles Fire Department and the County of Los Angeles Department of Agricultural Commissioner/Weights and Measurem‘:NNLA|AlL‘A_L-Nmp Abatement Bureau (Weed Abatement Division). :V]LœlN Yes Los Angeles County Code – Title 26: Building Code Provides minimum standards to regulate pUNLNmVT_‘Ja_mplqJpVa_‘ V_mpA]]ApVa_‘kqA]VpyaS^ApNlVA]m‘ qmN‘aJJqiA_Jy‘]aJApVa_‘A_L ^AV_pN_A_JNaSA]]IqV]LV_Tm‘ mplqJpqlNm‘TlALV_T‘A_LJNlpAV_ equipment. Regulates construction Earthquake :V]LœlN Yes County of Los Angeles All-Hazards Mitigation Plan Page 161 of 204 Authority, Policy, or 0NmaqlJN Description Hazards Addressed Potential to Affect Development near a known active earthquake SAq]pŸUAipNl‘1NJpVa_ƒ ‘pUN materials and construction methods for construction in a Wildland-Urban Interface (WUI) VlNlNAŸUAipNl‡ ‘mplqJpqlA] design as it relates to earthquake UA|AlLmŸUAipNl†‘1NJpVa_ 16ƒ ‘lNiAVlaSJNlpAV_IqV]LV_TmV_ High Earthquake Damage Areas ŸUAipNl‰„ ‘NAlpUkqA\NUA|AlL reduction for concrete tilt-up buildings (Chapter 95) and unreinforced masonry buildings ŸUAipNl‰† ‘A^a_TapUNlm3UN Building Code also includes provisions for emergency housing during a proclaimed emergency. 7.3.2 Human and Technical Resources Existing human and technical resources across County Departments enable the aq_pypai]A_‘^A_ATN‘Ja_LqJp‘A_LNxNJqpNVpmwVLNlA_TNaSUA|AlL^VpVTApVa_ activities. The resources below represent a high degree of expertise in all facets of hazard mitigation available to support mitigation activities. The County aims to NxiA_LA_LV^ilavNqia_pUNmNVLN_pVœNLJAiAIV]VpVNmIyNxiA_LV_Tpotential hazard training opportunities available to the Los Angeles County Operational Area. LLVpVa_A]]y‘AmvAlVaqmmpecial events are scheduled in Los Angeles County over the _NxpœvNyNAlm‘pUNaq_pyshould seek to expand coordination and technical resources lN]ApNLpa^AmmvVa]N_JN‘JyINl‘A_LapUNlmiNJVA]NvN_p-related hazards. County of Los Angeles All-Hazards Mitigation Plan Page 162 of 204 Table 7-3 provides an overview of existing capabilities related to human and technical resources. Table 7-3 q^A_A_L3NJU_VJA]0NmaqlJNm 0NmaqlJN Department/Agency -lV_JViA]JpVvVpVNm0N]ApNLpaA|AlL Mitigation Emergency Management Coordinator(s) Los Angeles County %SœJNaS^NlTN_Jy Management x Maintains and updates the Los Angeles County Operational Area Emergency Operations Plan and Los Angeles County All-Hazard Mitigation Plan. x Coordinates local response and recovery activities in the Emergency Operation Center A_LV_pUNœN]L x Wal\mJ]amN]ywVpU]aJA]‘ mpApN‘A_L federal partners to support planning‘ training‘NxNlJVmN‘iqI]VJV_Sal^ApVa_‘ and resource coordination. _TV_NNlŸm ‘ Building _miNJpalŸm ‘ Code Enforcement %SœJNlŸm ‘VlN "AlmUA]]m‘A_L Other Technical Staff Los Angeles County Public Works and Fire Department x %vNlmNNmpUNNSSNJpVvN‘NSœJVN_p‘SAVl‘ and safe enforcement of County of Los Angeles Building and Fire Codes. _TV_NNlŸm ‘ Construction Project "A_ATNlm‘A_L Other Technical Staff Los Angeles County Public Works x Provides direct (or contract) JVvV]‘ mplqJpqlA]‘A_L^NJUA_VJA] N_TV_NNlV_TmNlvVJNm‘ including Ja_plAJp‘ila[NJp‘A_LJa_mplqJpVa_ management. _TV_NNlŸm ‘ Project Los Angeles County Public Works x Maintains and operates a wide range of local equipment and facilities and assists members of the public by County of Los Angeles All-Hazards Mitigation Plan Page 163 of 204 0NmaqlJN Department/Agency -lV_JViA]JpVvVpVNm0N]ApNLpaA|AlL Mitigation "A_ATNlŸm ‘ Equipment OiNlApalm‘ Maintenance and Construction Staff‘A_L%pUNl Technical Staff ilavVLV_TmqSœJVN_pJ]NA_SlNmUwApNl‘ reliable mNwNlmNlvVJNm‘mplNNp ^AV_pN_A_JN‘mpal^LlAV_ATN mympN^m‘mplNNpJ]NA_V_T‘mplNNp]VTUpm‘ A_LplASœJmVT_A]m Floodplain Administrator Los Angeles County Public Works x _SalJNmpUNŔaaLi]AV_^A_ATN^N_p ordinance ensuring that development proposals do not V_JlNAmNŔaaLlVm\A_LpUAp_Nw developments are not located below the 100-yNAlŔaaL]NvN]_ALLVpVa_‘ pUNŔaaLi]AV_AL^V_VmplApalVm responsible for planning and ^A_ATV_TŔaaLlVm\lNLqJpVa_ projects throughout Los Angeles County. -]A__NlŸm ‘ _TV_NNlŸm ‘A_L Technical Staff Los Angeles County Department of Regional Planning x Develops and maintains the Los _TN]Nmaq_pyN_NlA]-]A_‘ including the Safety Element. x Develops area plans based on the Los Angeles County General Plan to ilavVLN^alNmiNJVœJTqVLA_JNSal pUNLNvN]ai^N_paS^alNmiNJVœJ areas. x 0NvVNwmilaiamNLLNvN]ai^N_p‘ JAiVpA]V^ilavN^N_pm‘A_LapUNl physical projects involving property for consistency and conformity with the Los Angeles County General Plan. x Anticipates and acts on the need for Aii]VJAI]N_Nwi]A_m‘ia]VJVNm‘A_L code changes. County of Los Angeles All-Hazards Mitigation Plan Page 164 of 204 0NmaqlJN Department/Agency -lV_JViA]JpVvVpVNm0N]ApNLpaA|AlL Mitigation x ii]VNmpUNAiilavNLi]A_m‘ia]VJVNm‘ JaLNilavVmVa_m‘A_LapUNl regulations to proposed land uses. Procurement Services Manager Los Angeles County Internal Services Department x Provides a full range of municipal œ_A_JVA]mNlvVJNmand administers several licensing measures. Comptroller Personnel Los Angeles County Auditor – Controller x -lavVLNmœ_A_JVA]and grant services. County Counsel Personnel Los Angeles County Counsel x Provides legal services for the County. Fire Department Personnel Los Angeles County Fire Department x -lavVLNmœlNilapNJpVa_mNlvVJNm V_J]qLV_TlNmia_mN‘œlNilNvN_pVa_‘ and mitigation activities for the County. Sheriff’s Department Personnel Los Angeles County Sheriff’s Department x Provides law enforcement services in the County. 7.3.3 Financial Resources and Programs 3UNlN AlN ^A_y NxVmpV_T œ_A_JVA] lNmaqlJNm‘ TlA_p ilaTlA^m‘ A_LapUNlSq_LV_T mechanisms that enable current and future hazard mitigation activities. Sources for these resources and programs vary widely from local funding out of the County’s General Fund to state and federal programs that aim to help local jurisdictions accomplish their hazard mitigation goals. The amount of funding available is variable and project-miNJVœJSal^A_yaSpUNmNilaTlA^m1V^V]Al]y‘TlA_pAwAlLmAlNIAmNLa_ pUNmiNJVœJila[NJpmpUApAlNVLN_pVœNLAmpUNIAmVmSalpUNTlA_pAii]VJApVa_3AI]N‡-4 ilavVLNm A_ avNlvVNw aS NxVmpV_T JAiAIV]VpVNm lN]ApNL pa œ_A_JVA] lNmaqlJNm A_L programs. County of Los Angeles All-Hazards Mitigation Plan Page 165 of 204 Table 7-4 V_A_JVA]0NmaqlJNmA_L-laTlA^m 0NmaqlJNal Program Administrator Purpose General Fund Chief Executive %SœJN -laTlA^aiNlApVa_mA_LmiNJVœJila[NJpm General Obligation Bonds Auditor - Controller General obligation bonds are appropriately used for the construction and/or acquisition of improvements to real property broadly available to residents and visitors. Such facilities include but are not limited to: ]VIlAlVNm‘ UamiVpA]m‘ iAl\m‘iqI]VJmASNpySAJV]VpVNm‘A_L cultural and educational facilities. Special Tax and Revenue Bonds Controller 0NvN_qNIa_LmAlNqmNLpaœ_A_JNJAiVpA] projects that: 1. HAvNA_VLN_pVœNLIqLTNpAlymplNA^Sal lNiAy^N_pŸNT‘miNJVœNLSNNm‘pAx lNJNVipm “ 2. Generate project revenue but rely on a broader pledge of general fund revenues to lNLqJNIallawV_TJampm“al 3. Finance the acquisition and installation of equipment for the local jurisdiction’s general governmental purposes. Vegetation Management Program Cal FIRE Cost-sharing program between Cal FIRE and private landowners‘ which focuses on the use of ilNmJlVINLœlNA_L/or ^NJUA_VJA]^NA_m‘Sal ALLlNmmV_TwV]L]A_LœlNSqN]UA|AlLmA_LapUNl resource management issues on State Responsibility Area (SRA) lands. :V]LœlN Emergency and Mitigation Funds Cal FIRE Administers funding from FEMA‘ Bureau of Land "A_ATN^N_p‘ and U.S. Forest Service for County of Los Angeles All-Hazards Mitigation Plan Page 166 of 204 0NmaqlJNal Program Administrator Purpose certain types of wV]LœlN emergency and mitigation funding. California Residential Mitigation Program California Earthquake Authority Created by the California Earthquake Authority A_LpUNavNl_al¯m%SœJNaS^NlTN_Jy 1NlvVJNm‘¬Earthquake Brace + Bolt: Funds to Strengthen Your Foundation” is the œlmp incentive program offered by the California Residential Mitigation Program. Public Health Emergency Preparedness Cooperative Agreement Center for Disease Control and Prevention Funds are intended to upgrade state and local public health jurisdictions’ preparedness and response to IVapNllalVm^‘ outbreaks of infectious LVmNAmNm‘ and other public health threats and emergencies. Hazard Mitigation Grant Program (HMGP) FEMA Administered by the California Governor’s %SœJNaS^NlTN_Jy1NlvVJNmŸA]%1 ‘"- supports pre- and post-disaster mitigation plans and projects available to California communities after a presidentially declared disaster has occurred in California. Pre-Disaster Mitigation (PDM) Grant Program FEMA Available annually as a nationally competitive A]%1TlA_p‘pUN-"lA_p-laTlA^ supports pre-disaster mitigation plans and projects. Flood Mitigation Assistance (FMA) Grant Program FEMA Available annually as a nationally competitive A]%1TlA_p‘pUN-"lA_p-laTlA^ supports pre-disaster mitigation plans and projects. Homeland Security FEMA Builds and sustains preparedness technical assistance activities in support of the four County of Los Angeles All-Hazards Mitigation Plan Page 167 of 204 0NmaqlJNal Program Administrator Purpose Preparedness Technical Assistance Program Ua^N]A_LmNJqlVpy^VmmVa_AlNAmŸVN‘ ilNvN_pVa_‘ilapNJpVa_‘lNmia_mN‘lNJavNly A_L homeland security program management. Assistance to VlNœTUpNlm Grant Program FEMA/U.S. Fire Administration -lavVLNmNkqVi^N_p‘ilapNJpVvNTNAl‘ N^NlTN_JyvNUVJ]Nm‘plAV_V_T‘A_LapUNl resources needed to protect the public and emergency personnel from œlN and related UA|AlLmvAV]AI]NpaœlNLNiAlp^N_pmA_L _a_ASœ]VApNLN^NlTN_Jy^NLVJA]mNlvVJNm providers. Land and Water Conservation Funds U.S. Department of the Interior Supports the protection of federal public lands and waters and voluntary conservation on private land. Community Action for a Renewed Environment U.S. Environmental Protection Agency (EPA) Offers means by which communities may organize/take action to reduce toxic pollution ŸNT‘V_mpal^wApNl‘NpJ pUlaqTUœ_A_JVA]A_L technical assistance. Communities create partnerships that implement solutions to reduce releases of toxic pollutants and that minimize toxic exposures. Clean Water State Revolving Fund EPA A loan program that provides low-cost œ_A_JV_T to eligible entities on state and tribal lands for water quality ila[NJpm‘V_J]qLV_TA]] types of non-iaV_pmaqlJN‘wApNlmUNL ilapNJpVa_allNmpalApVa_‘NmpqAly^A_ATN^N_p ila[NJpm‘A_L^alNplALVpVa_A]^q_VJViA] wastewater treatment projects. County of Los Angeles All-Hazards Mitigation Plan Page 168 of 204 0NmaqlJNal Program Administrator Purpose Community Block Grant Program Entitlement Communities Grants U.S. Department of Housing and Urban Development JkqVmVpVa_aSlNA]ilaiNlpy‘lN]aJApVa_A_L LN^a]VpVa_‘lNUAIV]VpApVa_aSlNmVLN_pVA]A_L non-lNmVLN_pVA]mplqJpqlNm‘Ja_mplqJpVa_aS iqI]VJSAJV]VpVNmA_LV^ilavN^N_pmŸNT‘ wApNlmNwNlSAJV]VpVNm‘mplNNpm‘neighborhood JN_pNlm‘NpJ ‘ and the conversion of school buildings for eligible purposes. High Hazard Potential Dams (HHPD) Grant Program FEMA PlavVLNm pNJU_VJA]‘ i]A__V_T‘ LNmVT_‘ A_L construction assistance in the form of grants for the rehabilitation of eligible high hazard potential dams. State and Local Cybersecurity Grant Program FEMA Provides funding to eligible entities to address cybersecurity risks and threats to information mympN^maw_NLalaiNlApNLIy‘ala_INUA]SaS‘ mpApN‘]aJA]‘alplVIA]TavNl_^N_pm. 7.3.4 Education and Outreach Resources Engagement with the communities of Los Angeles County is an important component aS^VpVTApVa_NSSalpm3UNaq_pyaS!am_TN]NmUAm^q]pVi]N^NpUaLm‘Sal^Apm‘A_L venues to conduct outreach with community members and provide education on the hazard landscape in Los Angeles County. These activities ensure mitigation efforts align with community goals and include community input. Table 7-5 shows a list of existing resources for education and outreach. Table 7-5 LqJApVa_A_L%qplNAJU0NmaqlJNm 0NmaqlJNal Program Agencies Potentially Involved Purpose Preparedness Fairs %SœJNaS^NlTN_Jy "A_ATN^N_p‘VlN Engage with community members to provide education County of Los Angeles All-Hazards Mitigation Plan Page 169 of 204 0NmaqlJNal Program Agencies Potentially Involved Purpose NiAlp^N_p‘1UNlVSS¯m NiAlp^N_p‘-qI]VJ:al\m‘ Board of Supervisors on hazards found in Los Angeles County and emergency preparedness for homes and businesses. Personal Disaster Impact Surveys %SœJNaS^NlTN_Jy Management Receive input and feedback on the hazard landscape from community members in Los Angeles County to inform the 2025 AHMP. AHMP Draft Review Surveys %SœJNaS^NlTN_Jy Management Receive input and feedback on sections of the AHMP from community members in Los Angeles County. Homeless Outreach Services Team (HOST) 1UNlVSS¯mNiAlp^N_p‘ Homelessness Services Organizations Conduct outreach to People Experiencing Homelessness in AlNAmila_NpawV]LœlNmal ŔaaLV_TIAmNLa_wNApUNl conditions. Community Emergency Response Teams (CERT) Fire Department Educate community members about disaster preparedness and response in their communities. Explorer Programs VlNNiAlp^N_p‘1UNlVSS¯m Department Educate youth about disaster preparedness and response in their communities. Youth Climate Commission UVNS1qmpAV_AIV]Vpy%SœJN Educate and obtain input from youth on climate change impacts and mitigation efforts. County of Los Angeles All-Hazards Mitigation Plan Page 170 of 204 7.3.5 National Flood Insurance Program Participation The National Flood Insurance Program (NFIP) is administered by FEMA and provides ASSalLAI]N ŔaaL V_mqlA_JN pa iAlpVJViApV_T Ja^^q_VpVNm pUlaqTUA _Npwal\ aS insurance providers. NFIP regulations must be enforced in Special Flood Hazard Areas (SFHAs). Flood insurance is required for structures in SFHAs with federally backed loans ŸNT‘^amp^alpTATNm‘1^A]] qmV_NmmL^V_VmplApVa_Ÿ1  ]aA_m A_L"TlA_pm A]a_TwVpUA_ymplqJpqlNmwVpU1 ]aA_m‘lNTAlL]NmmaSŔaaL|a_N]aaLV_mqlA_JNVm required to IN^AV_pAV_NLSalpUN]VSNaSpUNSNLNlA]]yIAJ\NL]aA_A_LV_iNliNpqVpy‘ lNTAlL]NmmaSJUA_TNV_aw_NlmUVi‘V_pUNJAmNaS"TlA_pm The Los Angeles County Board of Supervisors adopted the County Floodway %lLV_A_JNŸ!am_TN]Nmaq_pyaLN3Vp]N‘UAipNl†€ V_"AlJU‰ˆ€3UVm alLV_A_JNV_J]qLNLpUNœlmpaq_py]aaLwAy"AimA_LiAvNLpUNwAySalpUNaq_py to begin participation in NFIP on behalf of unincorporated residents. The County’s participation means that residents (owners and renters) in the unincorporated Ja^^q_VpVNm wVpUV_ !am_TN]Nm aq_py AlN N]VTVI]N Sal #- ŔaaLV_mqlA_JNA_L NLNlA]ŔaaLLVmAmpNlAmmVmpA_JN3UNœlmp"]aaL_mqlA_JN0ApN"AimŸ0"m  INJA^NNSSNJpVvNa_NJN^INl‚‘‰ˆ€1V_JN‰ˆ€‘pUNaq_pyUAmJa_pV_qNLlaIqmp participation in NFIP. The FEMA FIRMs were digitized in September 2008 and have been revised over the years by numerous Letters of Map Change and by large-scale Physical Map Revisions for the Ballona Creek watershed and several watersheds in the 1A_pA"a_VJA"aq_pAV_mŸ3lVq_SalNN\‘3aiA_TAA_ya_A_LapUNlm V_NJN^INl ‚€ˆ‘ pUN !am _TN]Nm aq_py JaAmp]V_N V_ ilV] ‚€‚‘ A_Lthe Santa Clara River watershed in June 2021. These maps are available to the public on the Los Angeles County Public Works (PW) website at dpw]AJaq_pyTavŔaaL|a_N Los Angeles County also participates in the NFIP’s Community Rating System (CRS) program. The CRS program is a voluntary program for communities that engage in Ja^^q_Vpy ŔaaLi]AV_ ^A_ATN^N_p AJpVvVpVNm‘ wUVJU NxJNNL pUN ^V_V^q^ #- standards. CRS communipVNmIN_NœpSla^ALVmJaq_pa_ŔaaLV_mqlA_JNlApNmA_L V^ilavNLŔaaLi]AV_^A_ATN^N_pilaTlA^m01qmNmAJ]AmmlApV_TmympN^INpwNN_ A_L‰paLNpNl^V_NŔaaLV_mqlA_JNilN^Vq^lNLqJpVa_mSallNmVLN_pmmaSilV]‘ ‚€‚‚‘!am_TN]Nmaq_pyVmA]Amm†01Ja^^q_Vpy“pUNlNSalNUa^Naw_NlmA_L County of Los Angeles All-Hazards Mitigation Plan Page 171 of 204 lN_pNlmwUa]VvNV_A1JA_lNJNVvNqipaA‚€ÈLVmJaq_pa_pUNVlŔaaLV_mqlA_JN policies. 3UN aq_py¯m V^i]N^N_pApVa_ A_L N_SalJN^N_p aS ]aJA] ŔaaLi]AV_^A_ATN^N_p regulations for development in SFHAs are covered in Los Angeles County Building aLNmwVpUpUN^amplNJN_pqiLApNJa^i]NpNLV_‚€‚ƒ3Vp]N‚†‘UAipNl‘V_J]qLNm requirements for dNvN]ai^N_pwVpUV_ŔaaLUA|AlLAlNAm%pUNllN]NvA_palLV_A_JNm V_J]qLNapUNlJUAipNlmV_3Vp]N‚†Ÿ qV]LV_TaLN A]a_TwVpU3Vp]Nm‚‡Ÿ]NJplVJA]aLN ‘ 3Vp]N‚ˆŸ-]q^IV_TaLN ‘3Vp]N‚‰Ÿ"NJUA_VJA]aLN ‘3Vp]Nƒ€Ÿ0NmVLN_pVA]aLN ‘A_L Title 33 (Existing Building Code). Implementation and enforcement are also covered in the Los Angeles County Subdivision Code (Title 21) and Planning and Zoning Code (Title 22). The NFIP for unincorporated communities is administered by the Department of Public Works (L-:  1pal^wApNl _TV_NNlV_T VvVmVa_‘ wUVJU mNlvNm Am pUN aq_py¯mŔaaLi]AV_^A_ATNl‘JaalLV_ApNmwVpU!-:¯m qV]LV_TA_L1ASNpyA_L!A_L Development Divisions and with the Los Angeles County Department of Regional Planning in their enforcement of the aq_py¯mŔaaLi]AV_^A_ATN^N_plNTq]ApVa_m‘A_L iAlpVJViApNmV_"¯ma^^q_VpymmVmpNL9VmVpm‘wUVJUpyiVJA]]yaJJqla_A…-year cycle. LACPW continues to enforce NFIP regulations for building permit applications LNpNl^V_NLIy qV]LV_TA_L1ASNpyaSœJVA]mpaINmqImpA_pVA]V^ilavN^N_pallNiAVlaS substantial damage. Los Angeles County also requires all residential buildings undertaking sqImpA_pVA]V^ilavN^N_ppaUAvNpUNVl]awNmpŔaalN]NvApNLSaapAIavN the 100-yNAlŔaaLN]NvApVa_LLVpVa_A]]y‘!am_TN]Nmaq_pyJa_LqJpNLA0NiNpVpVvN !ammlNA_A]ymVmV_‚€‚€‘wUVJUmNlvNmAmAmiNJVœJi]A_SallNLqJV_TLA^ATNSla^ ŔaaLV_TV_lepetitive loss areas. SpNlA_NvN_p‘-qI]VJ:al\mmpASSAmmNmmpUNq_V_JalialApNLAlNAIqV]LV_TmwVpUV_pUN extent of the event. The assessment will identify the buildings that appear to have damages affecting 50 percent or greater of the building. SmqJUAIqV]LV_TVmV_Ŕood- ila_NAlNAmVLN_pVœNLIy"¯m]aaL_mqlA_JN0ApN"Aim‘aq_py^AimŸ]aaLwAy "AimalmmNmmal¯m"Aim ‘alVLN_pVœNLIy-qI]VJ:al\mpaINV_A0NiNpVpVvN!ammlNA‘ will undergo further evaluation by Public Works staff on whether the building meets "¯mLNœ_VpVa_aSmqImpA_pVA]V^ilavN^N_pmqImpA_pVA]LA^ATNŸ11  A building pUAp ^NNpm "¯m 11 LNœ_VpVa_ wV]] IN lNkqVlNL pa UAvN pUNN_pVlN IqV]LV_T upgraded to meet National Flood Insurance Program (NFIP) standards ( Title 44‘aLN County of Los Angeles All-Hazards Mitigation Plan Page 172 of 204 aSNLNlA]0NTq]ApVa_m‘1NJpVa_†€ƒ . !am_TN]Nmaq_pyaLN3Vp]N‚†‘1NJpVa_€ requires the County to enforce as a minimum the current Federal Flood Plain "A_ATN^N_p0NTq]ApVa_mLNœ_NLV_ Title 44‘aLNaSNLNlA]0NTq]ApVa_m‘1NJpVa_ †€ƒ‘SalIqV]LV_Tm‘mplqJpqlNm‘A_LTlALV_T]aJApNLV_wUa]NalV_iAlpV_ŔaaLUA|AlL areas. (Ord. 2013-€€„ˆÍ‚‘‚€ƒ“%lL‚€€-€€…ƒÍ‚‘‚€€“%lL‰…-€€†…̓ŸiAlp ‘ 1995.) 7.4 LN_pVœJApVa_A_L_A]ymVmaS"VpVTApVa_Strategies -apN_pVA]^VpVTApVa_AJpVa_mwNlNVLN_pVœNLSalNAJUUA|AlLVLN_pVœNLV_1NJpVa_6 in an effort to ensure as comprehensive a mitigation strategy as possible. Multiple mitigation options were then analyzed against the goals and objectives delineated in this section with a focus on new and existing buildings. A combination of new and ongoing ^VpVTApVa_ AJpVa_m AV^NL Ap lNLqJV_T pUN NSSNJpm aS pUN VLN_pVœNL UA|AlLm wNlN compiled into the list of mitigation actions in the following subsection. This list includes AwVLNlA_TNaSiapN_pVA]pyiNmaS^VpVTApVa_AJpVa_m‘V_J]qLV_T’ x Local Plans and Regulations. x Structure and Infrastructure Projects. x Natural Systems Protection. x Education and Awareness Programs. A notable update to the 2025 AHMP was the integration of human-caused threats and corresponding potential mitigation actions. The AHMP Planning Team also reviewed FEMA’s Mitigation Ideas document to incorporate national best practices in the list of potential mitigation actions. County of Los Angeles All-Hazards Mitigation Plan Page 173 of 204 7.4.1 Mitigation Strategies 01 Title: 1qiialpA_LxiA_Laq_pywVLN9NTNpApVa_"A_ATN^N_pA_LVlN Prevention Efforts 1aqlJN’ Los Angeles County Fire Department Type: Natural Systems Protection Description: Conduct passive protection measures such as creating defensible space buffers around residential and non-residential structures through the removal of ŔA^^AI]N vNTNpApVa_‘ ^A_ATV_T A_Lal lNLqJV_T UA|AlLaqm SqN]m‘ JlNApV_T œlNIlNA\m‘ œlN-resistive landmJAiV_T A_L Ja_mplqJpVa_‘ A_L J]NAlV_T LNAL vNTNpApVa_‘ A^a_T apUNlm _TATN V_LVTN_aqm Ja^^q_VpVNmpaV_Sal^vNTNpApVa_^A_ATN^N_pA_LœlN prevention practices aligned with Traditional Ecological Knowledge (TEK). Hazard: :V]LœlN Hazard: Severe Wind/Tornado 02 Title: _UA_JN a^^q_Vpy _TATN^N_p V_ :V]LœlN -lapNJpVa_ A_L Prevention 1aqlJN’ Los Angeles County Department of Regional Planning Type: Education and Awareness Programs Description: _TATNlNmVLN_pmA_LIqmV_NmmNmV_UVTUœlN risk communities to educate them on community-focused ^VpVTApVa_ A_L lVm\ lNLqJpVa_ mplApNTVNm‘ N^NlTN_Jy ilNiAlNL_NmmA_LNvAJqApVa_lNALV_Nmm‘A_Laiialpq_VpVNm paTNpV_va]vNLV_œlNmASNpy-related community initiatives. Engage indigenous communities to inform protection and prevention practices aligned with Traditional Ecological Knowledge (TEK). Hazard: :V]LœlN Hazard: Severe Wind/Tornado County of Los Angeles All-Hazards Mitigation Plan Page 174 of 204 03 Title: Perform Post-Fire Flooding, Debris Flow, and Mud ]aw 0Vm\ Assessments and Mitigation Activities 1aqlJN’ Los Angeles County Department of Public Works Type: Structure and Infrastructure Projects Description: a]]awV_T A wV]LœlN‘ AmmNmm Iql_ mJAl Sal mVT_VœJA_p^qLA_LLNIlVmŔawlVm\mpailaLqJN^qLA_L LNIlVmŔawiUAmN^AimSalœlmplNmia_LV_TATN_JVNmpa prepare for potential evacuations. Recommend mitigation mplApNTVNmpailNvN_p^qLA_LLNIlVmŔawVmpacts. Hazard: :V]LœlN Hazard: Flooding 04 Title: Strengthen Operational Continuity Capabilities for Critical Facilities 1aqlJN’ Los Angeles County NiAlp^N_p-qI]VJNA]pU‘A^a_TapUNlm Type: Structure and Infrastructure Projects Description: Conduct robust continuity planning to ensure the continued performance of essential functions in the event critical facilities are impacted by various hazards. Build capabilities that support operational continuity such as alternate or uninterrupted power mqii]y‘ wal\SalJN development and cross-plAV_V_T‘ N^NlTN_Jy Ja^^q_VJApVa_m‘A_LLApAIAJ\qialSAV]avNlUAlLwAlN Hazard: :V]LœlN Hazard: Extreme Heat Hazard: Severe Wind/Tornado Hazard: Cyber Incidents County of Los Angeles All-Hazards Mitigation Plan Page 175 of 204 05 Title: Incorporate Hazards in Local Planning, Land Use, and Development Codes 1aqlJN’ Los Angeles County Department of Public Works and Regional Planning Type: Local Planning and Regulations Description: NvN]ai‘ ^AV_pAV_‘ A_L ]NvNlATN opportunities to strengthen relevant ordinances that TavNl_ ]A_L qmN‘ IqV]LV_T JaLNm‘ A_L LNvN]ai^N_p V_ high-risk hazard areas. Incorporate mitigation actions in Ja^^q_Vpyi]A__V_TmqJUAma^^q_Vpy:V]LœlN-]A_m‘ Flood MA_ATN^N_p-]A_m‘A_LpUNaq_pyN_NlA]-]A_‘ among many others. Hazard: :V]LœlN Hazard: AlpUkqA\N Hazard: Land Movement Hazard: Severe Wind/Tornado Hazard: Flooding 06 Title: Increase Public Awareness of Climate Change Effects on Local Hazards 1aqlJN’ Los Angeles County UVNS1qmpAV_AIV]Vpy%SœJN Type: Education and Awareness Programs Description: Engage with communities on ways climate change impacts various natural hazards along with mitigation actions and available resources for climate adaptation and resilience. Efforts should focus on how communities can take action or support existing County programs including funding available to the public. Public N_TATN^N_pNSSalpmmUaq]LINAJJNmmVI]N‘N_mqlNiNai]N with Access and Functional Needs are included in aqplNAJU‘ A_L qmN ^ApNlVA]m wVpU ^q]pVi]N ]A_TqATN options. Hazard: :V]LœlN Hazard: Extreme Heat Hazard: Drought Hazard: Land Movement Hazard: Severe Wind/Tornado Hazard: Flooding County of Los Angeles All-Hazards Mitigation Plan Page 176 of 204 07 Title: Expand Stormwater Management, Drainage, and Outlet Planning 1aqlJN’ Los Angeles County Department of Public Works Type: Local Planning and Regulations Description: Continue robust stormwater management programs. Conduct studies to inform measures to improve aqp]NpA_LLlAV_ATNi]A__V_TA_LilNvN_pŔaaLLA^ATN to communities in high-risk areas. These efforts should also ilNvN_p ŔaaL LA^ATN pa aq_py-maintained roadwAym‘ including evacuation egress and emergency services V_TlNmm‘wUV]NmqiialpV_TiapN_pVA]Tlaq_LwApNllNJUAlTN Hazard: Flooding Hazard: Drought Hazard: Transportation Incident 08 Title: Construct and Maintain Localized Flood Control Improvements 1aqlJN’ Los Angeles County Department of Public Works Type: Structural and Infrastructure Projects Description: "AV_pAV_NxVmpV_TŔaaLJa_pla]^NJUA_Vm^m Iy LlAV_ATN mympN^ ^AV_pN_A_JN‘ mNLV^N_p A_L LNIlVm J]NAlA_JN‘ A_L apUNl AJpVa_m !NvNlATN aiialpq_VpVNm pa Ja_mplqJpŔaaLJa_pla]V^ilavN^N_pm Hazard: Flooding County of Los Angeles All-Hazards Mitigation Plan Page 177 of 204 09 Title: Preserve Floodplains as Public Use Open Spaces 1aqlJN’ Los Angeles County NiAlp^N_paS-qI]VJ:al\m‘A^a_TapUNlm Type: Natural Systems Protections Description: Preserve and expand public use open spaces that capture stormwater with the aim of reducing localized ŔaaLV_TwUV]NA]mailavVLV_TTlNN_miAJNA_L recreational opportunities to communities. Prioritize ŔaaLi]AV_mA_LwApNlmUNLmV_aq_py-owned public use aiN_miAJNm_NAlŔaaLlVm\AlNAm4mNmpal^wApNlINmp management practices in projects involving open spaces to support natural water collection and conservation. _JalialApN ŔaaLi]AV_ ilNmNlvApVa_ V_pa SqpqlN iAl\ improvements. Hazard: Flooding 10 Title: Harden Critical Facilities and Infrastructure from Seismic Damage 1aqlJN’ Los Angeles County Department of Public Works Type: Structure and Infrastructure Projects Description: Conduct seismic assessments to prioritize lNplaœppV_TA_LapUNlmNVm^VJ^VpVTApVa_AJpVa_mmqJUAm bracing or seismic shutoff valves. Efforts should focus on JlVpVJA]SAJV]VpVNmSalJa^^q_Vpy]VSN]V_NmmqJUAmUamiVpA]m‘ iqI]VJmASNpySAJV]VpVNm‘qpV]Vpy mVpNm‘UVTU-hazard potential LA^m‘A_LplA_mialpApVa_AmmNpmŸVN‘IlVLTNm‘laALwAym‘ AVlialpm‘A_LapUNlm  Hazard: AlpUkqA\N Hazard: Land Movement Hazard: Dam Failure County of Los Angeles All-Hazards Mitigation Plan Page 178 of 204 11 Title: Prevent Impacts to the Transportation System 1aqlJN’ Los Angeles County Department of Public Works Type: Structure and Infrastructure Projects Description: Hazard impacts to the transportation system in Los Angeles County have far-reaching potential for cascading effects across multiple lifelines. Mitigation activities for multiple hazards should focus on preventing or lessening impacts to transportation. Activities may include stabilization efforts along County-maintained laALm‘lNV_SalJV_TplA_mialpApVa_AmmNpm‘alapUNlmNVm^VJ mitigation actions. Hazard: AlpUkqA\N Hazard: Land Movement Hazard: Transportation Incident 12 Title: Continue SSalpmpa_UA_JNA^1ASNpyA_L0NLqJN!a_T-Term 9q]_NlAIV]VpVNmwVpUVTUA|AlL-apN_pVA]A^m 1aqlJN’ Los Angeles County Department of Public Works Type: Structure and Infrastructure Projects Description: Upgrade infrastructure to ensure the long- term integrity and safe operation of County-owned dam facilities. Potential actions could include strengthening of LA^m‘ mNLV^N_p ^A_ATN^N_p AJpVvVpVNm‘ lNTq]Al V_miNJpVa_m‘ Ja_pV_qaqm ^AV_pN_A_JN‘ V_pNTlApV_T ALvA_JNLpNJU_a]aTVNm‘A_LN^NlTN_JyilNiAlNL_Nmm efforts. Hazard: AlpUkqA\N Hazard: Dam Failure County of Los Angeles All-Hazards Mitigation Plan Page 179 of 204 13 Title: mmNmm:ApNl0NmV]VN_JNV_!am_TN]Nmaq_py 1aqlJN’ Los Angeles County Department of Public Works Type: Local Planning and Regulations Description: Conduct assessments and studies to monitor the water supply and develop recommendations for other water systems. Identify potential secondary water sources or other contingency measures for ensuring water system resilience during drought conditions. Hazard: Drought 14 Title: Expand Drought-Tolerant Landscaping and Design 1aqlJN’ !am_TN]Nmaq_pyUVNS1qmpAV_AIV]Vpy%SœJNA_LNiAlp^N_paS0NTVa_A] Planning Type: Natural Systems Protection Description: Integrate drought mitigation into landscaping and design measures undertaken by the County. Prioritize native and drought-tolerant plants when selecting ]A_LmJAiV_TLNmVT_m4mNiNl^NAI]N^ApNlVA]mSaliAvNlm‘ LlVvNwAym‘wA]\wAym‘A_LlaALwAympalNLqJNlunoff and promote groundwater recharge that incorporate indigenous- informed practices aligned with Traditional Ecological Knowledge (TEK). Hazard: Drought County of Los Angeles All-Hazards Mitigation Plan Page 180 of 204 15 Title: LLlNmm4lIA_NApm]A_LmIy_vNmpV_TV_lNN__SlAmplqJpqlN and Cooling Strategies 1aqlJN’ !am_TN]Nmaq_pyUVNS1qmpAV_AIV]Vpy%SœJN‘NiAlp^N_paS0NTVa_A] -]A__V_T‘NiAlp^N_paSJa_a^VJ%iialpq_Vpy‘NiAlp^N_paS-qI]VJNA]pU‘A_L NiAlp^N_paS-qI]VJ:al\m‘A^a_TapUNlm Type: Local Planning and Regulations Description: Increase shade cover provided by vegetation such as planting native and drought-tolerant trees along wVpU m^A]]Nl i]A_pm mqJU Am mUlqIm‘ TlAmmNm‘ A_L groundcover. Increase the tree canopy in County parks and open concrete or asphalt spaces in the public right of way or County-owned parking lots. Conduct assessments to identify communities considered urban heat islands that are at highest need for an increase in tree canopy or other heat mitigation activities. Advance cooling strategies such as Ja_mplqJpV_T mUALNmplqJpqlNm‘ V_mpA]]V_T mi]AmU iALm‘ aiNlApV_TJaa]V_TJN_pNlm‘^aLNl_V|V_TAVlJa_LVpVa_V_T mympN^m‘ A_L NxiA_LV_T pUN AvAV]AIV]Vpy aS Jaa] laaœ_T V_SlAmplqJpqlN pUAp lNŔNJpm UNAp AwAy Sla^ IqV]LV_Tm Ensure mitigation actions address heat impacts faced by people with Access and Functional Needs. Many of these AJpVa_mUAvNAmNJa_LAlyIN_Nœp^VpVTApV_TpUNNSSNJpmaS J]V^ApNJUA_TNIyila^apV_TJAlIa_mNkqNmplApVa_‘pUN capture and storage of CO2 from the atmosphere. LLVpVa_A]]y‘V_Jleasing green space and shade cover in urban areas can advance environmental justice. Hazard: Extreme Heat County of Los Angeles All-Hazards Mitigation Plan Page 181 of 204 16 Title: _JlNAmNaAmpA]0NmV]VN_JN‘-lNvN_plamVa_‘A_L-lapNJp1UalN]V_Nm 1aqlJN’ !am_TN]Nmaq_pyUVNS1qmpAV_AIV]Vpy%SœJNA_LDepartment of Beaches and Harbors Type: Natural Systems Protection Description: Conduct activities to replace sediment lost due to erosion or coastal storms. Assess the need for other sediment protection measures such as planting certain types of vegetation. Consider activities that prevent wind from blowing sand off beaches and impacts from storm surge in high-risk areas. These actions help protect coastal roadways and other infrastructure along with ensuring recreation opportunities remain for residents and visitors. Hazard: Flooding Hazard: Tsunami 17 Title: Conduct Multi-Discipline Training and Exercise Programs 1aqlJN’ !am _TN]Nm aq_py 1UNlVSS¯m NiAlp^N_p A_L %SœJN aS ^NlTN_Jy Management Type: Education and Awareness Programs Description: Identify opportunities for joint training and exercises for mass violence and cyber incident response AJlammLVmJVi]V_NmaS]AwN_SalJN^N_p‘œlNA_LN^NlTN_Jy ^NLVJA] mNlvVJNm‘ ^NLVJA] NxA^V_Nl‘ ilVvApN mNJpal‘ A_L others. Each training and exercise should include mass violence rescue and evacuation techniques for AFN populations. Hazard: "Amm9Va]N_JN Hazard: Cyber Incidents County of Los Angeles All-Hazards Mitigation Plan Page 182 of 204 18 Title: Strengthen Partnerships and Coordination Among Local Agencies 1aqlJN’ !am _TN]Nm aq_py 1UNlVSS¯m NiAlp^N_p A_L %SœJN aS ^NlTN_Jy Management Type: Education and Awareness Programs Description: Expand collaborative agreements with other agencies to share resources during large-scale emergencies. Strengthen partnerships with local agencies for resource sharing. Enhance response capabilities during major incidents. Hazard: "Amm9Va]N_JN Hazard: Cyber Incidents 19 Title: _JalialApN"Amm9Va]N_JN-lNvN_pVa_A_L"VpVTApVa_SSalpmV_pa Special Event Planning 1aqlJN’ !am _TN]Nm aq_py 1UNlVSS¯m NiAlp^N_p A_L %SœJN aS ^NlTN_Jy Management Type: Education and Awareness Programs Description: Use physical security measures such as Ia]]AlLm‘ wApNl-œ]]NL IAllVJALNm‘ vNUVJ]N IAllVNlm‘ A_L others. Identify mitigation measures for upcoming special NvN_pmmqJUAmpUN:al]Lqi‘1qiNl aw]‘A_L%]y^iVJm Conduct special event training on topics such as crowd ^A_ATN^N_p‘ mialpV_T NvN_p mASNpy‘ A_L mpALVq^ evacuation. Incorporate Family Assistance Center readiness into special event planning. Hazard: "Amm9Va]N_JN County of Los Angeles All-Hazards Mitigation Plan Page 183 of 204 20 Title: xplN^NNAp0Vm\LqJApVa_A_L1ASNpy%qplNAJUSal0NmVLN_pmA_L 9q]_NlAI]N:al\Nlm 1aqlJN’ !am_TN]Nmaq_pyUVNS1qmpAV_AIV]Vpy%SœJN‘NiAlp^N_paSJa_a^VJ %iialpq_Vpy‘NiAlp^N_paS-qI]VJNA]pU‘A_LNiAlp^N_paS-qI]VJ:al\m Type: Education and Awareness Programs Description: Implement outreach and education to workers in low-wage and high hazard industries in LA County that are disproportionately impacted by extreme heat. Partner with organizations providing services to people with Access and Functional Needs on heat response strategies. Expand awareness of cooling centers and other heat respite options for unhoused populations. Increase workforce development opportunities to expand the availability of green infrastructure. Hazard: Extreme Heat 21 Title: _JlNAmNVN]L0Nmia_mNA_LaalLV_ApVa_AiAIV]VpVNm 1aqlJN’ !am _TN]Nm aq_py 1UNlVSS¯m NiAlp^N_p A_L %SœJN aS ^NlTN_Jy Management Type: Education and Awareness Programs Description: _UA_JN œN]L JaalLV_ApVa_ JAiAIV]VpVNm Ap large-scale planned events and no-notice incidents such AmwV]LœlNm‘^AmmvVa]N_JN‘A_LapUNlm-apN_pVA]AJpVa_m could include investments in new redundant Ja^^q_VJApVa_m mympN^m‘ lNmia_mN vNUVJ]Nm‘ A]Nlp A_L wAl_V_T JAiAIV]VpVNm‘ A_L apUNl œN]L aiNlApVa_m equipment. Hazard: :V]LœlN Hazard: "Amm9Va]N_JN County of Los Angeles All-Hazards Mitigation Plan Page 184 of 204 22 Title: Strengthen Public Health Prevention and Preparedness Measures 1aqlJN’ !am_TN]Nm aq_py %SœJN aS ^NlTN_Jy "A_ATN^N_p‘ NiAlp^N_p aS -qI]VJNA]pU‘NiAlp^N_paSNA]pU1NlvVJNm‘A_LVlNNiAlp^N_p Type: Education and Awareness Programs Description: Continue and expand mass vaccination and immunization efforts. Coordinate healthcare surge preparedness and response efforts. Conduct disease mqlvNV]]A_JN‘^a_VpalNAl]ywAl_V_TmympN^m‘A_L coordinate outbreak response. Educate communities and businesses about health implications related to wildœlN recovery and hazardous materials. Liaise with health system partners to understand hospital surge capacity within the County. Maintain and deploy emergency stockpiles. Incorporate potential climate change-related infectious disease implications into public health preparedness planning. Hazard: Public Health Emergencies 7.5 Status of Previous Mitigation Efforts Table 7-6 below shows the status of mitigation strategies described in the 2020 AHMP. NiAlp^N_pmUAvN^ALNmVT_VœJA_pilaTlNmma_ma^NaSpUNmN^VpVTApVa_mplApNTVNm‘ iAlpVA]]yIqp_apSq]]yJa^i]NpV_Tma^NaSpUNmNNSSalpmmmqJU‘NAJUmplApNTySla^pUN 2020 AHMP have been rolled into the mitigation strategies described in this section. Table 7-6 Status of Mitigation Efforts 2020 AHMP Strategy Status 2025 AHMP Strategy Red Flag Warning Public Outreach Not Completed/ Ongoing Enhance Community Engagement V_:V]LœlN-lapNJpVa_A_L Prevention County of Los Angeles All-Hazards Mitigation Plan Page 185 of 204 2020 AHMP Strategy Status 2025 AHMP Strategy Vegetation Management Program Not Completed/ Ongoing Support and Expand Countywide Vegetation Management and Fire Prevention Efforts Fireproof Coating of Critical Facilities Not Completed/ Ongoing Enhance Community Engagement V_:V]LœlN-lapNJpVa_A_L Prevention Auxiliary Power for Critical Facilities Not Completed/ Ongoing Strengthen Operational Continuity Capabilities for Critical Facilities Earthquake-Resistant Ductile Iron Pipes Replacement Not Completed/ Ongoing Harden Critical Facilities and Infrastructure from Seismic Damage Watershed Ecosystem Restoration Not Completed/ Ongoing Preserve Floodplains as Public Use Open Spaces Green Streets / Living Streets Not Completed/ Ongoing Expand Drought-Tolerant Landscaping and Design Coordinated Data Collection and Database Systems Not Completed/ Ongoing Strengthen Partnerships and Resource Coordination Among Local Agencies Brush Clearance Program Not Completed/ Ongoing Support and Expand Countywide Vegetation Management and Fire Prevention Efforts Wildland Urban-Interface Ordinance Not Completed/ Ongoing Incorporate Hazards in Local -]A__V_T‘!A_L4mN‘A_L Development Codes Urban Forest Management Plan Not Completed/ Ongoing Address Urban Heat Islands by Investing in Green Infrastructure and Cooling Strategies County of Los Angeles All-Hazards Mitigation Plan Page 186 of 204 2020 AHMP Strategy Status 2025 AHMP Strategy a^^q_Vpy:V]LœlN-lapNJpVa_ Plans Not Completed/ Ongoing Incorporate Hazards in Local -]A__V_T‘!A_L4mN‘A_L Development Codes Pre-Disaster Professional Support Not Completed/ Ongoing Strengthen Operational Continuity Capabilities for Critical Facilities Fuel Trailer Project Not Completed/ Ongoing Strengthen Operational Continuity Capabilities for Critical Facilities 7.6 Prioritization and Implementation of Mitigation Actions Potential mitigation actions were prioritized using the FEMA National Risk Index (NRI) score and information from the 2024 Los _TN]Nm3UlNApA_LA|AlLLN_pVœJApVa_A_L 0Vm\ mmNmm^N_p Ÿ30 ‘ wUVJU IapU ALLlNmm UA|AlLm Iy SlNkqN_Jy‘ mNvNlVpy‘ A_L impact. Both the NRI and THIRA follow established processes and use a standardized risk assessment methodology. The NRI incorporates multiple variables including physical impacts posed by hazards in addition to social vulnerability data that communicates risks miNJVœJpaAJNlpAV_Ja^^q_Vpy3AI]N7-7 provides an overview of the NRI results for Los Angeles County across 18 hazards. Hazards rated as Relatively !aw‘#apii]VJAI]N‘al#a0ApV_TwNlN_apV_J]qLNLV_pUVm"- Am pUNy AlN q_Ja^^a_V_SlNkqN_JyV_!am_TN]Nmaq_py“A]]apUNlUA|AlLmAlNJovered in this plan. Table 7-7 "#ApVa_A]0Vm\_LNxA|AlLm Hazard #01JalN (out of 100.0) Score Description Covered in Plan? Earthquake 100.0 Very High Yes | Section 6.3 :V]LœlN 99.9 Very High Yes | Section 6.2 Extreme Heat 98.4 Relatively High Yes | Section 6.4 Tornado 97.6 Relatively High Yes | Section 6.10 County of Los Angeles All-Hazards Mitigation Plan Page 187 of 204 Hazard #01JalN (out of 100.0) Score Description Covered in Plan? Landslide 96.3 Relatively High Yes | Section 6.8 Lightning 95.0 Relatively High Yes | Section 6.2/ 6.6 Riverine Flooding 90.8 Relatively Moderate Yes | Section 6.6 Drought 73.8 Relatively Moderate Yes | Section 6.5 Strong Wind 73.5 Relatively Moderate Yes | Section 6.10 Tsunami 63.5 Relatively Moderate Yes | Section 6.10 Winter Weather 48.6 Relatively Low Not Prioritized Hail 48.1 Relatively Low Not Prioritized Coastal Flooding 43.3 Very Low Not Prioritized Avalanche 33.7 Very Low Not Prioritized Cold Wave 0.0 No Rating Not Prioritized Hurricane N/A Not Applicable Not Prioritized Ice Storm N/A Not Applicable Not Prioritized Volcanic Activity N/A Not Applicable Not Prioritized The THIRA is a process that communities undertake to assess risk and set capability targets to focus their preparedness efforts and strengthen response and recovery capabilities. There are three primary focuses of the THIRA: threat and hazard VLN_pVœJApVa_‘V^iAJpmA_A]ymNmpUApV_J]qLNpUNmiNJVœJLN^aTlAiUVJm aS pUN Ja^^q_Vpy‘A_LALNmJlVipVa_aSNxVmpV_TlNmia_mNA_LlNJavNlyJAiAIV]VpVNm3UN‚€‚„ Los Angeles/Long Beach THIRA was reviewed as part of this hazard mitigation planning effort and all threApm A_L UA|AlLm VLN_pVœNL wNlN V_J]qLNL Am iAlp aS pUVm "- LLVpVa_A]]y‘pUN30¯mVLN_pVœJApVa_aSmNvNlA]Uq^A_-caused threats with potential paV^iAJp!am_TN]Nmaq_pyV_ŔqN_JNLpUNLNJVmVa_paV_J]qLNmqJUpUlNApmV_pUVm AHMP. Table 7-8 mUawmAJlammwA]\aSpUNUA|AlLmA_LpUlNApmVLN_pVœNLV_pUN30 and their corresponding sections in this AHMP. County of Los Angeles All-Hazards Mitigation Plan Page 188 of 204 Table 7-8 ‚€‚„30A_L‚€‚…"-lammwA]\ ‚€‚„30 Hazard/Threat Name 2025 AHMP Hazard/Threat Name Covered in Plan? Biological Attack Public Health Emergencies Yes | Section 6.14 Complex Coordinated Terrorist Attack Mass Violence Yes | Section 6.11 Cyber Attack Cyber Incident Yes | Section 6.12 Earthquake Earthquake Yes | Section 6.3 Flood Flooding Yes | Section 6.6 Pandemic – Human Public Health Emergencies Yes | Section 6.14 Radiological Attack Public Health Emergencies Yes | Section 6.14 Transportation Accident Transportation Incident Yes | Section 6.13 :V]LœlN :V]LœlN Yes | Section 6.2 Additional criteria used to prioritize potential mitigation actions also included the following components: x JpVa_mpUApilValVpV|NNkqVpyA_LV_pNTlApNvq]_NlAI]Niaiq]ApVa_m‘V_J]qLV_T people with AFN. x -apN_pVA]IN_NœpmaSpUNAJpVa_pailNvN_pA^A[alUA|AlL x Actions that have social support to build a culture and practice of resilience. x ampaSpUNAJpVa_vNlmqmpUNiapN_pVA]IN_NœppailNvN_pA^A[alUA|AlL x Availability of funding and actions that support grant requirements. x Political support to remedy or prevent a major health or safety hazard. x JpVa_mpUApAlNpNJU_VJA]]y‘]NTA]]y‘N_vVla_^N_pA]]y‘A_LNJa_a^VJA]]ySNAmVI]N x Actions that the County has the administrative capabilities to implement. x Actions that are related to mitigating long-term vulnerabilities to County- owned High Hazard Potential Dams will automatically be given a HIGH priority. 7.6.1 Priority Levels x High-Priority Mitigation Actions: are essential and require immediate AppN_pVa_ pa ALLlNmm JlVpVJA] lVm\m A_L mASNTqAlL ]VSN‘ ilaiNlpy‘ al NmmN_pVA] systems. County of Los Angeles All-Hazards Mitigation Plan Page 189 of 204 x Medium-Priority Mitigation Actions: AlNV^ialpA_pIqp]NmmqlTN_p‘mqiialpV_T overall risk reduction and resilience goals while allowing for planned implementation. x Low-Priority Mitigation Actions: address lower-risk concerns or long-term objectives and can be deferred without immediate impact to safety or core functions. 7.6.2 Changes in Criteria The 2014 Los Angeles County AHMP’s Mitigation Action Matrix was prioritized using pUN 1aJVA]‘ 3NJU_VJA]‘ L^V_VmplApVvN‘ -a]VpVJA]‘ !NTA]‘ _vVla_^N_pA]‘ A_L Ja_a^VJ Ÿ13-! ^NpUaL‘wUVJU"UALlNJa^^N_LNLAmAilValVpV|ApVa_ilaJNLqlNV_pUN early to mid-2000s. The 2020 AHMP replaced the use of STAPLEE with a more streamlined prioritization process that included the following: x 3alN^NLyalilNvN_pA^A[alUNA]pUmASNpyUA|AlL‘A^VpVTApVa_ila[NJp^qmp have political support. x 3aIqV]LAJq]pqlNA_LilAJpVJNaSLVmAmpNllNmV]VN_JN‘A^VpVTApVa_ila[NJp^qmp have social support. x 3a^NNp""TlA_pJlVpNlVA‘A^VpVTApVa_ila[NJp^qmp INpNJU_VJA]]y‘ ]NTA]]y‘N_vVla_^N_pA]]y‘A_LNJa_a^VJA]]y SNAmVI]NA_LpUN[qlVmLVJpVa_^qmp have the administrative capabilities to implement it. This prioritization method used in the 2020 AHMP has been adapted and incorporated into the prioritization criteria described previously in Section 7.6. 7.7 Integration with Other Plans The County of Los Angeles ensures that mitigation is a countywide effort with multiple departments contributing to critical activities that reduce hazard risks. These actions are captured in other discipline-miNJVœJi]A_mV_ALLVpVa_papUN"-‘V_J]qLV_TpUamN listed in Table 7-9. County of Los Angeles All-Hazards Mitigation Plan Page 190 of 204 Table 7-9 AHMP Integration with Other Plans Plan Authored By Hazard(s) Covered in Plan? Comprehensive Floodplain Management Plan Los Angeles County Department of Public Works Flood Yes Repetitive Loss Area Analysis Report Los Angeles County Department of Public Works Flood Yes Climate Action Plan Los Angeles County Department of Regional Planning :V]LœlN Extreme Heat Flooding Drought Yes Sustainability Plan Los Angeles County Chief 1qmpAV_AIV]Vpy%SœJN :V]LœlN Extreme Heat Flooding Drought Yes County Fire Plan Los Angeles County Fire Department :V]LœlN Yes County of Los Angeles All-Hazards Mitigation Plan Page 191 of 204 7.8 Mitigation Action Plan Table 7-10 lNilNmN_pmA"VpVTApVa_JpVa_-]A_palNLqJNlVm\maSpUNUA|AlLmVLN_pVœNLV_pUVm"-#apAI]y‘^A_y County departments include discipline-miNJVœJ^VpVTApVa_AJpVa_mwVpUV_apUNllN]ApNLi]A_m^N_pVa_NLV_pUNAIavN section. Some actions that mitigate risk of natural hazards that are covered elsewhere may not be explicitly listed or may INlNSNllNLpaV_TN_NlA]pNl^mwUV]NmiNJVœJLNpAV]mAlNAvAV]AI]NV_apUNllN]ApNLi]A_m Table 7-10 Mitigation Action Plan Action No. Priority Hazard Action Name Potential Funding Source Expected Time Frame Lead Agencies 01 HIGH :V]LœlN Support and Expand Countywide Vegetation Management and Fire Prevention Efforts HMGP Annual !a‘PW Severe Wind/Tornado 02 HIGH :V]LœlN Enhance Community _TATN^N_pV_:V]LœlN Protection and Prevention HMGP Quarterly !a‘0-‘ %"‘!1 Severe Wind/Tornado 03 HIGH :V]LœlN Perform Post-VlN]aaLV_T‘ NIlVm]aw‘A_L"qL]aw0Vm\ Assessments and Mitigation Activities "-‘" Annual PW‘ !a‘ OEM Flooding 04 HIGH :V]LœlN 41‘11- Annual %"‘PW‘ -‘Extreme Heat County of Los Angeles All-Hazards Mitigation Plan Page 192 of 204 Action No. Priority Hazard Action Name Potential Funding Source Expected Time Frame Lead Agencies Severe Wind/Tornado Strengthen Operational Continuity Capabilities for Critical Facilities !a‘ !1‘1 Cyber Incidents 05 HIGH :V]LœlN Incorporate Hazards in Local -]A__V_T‘!A_L4mN‘A_L Development Codes "-‘" 1-3 Years 0-‘PW AlpUkqA\N Land Movement Severe Wind/Tornado Flooding 06 MEDIUM :V]LœlN Increase Public Awareness of Climate Change Effects on Local Hazards "‘-lai„ Annual 0-‘ 1%‘ CEO Extreme Heat Drought Land Movement 1evere Wind/Tornado Flooding County of Los Angeles All-Hazards Mitigation Plan Page 193 of 204 Action No. Priority Hazard Action Name Potential Funding Source Expected Time Frame Lead Agencies 07 HIGH Flooding Expand Stormwater "A_ATN^N_p‘lAV_ATN‘A_L Outlet Planning FMA 1-5 Years PW Drought Transportation Incident 08 HIGH Flooding Construct and Maintain Localized Flood Control Improvements FMA 1-5 Years PW 09 MEDIUM Flooding Preserve Floodplains as Public Use Open Spaces "‘-lai„ 1-5 Years PW‘0-‘-0 10 HIGH AlpUkqA\N Harden Critical Facilities and Infrastructure from Seismic Damage HMGP 1-5 Years PW‘1 Land Movement Dam Failure 11 MEDIUM AlpUkqA\e Prevent Impacts to the Transportation System HMGP 1-5 Years PW‘LASD Land Movement Transportation Incident County of Los Angeles All-Hazards Mitigation Plan Page 194 of 204 Action No. Priority Hazard Action Name Potential Funding Source Expected Time Frame Lead Agencies 12 HIGH AlpUkqA\N Conduct Seismic Strengthening at County-Owned Dams "‘- 1-5 Years PW Dam Failure 13 MEDIUM Drought Assess Water Resilience in Los Angeles County Prop 4 1-5 Years PW‘0- 14 MEDIUM Drought Expand Drought-Tolerant Landscaping and Design Prop 4 1-5 Years -0‘ 0-‘ PW‘1% 15 HIGH Extreme Heat Address Urban Heat Islands by Investing in Green Infrastructure and Cooling Strategies Prop 4 1-5 Years 1%‘ 0-‘ %‘ -‘ PW‘-0 16 HIGH Flooding _JlNAmNaAmpA]0NmV]VN_JN‘ -lNvN_plamVa_‘A_L-lapNJp Shorelines "‘-lai„ 1-5 Years 1%‘  ‘ PW Tsunami 17 HIGH "Amm9Va]N_JN Conduct Multi-Discipline Training and Exercise Programs 41‘SHSP 1-5 Years !1‘ %"‘ LACoFD Cyber Incidents 18 MEDIUM "Amm9Va]N_JN Strengthen Partnerships and Resource Coordination Among Local Agencies 41‘11- 1-5 Years !1‘ %"‘ LACoFD Cyber Incidents County of Los Angeles All-Hazards Mitigation Plan Page 195 of 204 Action No. Priority Hazard Action Name Potential Funding Source Expected Time Frame Lead Agencies 19 MEDIUM "Amm9Va]N_JN Incorporate Mass Violence Prevention and Mitigation Efforts into Special Event Planning 41‘11- 1-5 Years !1‘ %"‘ LACoFD 20 HIGH Extreme Heat Extreme Heat Risk Education and Safety Outreach for Residents and Vulnerable Workers Prop 4 1-5 Years 1%‘ %‘ -‘PW‘ DAD 21 HIGH Public Health Emergencies Strengthen Robust Public Health Prevention and Preparedness Measures 41‘ 11-‘ --‘-- 1-5 Years -‘ %"‘ 1‘ LACoFD 22 MEDIUM :V]LœlN Increase Field Response and Coordination Capabilities 41‘11- 1-5 Years !1‘ %"‘ LACoFD "Amm9Va]N_JN Agency Key: CEO = Los Angeles County UVNSxNJqpVvN%SœJN 1%À!am_TN]Nmaq_pyUVNS1qmpAV_AIV]Vpy%SœJN DAD=!am_TN]NmNiAlp^N_paSTV_TA_LVmAIV]VpVNm DBH = Los _TN]Nmaq_pyNiAlp^N_paS NAJUNmA_LAlIalm %À!am_TN]Nmaq_pyNiAlp^N_paSJa_a^VJ%iialpq_Vpy 1À!am_TN]Nmaq_pyNiAlp^N_paSNA]pU1NlvVJNm -À!am_TN]Nmaq_pyNiAlp^N_paS-qI]VJNA]pU -0À!am_TN]Nmaq_pyNiAlp^N_paS-Al\mA_L0NJlNApVa_ PW = Los Angeles County Public Works 0-À!am_TN]Nmaq_pyNiAlp^N_paS0NTVa_A]-]A__V_T 1À!am_TN]Nmaq_py_pNl_A]1NlvVJNmNiAlp^N_p !aÀ!am_TN]Nmaq_pyVlNNiAlp^N_p !1À!am_TN]Nmaq_py1UNlVSS¯mNiAlp^N_p OEM = Los Angeles County UVNS xNJqpVvN %SœJN- %SœJN aS ^NlTN_Jy"A_ATN^N_t lA_p-laTlA^ Ny’ FMA = Flood Mitigation Assistance HMGP = Hazard Mitigation Grant Program HPP = Hospital Preparedness Program PHEP = Public Health Emergency Preparedness SHSP = State Homeland Security Program UASI = Urban Area Security Initiative County of Los Angeles All-Hazards Mitigation Plan Page 196 of 204 8 Plan Maintenance County of Los Angeles All-Hazards Mitigation Plan Page 197 of 204 8.1 Community Participation in Plan Maintenance 3UNA|AlL"VpVTApVa_-]A_wV]]INlNvVNwNLlNTq]Al]y‘AJ\_aw]NLTV_TpUNLy_A^VJ nature of hazard landscapes and the evolving understanding of risks. Stakeholders’ N_TATN^N_pwV]]INilValVpV|NLpUlaqTUaqppUNLNvN]ai^N_pA_L^a_VpalV_TilaJNmm‘ fostering transparency and accountability. 3a^AV_pAV_plA_miAlN_JyA_LJa^^q_VpyV_va]vN^N_p‘pUNaq_pyUAmaqp]V_NLmNvNlA] measures for continued public participation: x Public Access to Hazard Mitigation Documents: A copy of the 2025 AHMP will be maintained on the Los Angeles County Hazard Mitigation Program website along with contact information. Los Angeles County OEM will notify the public aSA_yJUA_TNmalqiLApNm‘V_J]qLV_T^VpVTApVa_ila[NJpmVLN_pVœNLV_pUN plan AmpUNyAlNV^i]N^N_pNL‘vVAmaJVA]^NLVA‘A_LplALVpVa_A]]aJA]^NLVAJUA__N]m x Annual Public Engagement Opportunities: Los Angeles County OEM will endeavor to hold multiple in-person public engagement opportunities for hazard mitigation to keep the public informed of progress on hazard mitigation ila[NJpm‘aIpAV_a_TaV_TiqI]VJSNNLIAJ\‘A_LNLqJApNpUNiqI]VJAIaqppUN County’s hazard mitigation efforts. x Online Portal: A Los Angeles County Hazard Mitigation Program website will be established to provide the public with more information on hazard mitigation and project updates. This portal will serve as a mechanism to obtain continuous public feedback as projects are implemented and offers access to mitigation resources. x Standing Advisory Committee: The Hazard Mitigation Advisory Committee will be expanded to a standing status and will meet at least once per year or more often as determined necessary to support hazard mitigation projects. The standing Hazard Mitigation Advisory Committee will be comprised of representatives from diverse community groups to provide ongoing input and oversight of hazard mitigation efforts. The standing Hazard Mitigation Advisory Committee will also serve as an important forum for future updates of the AHMP. These activities ensure that the community remains informed and actively engaged in the plan’s implementation and maintenance. County of Los Angeles All-Hazards Mitigation Plan Page 198 of 204 8.2 Monitoring‘Evaluation‘A_L"AV_pN_A_JN To ensure the continued effectiveness of this All-A|AlL "VpVTApVa_ -]A_ Ÿ"- ‘ effective monitoring and evaluation will be conducted throughout the plan implementation period. Regular assessments will monitor progress and evaluate the achievements of the intended outcomes. Performance metrics will be developed to kqA_pVSypUNV^iAJpaSNAJU^VpVTApVa_AJpVa_‘A]]awV_TSalLApALlVvN_AL[qmp^N_pmA_L lNœ_N^N_pm The plan will be reviewed annually to assess progress on mitigation actions. Annual review will include the following elements: x __qA] 0NvVNw :al\mUNNpm’ vNly yNAl‘ ! aq_py %" wV]] N^AV] NAJU member of the Hazard Mitigation Advisory Committee an Annual Review :al\mUNNppaJa^i]NpNmmUaw_V_iiN_LVx‘pUN__qA]0NvVNw:al\mUNNp lNŔNJpmpUN"!aJA]A|AlL"VpVTApVa_-]A_0NvVNw3aa]A_LV_J]qLNs the Sa]]awV_T mNJpVa_m’ i]A__V_T ilaJNmm‘ UA|AlL ilaœ]N‘ lVm\ AmmNmm^N_p‘ A_L mitigation strategy. Each member of the Hazard Mitigation Advisory Committee will email completed worksheets back to LA County OEM to review. LA County %"wV]]mq^^AlV|NpUNmNœ_LV_TmA_LN^AV]pUN^aqppapUNJa^^VppNN LLVpVa_A]]y‘pUNœ_LV_TmSla^pUNlNvVNwwal\mUNNpmwV]]INilNmN_pNLpapUN full Hazard Mitigation Advisory Committee at its next regular meeting. x "VpVTApVa_-laTlNmm-la[NJp0Nialpm’ Mitigation actions will be monitored and updated using the Mitigation Project Progress Report. During each annual lNvVNw‘NAJULNiAlp^N_palATN_JyJqllN_p]yAL^V_VmpNlV_TA^VpVTApVa_ila[NJp will submit a progress report to LA County OEM. For projects that are being Sq_LNLIyA"^VpVTApVa_TlA_p‘"kqAlpNl]ylNialpm^AyINqmNLAmpUN ilNSNllNL lNialpV_T paa] m mUaw_ V_ iiN_LVx ‘ pUN ilaTlNmmlNialp wV]] LVmJqmmpUNJqllN_pmpApqmaSpUN^VpVTApVa_ila[NJp‘including any changes made pa pUN ila[NJp‘ VLN_pVSy V^i]N^N_pApVa_ ilaI]N^m‘ A_L LNmJlVINAiilailVApN strategies to overcome them. x Post-_JVLN_p"VpVTApVa_0NvVNw’Following a major disaster event impacting !am_TN]Nmaq_py‘Aiamp-disaster review will be initiated by LA County OEM to evaluate the need to update the AHMP based on the circumstances of the LVmAmpNlA_LV_JalialApNA_ymiNJVœJ^VpVTApVa_AJpVa_mlNkqired due to the County of Los Angeles All-Hazards Mitigation Plan Page 199 of 204 V_JVLN_pS!aq_py%"œ_LmpUApA_qiLApNpapUN"-Vm_NNLNL‘pUN Hazard Mitigation Advisory Committee will be convened to begin drafting the update. 8.3 Criteria for Updating the Hazard Mitigation Plan The All-A|AlLm"VpVTApVa_-]A_Ÿ"- VmlNkqVlNLpaINqiLApNLNvNlyœvNyNAlmV_ compliance with the Disaster Mitigation Act of 2000 (DMA 2000) and FEMA guidance (44 CFR § 201.6). The update process is not merely an administrative requirement but a critical mechanism to evaluate the plan’s effectiveness in reducing risk and guiding mitigation strategies. 0NvVNwaS-AmpJpVa_mA_LSSNJpVvN_Nmm The update process begins with a thorough review of the mitigation actions outlined in the previous plan. This includes: x vA]qApV_TpUNV^i]N^N_pApVa_mpApqmaSNAJUAJpVa_ŸJa^i]NpNL‘V_ilaTlNmm‘_ap started). x Assessing the impact and effectiveness of completed actions in reducing hazard risk. x NpNl^V_V_TVSpUNaI[NJpVvNmAlNmpV]]lN]NvA_pallNkqVlN^aLVœJApVa_IAmNLa_ new data or circumstances. 2. Integration of New Data and Changing Conditions x A|AlLilaœ]NmA_LlVm\AmmNmm^N_pmAlNqiLApNLwVpU_NwUA|AlLNvN_pLApA‘ J]V^ApNmJVN_JN‘A_LJUA_TNmV_LNvN]ai^N_pal]A_LqmN x Demographic shifts and infrastructure changes are reviewed to reassess vulnerability. x 3NJU_a]aTVJA]ALvA_JN^N_pmalV^ilavNL^aLN]V_Tpaa]mŸNT‘A|qm‘#ApVa_A] 0Vm\_LNx AlNV_JalialApNLpalNœ_NlVm\A_A]ymVm ƒa^^q_VpyA_L1pA\NUa]LNl_iqp The update process must actively include community participation to maintain plA_miAlN_JyA_LN_mqlNpUNi]A_lNŔNJpm]aJA]ilValVpVNm3UVmV_J]qLNm’ County of Los Angeles All-Hazards Mitigation Plan Page 200 of 204 x Public workshops and surveys. x Targeted outreach to vulnerable populations including those with Access and Functional Needs (AFN). x NNLIAJ\Sla^aq_pyLNiAlp^N_pm‘JVpVNm‘#%m‘A_LlNTVa_A]iAlp_Nlm 4. Performance Evaluation and Metrics To ensure effectiveness‘pUNi]A_^AV_pN_A_JNmplApNTyV_J]qLNm’ x Annual progress reports that monitor implementation progress and identify barriers. x Metrics to evaluate the reduction of risk or exposure over time. x Documentation of lessons learned from real events and exercises to inform changes. …0NvVmVa_aSaA]m‘%I[NJpVvNm‘A_LJpVa_m AmNLa_pUNNvA]qApVa_œ_LV_Tm‘pUNi]A_¯mTaA]mA_L^VpVTApVa_AJpVa_mAlNlNvVmNLpa V^ilavN A]VT_^N_pwVpUJqllN_pJAiAIV]VpVNm‘lVm\]NvN]m‘ A_LSq_LV_Taiialpq_VpVNm Each updated action includes: x Clear responsibilities. x Realistic timelines. x Evaluation metrics to measure future success. 8.4 Plan Update 3UN‚€‚…!"-V_J]qLNmA_qiLApNL^NpUaLa]aTySalSqpqlNlNvVmVa_m‘ N_mqlV_T Ja^i]VA_JNwVpUSNLNlA]A_LmpApNTqVLN]V_NmSq]]i]A_qiLApNwV]]aJJqlNvNlyœvN years. x ‚€ƒ€ "- 4iLApN VJ\aSS’LA County OEM will convene the Hazard "VpVTApVa_LvVmalya^^VppNNSalA^NNpV_TpalNvVNwpUNwal\mUNNpœ_LV_Tm and endeavor to begin the process of updating the AHMP in approximately November 2028. The planning process should begin a minimum of 18 months prior to the plan’s expiration. !aq_py%"‘V_Ja_mq]pApVa_wVpUpUNA|AlL "VpVTApVa_LvVmalya^^VppNN‘wV]]LNvN]aiAwal\i]A_SalpUNqiLApN‘Ja_LqJp County of Los Angeles All-Hazards Mitigation Plan Page 201 of 204 lNmNAlJUA_LlNvVNwlN]NvA_pLaJq^N_pApVa_‘LNpNl^V_NUA|AlLmpaINV_J]qLNL V_pUN‚€ƒ€"-‘A_LINTV_pUNilaJNmmpaLlASpA_qiLApNL"- x Plan Submission and Adoption: %_JNqiLApNL‘pUNi]A_VmmqI^VppNLpaA] %1A_L"SallNvVNw4ia_Ja_LVpVa_A]AiilavA]‘Vp^qmpINALaipNLIy the Los Angeles County Board of Supervisors and participating jurisdictions to maintain eligibility for FEMA Hazard Mitigation Assistance (HMA) grants. 8.5 Integration with Other Plans Los Angeles County is committed to ensuring that hazard mitigation planning is not a mpA_LA]a_NNSSalp‘IqpASq]]yV_pNTlApNLJa^ia_N_paSIlaALNlaq_py i]A__V_T V_VpVApVvNm ymplApNTVJA]]ywNAvV_TpUNTaA]m‘aI[NJpVvNm‘A_LAJpVa_maSpUN]]-Hazards Mitigation Plan (AHMP) into a variety of local and regional plans such as the General -]A_‘ AiVpA] ^ilavN^N_p -]A_m‘ ]V^ApN JpVa_ A_L LAipApVa_-]A_m‘ A_L departmental strategic plans“the County promotes a more cohesive and effective approach to building long-term resilience. This integration is achieved through a_TaV_TJa]]AIalApVa_wVpUaq_pyLNiAlp^N_pm‘JVpVNm‘A_LlNTVa_A]ATN_JVNmpaA]VT_ ]A_L qmN‘ V_SlAmplqJpqlN LNvN]ai^N_p‘ A_L N^NlTN_Jy ilNiAlNL_Nmm NSSalpm wVpU VLN_pVœNLUA|AlLlVm\m^Iedding hazard mitigation principles into existing policies and planning mechanisms ensures that they become an inherent part of decision- ^A\V_TilaJNmmNm‘ila[NJpSq_LV_TilValVpV|ApVa_‘A_L]a_T-term investment strategies ultimately reducing vulnerabilities and enhancing the resilience of communities across Los Angeles County. The Los Angeles County AHMP will be shared across all jurisdictions within the operational area. Those jurisdictions will have the opportunity to incorporate the 2025 AHMP into their established planning process. The Hazard Mitigation Advisory a^^VppNNwV]]AmmNmmpUNi]A_ApAyNAl]yIAmVm‘AJ\_aw]NLTV_TpUNLy_A^VJ_ApqlNaS hazard landscapes and the evolving understanding of risks. The OEM Hazard Mitigation Program will make the AHMP available for all county departments to incorporate into departmental i]A__V_T NSSalpm‘ A_L apUNl lN]NvA_p LaJq^N_pm produced by Los Angeles County departments. County of Los Angeles All-Hazards Mitigation Plan Page 202 of 204 9 Plan Adoption County of Los Angeles All-Hazards Mitigation Plan Page 203 of 204 9.1 Plan Adoption Overview Plan Adoption addressed Element F of the Local Mitigation Plan Regulation Checklist under single jurisdiction plan requirement. The Los Angeles County Board of Supervisors ofœcially adopted the 2025 All Hazard Mitigation Plan (AHMP) through a formal resolution on September 9, 2025. A scanned copy of the resolution is included in Appendix F. The Los Angeles County Ofœce of Emergency Management (OEM) will retain the resolution for its records, while copies will be submitted to both Cal OES and FEMA. This Plan adoption completes the mitigation planning process and department agencies, stakeholders, and community’s commitment to the goals and actions. It also recognizes the current planning process and acknowledges changes from the past œve years and validates the priorities for hazard mitigation actions. It makes the community eligible for certain FEMA assistance that can fund some mitigation actions. After being adopted by the Los Angeles County Board of Supervisors, the 2025 AHMP transitions into the implementation phase. The success of the plan hinges on the integrating its mitigation strategies and actions into the local plans and policies. The mitigation action items collectively establish a robust framework to guide the County’s hazard mitigation strategies over the next œve years. To ensure these strategies are effective, actionable and well aligned with the county’s long term resilience goals, the Planning Advisory Committee has set clear objectives. Their prioritized approach focuses on seamlessly blending mitigation actions with current policies, plans, and emphasizing collaboration and coherence throughout. County of Los Angeles All-Hazards Mitigation Plan Page 204 of 204 Appendices CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX M WATER RATE STRUCTURE City of Arcadia Utility Rates & Service Charges The following tables present the City of Arcadia’s 2026 water and sewer rates. Effective January 1, 2026, the City will transition from bi-monthly billing to monthly billing. Seasonal summer and winter allotments have also been eliminated. Monthly Meter Charge 240 W. HunƟngton Drive | PO Box 60021 | Arcadia, California 91066-6021 (626) 254-2700 Billing | (626) 254-2700 Customer Service Single-Family Residential Water Rates Monthly Service Charge - ($/Month) Meter Size (In Inches) 5/8" 3/4" 1" 1-1/2" 2" 3" 4" 6"8”10" Meter Charge $21.31 $21.31 $26.54 $39.61 $55.30 $91.91 $144.21 $274.96 $431.86 $641.06 The table below shows the monthly water service charge by meter size. Most city have a 5/8-inch to 1-inch The table below shows the water consumption charge, which is the amount each customer pays per hundred cubic (HCF) of water used. One HCF equals 748 Monthly Water Rates Single Family Residential Tier 1: 0-8 Tier 2: 9-26 Tier 3: >26 $2.61 $3.03 $3.53 HCF x Per Dwelling Unit Tier 1 6 Tier 2 6 + Multi-Family Residential Water Rates Water Rates ($/HCF) Tier 1 $2.59 Tier 2 $2.93 Multi-Family monthly water rates and tiers based on the number of dwelling units in each multi-family complex. Example: A multi-family residential complex with 10 dwelling units is allocated 60 HCF per month under Tier 1 (6 HCF × 10 dwelling units). Any usage above 60 HCF will be billed under Tier 2. Commercial, Governmental, Institution, & Irrigation Water Rates Water Rates ($/HCF) Commercial $2.75 Governmental, Institution & Irrigation $3.18 Monthly Private Fireline Charges, ($/Month) Meter Size (In Inches) 5/8" 3/4" 1" 1-1/2" 2" 3" 4" 6" 8” 10" Meter Charge $7.50 $7.50 $7.50 $7.50 $7.50 $16.66 $32.45 $89.13 $186.89 $333.93 Monthly Private Fireline Charges 240 W. HunƟngton Drive | PO Box 60021 | Arcadia, California 91066-6021 (626) 254-2700 Billing | (626) 254-2700 Customer Service Monthly Sewer Charges and Rates Residential Sewer Charges and Rates- ($/Month) Single Family Multi-Family – Per Dwelling Unit Residential Sewer Only $9.05 $9.05 $9.05 Service Fee Metered Water $3.18 per HCF Deposit (Refundable) $1,681.26 Hydrant Permit $46.06 Meter Relocation $79.65 Meter Installation $159.29 Meter Reread $142.41 per month Hydrant Rental $32.45 per month Meter Rental $91.91 per month Eddy Valve Rental $25.00 per month Fire Hydrant Service for Construction, Outside Agencies, & Private Use Service Fees adopted December 2025/ ResoluƟon No. 7663 Commercial, Government, & Institution Sewer Charges and Rates- ($/Month) Commercial, Government, & Institution $9.05 + $0.67* *Variable per HCF Billed Water Usage 240 W. HunƟngton Drive | PO Box 60021 | Arcadia, California 91066-6021 (626) 574-2700 Billing | (626) 254-2700 Customer Service How to Reach Us For more information regarding the City of Arcadia’s utility billing and payment options please visit www.ArcadiaCA.gov/utilityrates or contact us at the following: Utility Billing wb@ArcadiaCA.gov (626) 254-2700 Public Works Services Department publicworks@ArcadiaCA.gov (626) 254-2700 Water Conservation publicworks@ArcadiaCA.gov (626) 574-3000 Other Utility Services Charges Service Fees adopted April 2025/ ResoluƟon No. 7628 Service Fee Water Meter Re-Read 1st = No Charge; 2nd in a year =$61.00 Water Meter Turn-Off/On for Property Repairs 1st = No Charge; 2nd in a year =$61.00 Water Meter Turn-On after Services Turned Off (change of ownership/transfer) $122.00 per account; $305.00 after hours Water Turn-Off Notice for Failure to Test Backflow Prevention Device $141.00 Water Turn-Off / Turn-On for Non-payment $159.00 during business hours; $305.00 after business after hours; * plus 2x monthly water rate for delinquent accounts Unauthorized Use of Fire Hydrant $147.00 plus cost of water used Hydrant Flow Test (Performed with Water Model) $285.00 per test Hydrant Flow Test (Performed in Field) $471.00 per test Flow Test Meter or Meter Accuracy Test $219.00 per test Request to Check Water Quality $287.00 plus Laboratory Costs Standpipe Inspection $275.00 Bacteriological Test for New Development $122.00 plus laboratory costs Backflow Test and Inspection (New Construction) $273.00 Backflow Administrative Fee $43.00 annual fee CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX N ORDINANCE NO. 2327 AND RESOLUTION NO. 7430 CITY OF ARCADIA 2025 URBAN WATER MANAGEMENT PLAN APPENDIX O RESOLUTION ADOPTING 2025 UWMP AND WSCP